A one-tube detection system based on cas protein modification and application thereof
By inserting the antigenic epitope GCN4 into the Cas protein and binding to the scFv-Rad51 protein, the cleavage function of Cas12a is regulated, realizing a one-tube simultaneous reaction for CRISPR-Cas12a detection. This solves the problems of long detection time and complex operation, and enables rapid and highly sensitive nucleic acid detection.
Patent Information
- Application Number
- CN202510316812.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-18
- Publication Date
- 2026-05-19
- Estimated Expiration
- 2045-03-18
AI Technical Summary
Existing CRISPR-Cas12a detection methods are two-step methods, which have problems such as long detection time, easy contamination and complicated operation. In addition, the one-tube detection system has compatibility issues between RPA amplification and Cas12a cutting, making it difficult to achieve rapid, simple and highly sensitive detection.
By inserting the antigenic epitope GCN4 at the RuvC protein active site of the Cas protein, its cis-cleavage activity is weakened, and it combines with the scFv-Rad51 protein to form the Cas12a-GCN4-scFv-Rad51 complex, thereby regulating its cis- and trans-cleavage functions and enabling RPA amplification and CRISPR cleavage to be performed simultaneously in the same tube.
It enables rapid, simple, and highly sensitive nucleic acid detection, significantly improving the sensitivity and applicability of the detection system. It can accurately identify samples at the level of a single copy and is suitable for POCT detection.
Smart Images

Figure CN120098966B_ABST
Abstract
Description
Technical Field
[0001] This application relates to the field of biodetection technology, and in particular to a one-tube detection system based on Cas protein modification and its application. Background Technology
[0002] In recent decades, there has been an urgent need to develop a rapid, sensitive, and accurate detection method to promptly detect viral infections in their early stages and reduce the risk of disease transmission. Currently, most early diagnosis still relies on quantitative real-time PCR and tissue / cell microscopy, but these methods are typically time-consuming, labor-intensive, and dependent on specialized operators and laboratory equipment. For special scenarios lacking specialized equipment, such as resource-scarce mountainous areas, traditional detection methods are unsuitable for the screening needs of point-of-care testing (POCT).
[0003] Recombinase polymerase amplification (RPA) technology, using enzymes with different properties and specific primers, can achieve efficient nucleic acid amplification under isothermal conditions of 37–42°C. It is simple to operate and, when combined with fluorescent probes or lateral flow assays (LFA), is more suitable for point-of-care testing (POCT) compared to traditional quantitative PCR. However, both probe and strip methods require expensive specific probes, resulting in high detection costs. Furthermore, RPA amplification has low specificity, easily leading to false positives and unstable results.
[0004] CRISPR (Clustered Regularly Interspaced Palindromic Repeat) is an acquired immune system found in bacteria and archaea. This system, guided by guide RNA, specifically targets complementary nucleotide sequences. After the CRISPR-Cas12a protein specifically binds to and cleaves the target DNA, its non-specific trans-cleavage activity is activated, allowing it to cleave surrounding ssDNA. Utilizing this property of the Cas12a protein, combining RPA isothermal amplification with Cas12a cleavage offers several advantages: firstly, the specific recognition and cleavage of RPA amplification products by Cas12a increases detection specificity; secondly, the trans-cleavage activity of CRISPR-Cas12a can trans-cleave a large number of ssDNA probes in a short time, thereby amplifying the signal and improving detection sensitivity. Based on this principle, the DETECTR detection method has been developed, and this technology has been successfully applied to the detection of various viruses.
[0005] However, the DETECTR detection method is a two-step reaction involving RPA pre-amplification followed by CRISPR cutting. This method requires setting a specific RPA amplification time, resulting in a relatively long overall detection time. Secondly, the transfer of RPA amplification products and the subsequent capping operation greatly increase the possibility of contamination and false positives. Later, scientists developed a method where the RPA amplification system is added to the bottom of the tube and the CRISPR cutting system to the cap. While this method can mitigate the risk of contamination to some extent, it is still a traditional two-step detection method and requires highly skilled technicians, lacking universal applicability.
[0006] To address this challenge, scientists have focused on developing "one-tube" detection methods, meaning that DNA amplification and CRISPR-mediated cleavage occur simultaneously within a single reaction tube. This integrated approach aims to simplify workflows and make diagnostic procedures more suitable for point-of-care testing (POCT) applications. However, the development process faces significant challenges because highly sensitive Cas12a can rapidly cleave dsDNA substrates and single-stranded ssDNA primers. RPA amplification competes with Cas12a cleavage, resulting in an imbalance between RPA product accumulation and Cas12a cleavage. In one-tube reactions, insufficient RPA product accumulation leads to extremely poor detection capabilities (Lin, M., 2022). Current reports have described one-tube detection systems utilizing suboptimal protospacer-jacent motifs (subPAMs), which reduce Cas12a binding affinity and minimize cis-cleavage (Lu, S., 2022). However, the variety of subPAMs necessitates extensive screening, and this method is not applicable to other Cas variants, such as Cas12b. Other scientists have developed PAM-less strategies to reduce Cas12a cis-cutting using PAM-free constraints (Ding, X., 2020), but this approach also faces scalability and adaptability challenges in other CRISPR detection systems.
[0007] Therefore, developing a universal and universally applicable single-tube detection system that can be adapted to different Cas systems is crucial for advancing CRISPR-Cas12a-based diagnostics. Summary of the Invention
[0008] The purpose of this application is to overcome the incompatibility problem between RPA amplification and Cas12a cleavage in the aforementioned one-tube method, and to provide a one-tube detection system based on Cas protein modification and its application. This application innovatively starts with the Cas protein, modifying it through protein engineering strategies to successfully overcome the competition between RPA amplification and Cas protein cleavage. Furthermore, this application names this Cas protein-modified one-tube detection system ECOT (Engineered Cas12a for One-pot Test). This detection system features rapid response, high sensitivity, high reliability, and ease of operation, and has significant practical implications for the detection, prevention, and treatment of early infections.
[0009] To achieve the above objectives, the technical solution adopted in this application is as follows:
[0010] This application provides a Cas protein with an inserted antigenic epitope, which weakens the cis-cleavage activity of the Cas protein.
[0011] This application inserts an antigenic epitope into the Cas protein. After modification, the Cas protein exhibits weakened cis-cleavage activity, which allows RPA amplification products to accumulate, thereby continuously activating the lateral cleavage activity of the Cas protein.
[0012] In a preferred embodiment of the Cas protein described in this application, the Cas protein is:
[0013] An antigenic epitope is inserted after the RuvC protein active site of the Cas protein, thereby weakening the cis-cleavage activity of the Cas protein.
[0014] Inserting an antigenic epitope after the RuvC protein active site of the aforementioned Cas protein can better weaken the cis-cleavage activity of the Cas protein.
[0015] As a preferred embodiment of the Cas protein described in this application, an antigenic epitope is inserted after the active site of the RuvC protein, which has at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2, thereby weakening the cis-cleavage activity of the Cas protein.
[0016] In a preferred embodiment of the Cas protein described in this application, the antigenic epitope includes GCN4.
[0017] This application modifies a protein based on LtCas12a or LbCas12a protein (amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2), or proteins with at least 80% homology to LtCas12a or LbCas12a protein (including FnCas12a, AsCas12a, LbCas12a and their various variants): The antigenic epitope GCN4 is inserted after the active site of the RuvC protein to obtain the Cas protein of this application. The insertion of GCN4 affects the overall cis-cleavage of the Cas protein. Secondly, the insertion of GCN4 endows the Cas protein with antigen recognition ability. This Cas protein has dual regulation of cis and trans-cleavage functions, which can overcome the incompatibility between RPA amplification and Cas protein cleavage, and is beneficial for rapid detection of RPA-Cas12a.
[0018] This application utilizes LtCas12a, a protein with independent intellectual property rights, as a CRISPR cleavage tool. Testing showed that LtCas12a's editing efficiency is comparable to the commonly used LbCas12a, and it also possesses non-specific ssDNA trans-cleavage capability, recognizing PAM as TTNA. Compared to TTTV recognized by LbCas12a, its target range is broader. Therefore, the Cas protein in this application can serve as a potential foundational tool for developing one-tube HPV detection, providing a new detection tool for the subsequent development of HPV in vitro diagnostic reagents.
[0019] In a preferred embodiment of the Cas protein described in this application, the Cas protein is (a) or (b):
[0020] (a): An antigenic epitope GCN4 is inserted after glycine at position 372 and threonine at position 1183 in an amino acid sequence that has at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced cis-cleavage activity.
[0021] (b): An antigenic epitope GCN4 is inserted after the positions of serine at position 1119, leucine at position 371, cysteine at position 965, and asparagine at position 825 in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 2 to form a protein with reduced cis-cleavage activity.
[0022] In the technical solution of this application, the Cas protein is screened at multiple sites, for example, the antigenic epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in the LtCas12a protein or a protein that has at least 80% homology with the LtCas12a protein.
[0023] Alternatively, the Cas protein of this application can be obtained by inserting the antigenic epitope GCN4 after the positions of serine (position 1119), leucine (position 371), cysteine (position 965), and asparagine (position 825) in the LbCas12a protein, or a protein with at least 80% homology to LbCas12a. Inserting the antigenic epitope GCN4 into the Cas protein endows it with antigen recognition capabilities, enabling it to specifically bind to scFv antibodies via GCN4, introducing Rad51 protein into a one-tube assay system and enhancing its trans-cleavage ability. Therefore, this modification strategy of inserting the antigenic epitope GCN4 into the Cas protein achieves dual regulation of both cis and trans-cleavage functions. The resulting Cas protein can overcome the incompatibility between RPA amplification and Cas protein cleavage, which is beneficial for rapid RPA-Cas12a detection.
[0024] In a preferred embodiment of the Cas protein described in this application, the Cas protein is (a) or (b):
[0025] (a): An antigenic epitope GCN4 is inserted after glycine at position 372 and threonine at position 1183 in an amino acid sequence that has at least 90% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced cis-cleavage activity.
[0026] (b): An antigenic epitope GCN4 is inserted after the positions of serine at position 1119, leucine at position 371, cysteine at position 965, and asparagine at position 825 in an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 2 to form a protein with reduced cis-cleavage activity.
[0027] In some specific embodiments, the Cas protein is (a) or (b):
[0028] (a): An antigenic epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced cis-cleavage activity.
[0029] (b): An antigenic epitope GCN4 is inserted after the positions of serine at position 1119, leucine at position 371, cysteine at position 965, and asparagine at position 825 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% homology with the amino acid sequence shown in SEQ ID NO: 2, to form a protein with reduced cis-cleavage activity.
[0030] As a preferred embodiment of the Cas protein described in this application, the Cas protein is (1) or (2):
[0031] (1) Proteins with amino acid sequences as shown in SEQ ID NO: 1-8;
[0032] (2) A protein derived from (a) whose amino acid sequence in (a) has been substituted, deleted or added at least one amino acid and whose ability to cis-cleave protein has been reduced.
[0033] This application preferably uses the above-mentioned Cas protein with weakened cis-cleavage ability, overcoming the incompatibility problem between RPA amplification and CRISPR cleavage in the one-tube method.
[0034] Specifically, an antigenic epitope GCN4 is inserted after the glycine position at position 372 in the amino acid sequence shown in SEQ ID NO: 1 to obtain Lt-G372-GCN4 (amino acid sequence as shown in SEQ ID NO: 3); an antigenic epitope GCN4 is inserted after the glycine position at position 1183 in the amino acid sequence shown in SEQ ID NO: 1 to obtain Lt-T1183-GCN4 (amino acid sequence as shown in SEQ ID NO: 4).
[0035] Experiments showed that the cis-cleavage ability of modified Cas proteins (such as Lt-G372-GCN4 and Lt-T1183-GCN4) exhibited significant increases and decreases, indicating that protein modification at different amino acid sites alters the overall performance of the Cas protein. Regarding trans-cleavage ability, the antigenic epitope GCN4, after enrichment with Rad51 via antibody scFv, significantly improved the trans-cleavage ability of both Lt-G372-GCN4 and Lt-T1183-GCN4 protein variants. Considering both cis-cleavage and trans-cleavage results, the modified Lt-T1183-GCN4 showed both decreased cis-cleavage ability and increased trans-cleavage ability.
[0036] Specifically, an antigenic epitope GCN4 was inserted after the serine position 1119 in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-S1119-GCN4 (amino acid sequence as shown in SEQ ID NO: 5); an antigenic epitope GCN4 was inserted after the leucine position 371 in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-L371-GCN4 (amino acid sequence as shown in SEQ ID NO: 6); an antigenic epitope GCN4 was inserted after the cysteine position 965 in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-C965-GCN4 (amino acid sequence as shown in SEQ ID NO: 7); and an antigenic epitope GCN4 was inserted after the asparagine position 825 in the amino acid sequence shown in SEQ ID NO: 2 to obtain Lb-N825-GCN4 (amino acid sequence as shown in SEQ ID NO: 8).
[0037] Modifications at positions L371, C965, and N825 in the amino acid sequence shown in SEQ ID NO: 2 successfully reduced the cis-cleavage activity of the Cas protein, while the insertion at S1119 increased the cis-cleavage activity of the Cas protein.
[0038] This application also provides a nucleic acid molecule that encodes the Cas protein.
[0039] This application also provides an expression vector carrying the nucleic acid molecule.
[0040] This application also provides a host cell comprising the Cas protein, the nucleic acid molecule, or the expression vector described herein.
[0041] This application also provides a one-tube detection system based on Cas protein modification, the one-tube detection system comprising the Cas protein as described above and a single-chain antibody;
[0042] The antigenic epitopes in the Cas protein bind to single-chain antibodies.
[0043] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the one-tube detection system includes an RPA amplification mixture and a CRISPR-Cas12a mixture, wherein the CRISPR-Cas12a mixture includes the Cas protein, crRNA, ssDNA, and scFv-Rad51 protein.
[0044] The ssDNA is a single-stranded DNA with fluorescent and quenching groups modified at both ends, respectively; the crRNA is a specific guide RNA sequence that guides the Cas protein to target and recognize the target product.
[0045] The antigenic epitope GCN4 in the Cas12a protein was enriched in the Rad51 protein using the single-chain antibody scFv.
[0046] This application, based on the concept of antigen-antibody specific binding, introduces the scFv-Rad51 protein into a one-tube assay system. The introduction of scFv-Rad51 enhances the lateral cleavage ability of Cas12a protein. GCN4, through specific binding to scFv, enriches scFv-Rad51, forming the Cas12a-GCN4-scFv-Rad51 complex. In this detection system, Rad51 plays a dual role: First, it binds to the unwinding target DNA, maintaining it in a single-stranded state. This single-stranded target DNA continuously activates the trans-cleavage activity of Cas12a, enhancing reporter cleavage and fluorescence signal release. Second, Rad51 binds to a single-stranded fluorescent probe, enriching the probe near the Cas12a cleavage site through the GCN4-scFv-Rad51-probe interaction. This local enrichment effectively enhances the fluorescence signal, thereby significantly improving detection sensitivity.
[0047] The results showed that scFv-Rad51 can enhance lateral cleavage. In summary, in the one-tube assay system, protein modification reduced cis-cleavage, while the introduction of scFv-Rad51 further enhanced trans-cleavage. This dual optimization significantly improved the detection sensitivity of the one-tube assay system.
[0048] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the amino acid sequence of the scFv-Rad51 protein is shown in SEQ ID NO: 9.
[0049] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the RPA amplification mixture includes upstream primer RPA-F and downstream primer RPA-R for amplifying RPA products.
[0050] In a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the detection target includes nucleic acid molecules, including HPV.
[0051] In a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the HPV is HPV18, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 10, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO: 11;
[0052] Alternatively, the HPV is HPV16, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 12, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO: 13.
[0053] In a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the nucleotide sequence of the ssDNA is 5'FAM-TTATT-BHQ 3';
[0054] And / or, the amino acid sequence of the crRNA includes the amino acid sequence shown in SEQ ID NO: 14 or SEQ ID NO: 15.
[0055] As a preferred embodiment of the one-tube detection system based on Cas protein modification described in this application, the RPA mixture further includes buffer and enzyme-free water.
[0056] Based on the aforementioned Cas proteins, this application develops a highly sensitive and specific one-tube detection system (ECOT-LtCas12a and ECOT-LbCas12a one-tube detection system): the ECOT-LtCas12a one-tube detection system is obtained based on Lt-G372-GCN4 and Lt-T1183-GCN4, and the ECOT-LbCas12a one-tube detection system is obtained based on Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4.
[0057] Experiments show that the one-tube detection system based on Lt-T1183-GCN4 exhibits weak CRISPR cis-cleavage ability in the early stages of the reaction, leading to further RPA amplification and effective accumulation of amplified products. In the later stages, the amplified products accumulated by RPA continuously activate the trans-cleavage activity of Lt-T1183-GCN. However, in the Lt-WT one-tube system, the strong CRISPR-Cas12a substrate cleavage activity prevents the provision of amplification templates for RPA, resulting in no amplified product accumulation and further hindering the continuous activation of CRISPR-Cas12a trans-cleavage activity.
[0058] This application utilizes protein engineering to create the ECOT-LtCas12a system, enabling significantly increased detection sensitivity using canonical PAM crRNAs without any modification to the crRNA. Compared to previous methods that required meticulous design and modification of the crRNA, the protein engineering strategy provides a more efficient and easier-to-implement solution. This protein engineering optimization not only simplifies the detection process but also significantly improves the system's flexibility and applicability, giving it greater application potential.
[0059] Compared to traditional two-step detection methods, the innovative ECOT one-tube detection system developed in this application combines RPA amplification and CRISPR cleavage in the same tube for simultaneous reaction, which not only shortens the detection time but also simplifies the operation and avoids potential contamination from opening the tube. Compared to two other reported one-tube detection systems, ECOT focuses on modifying Cas proteins, significantly improving the detection capability of the one-tube method by altering the cis and trans-cleavage properties of the Cas protein itself. SubPAM crRNAs and PAM-less crRNAs, on the other hand, screen for the performance of PAMs that bind to Cas proteins. These two methods have significant limitations and, after testing, are not applicable to LtCas12a or other CRISPR proteins. The ECOT protein modification strategy in this application not only shows significantly enhanced detection performance on LtCas12a protein but also on LbCas12a protein.
[0060] This application also provides the application of the above-mentioned one-tube detection system based on Cas protein modification in the detection of nucleic acids.
[0061] This application also provides the application of the above-mentioned one-tube detection system based on Cas protein modification in the preparation of nucleic acid detection products.
[0062] The ECOT one-tube detection system possesses high sensitivity and immediacy. The ECOT-LtCas12a and ECOT-LbCas12a one-tube detection methods proposed in this application have been validated and can both be successfully used for the real-time detection of high-risk HPV. The ECOT-LtCas12a system can detect 5×10⁵ HPV within 60 minutes. 2 HPV16 was detected at 1.3 × 10⁻¹¹ copies / μL. 1The ECOT-LbCas12a assay detected HPV16 and HPV18 at levels as low as 3 copies / μL within 30 minutes, far exceeding traditional detection methods and enabling accurate identification in samples as low as a single copy. This application provides two simple, rapid, and on-site one-tube in vitro nucleic acid diagnostic methods, reducing time consumption and operational complexity in laboratory settings. Furthermore, this assay exhibits high specificity and stability, providing reliable results in various practical application scenarios, making it an innovative tool highly suitable for preclinical screening and point-of-care testing.
[0063] Compared with the prior art, this application has the following beneficial effects:
[0064] This application provides a one-tube detection system based on Cas protein modification and its application. Inserting GCN4 into the Cas protein endows it with antigen recognition capabilities. This Cas protein exhibits dual regulation of both cis and trans cleavage functions, overcoming the incompatibility between RPA amplification and Cas protein cleavage, thus facilitating rapid RPA-Cas12a detection. Furthermore, the ECOT-LtCas12a and ECOT-LbCas12a one-tube detection systems obtained based on the above Cas protein modification possess the characteristics of rapid response, high sensitivity, high reliability, and ease of operation. Moreover, the introduction of scFv-Rad51 protein into the one-tube detection system forms a Cas12a-GCN4-scFv-Rad51 complex. In the one-tube system, protein modification reduces cis cleavage, while the introduction of scFv-Rad51 further enhances trans cleavage. This dual optimization significantly improves the detection sensitivity of the one-tube detection system. Attached Figure Description
[0065] Figure 1 This is a schematic diagram of the detection principle of the one-tube detection system based on Cas protein modification in this application;
[0066] Figure 2 Schematic diagram of LtCas12 protein modification;
[0067] Figure 3 A comparison chart of the cis- and anti-cis ...
[0068] Figure 4 The graph shows the fluorescence value of LtCas12 in a single tube and the accumulation of RPA products.
[0069] Figure 5 A comparison diagram of the ECOT-LtCas12a single-tube method system with other methods;
[0070] Figure 6Sensitivity detection diagram of the ECOT-LtCas12a one-tube method system;
[0071] Figure 7 This is a specificity detection diagram of the ECOT-LtCas12a one-tube method system;
[0072] Figure 8 For the establishment of the ECOT-LbCas12a one-tube method system;
[0073] Figure 9 The sensitivity test results for the ECOT-LbCas12a single-tube method system are shown in the figure. Detailed Implementation
[0074] To better illustrate the purpose, technical solution, and advantages of this application, the following description will be provided in conjunction with the accompanying drawings and specific embodiments.
[0075] In the following embodiments, unless otherwise specified, the experimental methods used are conventional methods, and the materials and reagents used are commercially available unless otherwise specified, and the raw materials used in each parallel experiment are the same.
[0076] The following reagents and instruments were used in the embodiments and comparative examples used in this application:
[0077] The RPA isothermal rapid amplification kit (basic type) was purchased from Anpu Future Biotechnology, catalog number: WLB8201KIT (which includes buffer A and buffer B); all primers used in this application were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.; all crRNAs used in this application were synthesized by Suzhou Genewiz Biotechnology Co., Ltd.; all ssDNA probes used in this application (including fluorescent probes and biotin test strip probes) were synthesized by Sangon Biotech Co., Ltd.; all test strips used in this application were from Beijing Baoying Tonghui Biotechnology Co., Ltd.; the fluorescence detector used in this application was the Bio-Rad CFX96 real-time fluorescence detection system.
[0078] LtCas12a is a novel Cas12a protein independently developed by the applicant in the early stage (see Chinese invention patent CN202110325073.8), and its amino acid sequence is SEQ ID NO: 1.
[0079] The amino acid sequence of the LbCas12a (PDB: 5xus) protein is SEQ ID NO: 2.
[0080] This application provides a Cas protein, wherein the Cas protein is:
[0081] An antigenic epitope GCN4 is inserted after the active site of the RuvC protein with an amino acid sequence having at least 80% homology to the amino acid sequence shown in SEQ ID NO: 1 or SEQ ID NO: 2 to form a protein with reduced cis-cleavage activity.
[0082] In some specific embodiments, the Cas protein is (a) or (b):
[0083] (a): An antigenic epitope GCN4 is inserted after glycine at position 372 and threonine at position 1183 in an amino acid sequence that has at least 80% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced cis-cleavage activity.
[0084] (b): An antigenic epitope GCN4 is inserted after the positions of serine at position 1119, leucine at position 371, cysteine at position 965, and asparagine at position 825 in an amino acid sequence having at least 80% homology with the amino acid sequence shown in SEQ ID NO: 2 to form a protein with reduced cis-cleavage activity.
[0085] More preferably, the Cas protein is (a) or (b):
[0086] (a): An antigenic epitope GCN4 is inserted after glycine at position 372 and threonine at position 1183 in an amino acid sequence that has at least 90% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced cis-cleavage activity.
[0087] (b): An antigenic epitope GCN4 is inserted after the positions of serine at position 1119, leucine at position 371, cysteine at position 965, and asparagine at position 825 in an amino acid sequence having at least 90% homology with the amino acid sequence shown in SEQ ID NO: 2 to form a protein with reduced cis-cleavage activity.
[0088] In some specific embodiments, the Cas protein is (a) or (b):
[0089] (a): An antigenic epitope GCN4 is inserted after the glycine at position 372 and the threonine at position 1183 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% or 90% or 91% or 92% or 93% or 94% or 95% or 96% or 97% or 98% or 99% homology with the amino acid sequence shown in SEQ ID NO: 1 to form a protein with reduced cis-cleavage activity.
[0090] (b): An antigenic epitope GCN4 is inserted after the positions of serine at position 1119, leucine at position 371, cysteine at position 965, and asparagine at position 825 in an amino acid sequence having at least 80% or 82% or 85% or 88% or 89% homology with the amino acid sequence shown in SEQ ID NO: 2, to form a protein with reduced cis-cleavage activity.
[0091] In some specific embodiments, the Cas protein is (1) or (2):
[0092] (1) Proteins with amino acid sequences as shown in SEQ ID NO: 3-8;
[0093] (2) A protein derived from (a) whose amino acid sequence in (a) has been substituted, deleted or added at least one amino acid and whose ability to cis-cleave protein has been reduced.
[0094] This application also provides a single-tube detection system based on Cas protein modification (referred to as ECOT single-tube method), the single-tube detection system comprising the Cas protein and a single-chain antibody; the antigenic epitope in the Cas protein binds to the single-chain antibody.
[0095] Preferably, the single-tube detection system includes an RPA amplification mixture and a CRISPR-Cas mixture, wherein the CRISPR-Cas mixture includes the Cas protein, crRNA, ssDNA, and scFv-Rad51 protein;
[0096] The ssDNA is a single-stranded DNA with fluorescent and quenching groups modified at both ends, respectively; the crRNA is a specific guide RNA sequence that guides the Cas protein to target and recognize the target product.
[0097] The antigenic epitope GCN4 in the Cas protein was enriched in the Rad51 protein using the single-chain antibody scFv.
[0098] The amino acid sequence of the scFv-Rad51 protein is shown in SEQ ID NO: 9.
[0099] The RPA amplification mixture includes upstream primer RPA-F and downstream primer RPA-R for amplifying the RPA product. The RPA amplification mixture also includes buffer and enzyme-free water.
[0100] The detection principle of the ECOT single-tube method described above is as follows: Figure 1 As shown.
[0101] In the following examples, high-risk HPV types (HPV16 and HPV18) associated with the occurrence of cervical cancer were selected as the detection targets.
[0102] Example 1: A Cas protein and its construction method
[0103] This application uses AlphaFold 3 to predict the protein structure of LtCas12a and selects two amino acid sites near the active site of RuvC protein, G372 and T1183, for protein modification. Antigenic epitope GCN4 is inserted after G372 and T1183 sites, respectively, to modify Lt-G372-GCN4 (the amino acid sequence is shown in SEQ ID NO: 3) and Lt-T1183-GCN4 (the amino acid sequence is shown in SEQ ID NO: 4).
[0104] This application modifies the LbCas12a (PDB: 5xus) protein structure, which already has a well-defined structure, by inserting the antigenic epitope GCN4 after four amino acid sites—S1119, L371, C965, and N825—at the active site of the RuvC protein, thus creating Lb-S1119-GCN4 (amino acid sequence as shown in SEQ ID NO: 5), Lb-L371-GCN4 (amino acid sequence as shown in SEQ ID NO: 6), Lb-C965-GCN4 (amino acid sequence as shown in SEQ ID NO: 7), and Lb-N825-GCN4 (amino acid sequence as shown in SEQ ID NO: 8). The unmodified Cas12a is referred to as Cas12a-WT (i.e., Lt-WT or wild-type LtCas12a, amino acid sequence as shown in SEQ ID NO: 1).
[0105] Example 2: Comparison of cis-cutting capability, anti-cutting capability, and single-tube detection capability of Lt-G372-GCN4 and Lt-T1183-GCN4
[0106] The purpose of this embodiment is to compare the cis-cleavage ability, trans-cleavage ability, and single-tube detection ability of Lt-G372-GCN4 and Lt-T1183-GCN4 modified at the G372 and T1183 sites with Cas12a-WT. The primer sequences used in this embodiment are shown in Table 1. This embodiment uses HPV16 and HPV18 as detection targets.
[0107] (1) LtCas12a protein structure prediction:
[0108] like Figure 2 This application predicts and distinguishes the functional domains of the LtCas12a protein through sequence alignment. Figure 2-A). AlphaFold 3 was used to predict the protein structures following the insertion of the antigenic epitope GCN4 after sites G372 and T1183, respectively. Figure 2 -B、 Figure 2 -C).
[0109] (2) Expression and purification of LtCas12a and scFv-Rad51 proteins:
[0110] The nucleotide sequences encoding Lt-WT, Lt-G372-GCN4, Lt-T1183-GCN4 proteins, and scFv-Rad51 protein were cloned into the psumo prokaryotic protein expression vector to construct recombinant plasmids capable of expressing the proteins. These plasmids were then transformed into DE3-codon competent cells. After Kana resistance selection, single colonies were picked and cultured in Kana-resistant medium for expansion. When the OD600 of the bacterial culture reached 0.6-0.8, IPTG was added to a final concentration of 0.1 mM, and induction culture was continued for 18-20 h. The bacterial pellet was collected by centrifugation, resuspended with lysis buffer, and then subjected to high-pressure lysis and ultrasonic disruption followed by centrifugation. The pellet was purified sequentially by Ni column affinity chromatography and molecular sieve filtration. Finally, the target protein was eluted with 250 mM imidazole, identified by SDS-PAGE electrophoresis, and the final protein concentration was determined. The pellets were then rapidly frozen in liquid nitrogen and stored at -80°C for later use.
[0111] (3) Preparation of HPV16 and HPV18 targets:
[0112] In this embodiment, the L1 regions of high-risk HPV16 and HPV18 are used as target regions. The HPV16-L1 and HPV18-L1 regions were cloned into the PXZ vector using the Gibson method. Sanger sequencing confirmed correct cloning, yielding the PXZ-HPV16-L1 and PXZ-HPV18-L1 plasmids, which serve as the target substrates for HPV16 and HPV18 in this application, respectively. Qubit quantification and copy number calculations were performed.
[0113] (4) Comparison of cis-cutting capabilities of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4:
[0114] In this embodiment, human codons were optimized for three proteins: Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4. The corresponding nucleotide sequences were cloned into the PX330 eukaryotic expression vector to obtain the PX330-LtCas12a eukaryotic expression plasmid. crRNA plasmids were constructed targeting the three endogenous CDKN2A, DYRK1A, and RUNX1 genes, respectively. Simultaneously, the PX330-LtCas12a plasmid and crRNA plasmid were co-transfected into healthy HEK293T cells. After 72 hours, DNA was extracted from the cells. Primers were designed upstream and downstream of the target sites for high-throughput sequencing. Cis-cleavage ability (e.g., [missing information]) was detected by amplicon assay. Figure 3 , Figure 3 -A). The target sequences of the three endogenous genes are shown in Table 1.
[0115] Table 1 Endogenous gene target sequences
[0116] CDKN2A gccccaataatccccacatgtca DYRK1A gaagcacatcaaggacattctaa RUNX1 ttctcccctctgctggatacctc
[0117] (5) Comparison of the reverse cutting capabilities of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4:
[0118] Cas12a’s trans-cleavage ability can non-specifically cleave ssDNA. In this example, an ssDNA reporter molecule modified with fluorescent and quenching groups, 5'FAM-TTATT-BHQ 3', was used as a fluorescent probe. Fluorescence signals were collected on a Bio-Rad quantitative fluorescence instrument, and the trans-cleavage ability of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4 was compared by the intensity of the fluorescence signals. The stronger the fluorescence signal, the stronger the trans-cleavage ability.
[0119] The following reaction was performed: 500 nM Cas12a protein (one of Lt-WT, Lt-G372-GCN4, or Lt-T1183-GCN4), 1000 nM Lt-HPV16-crRNA1 (sequence shown in Table 3) or 1000 nM Lt-HPV18-crRNA1 (sequence shown in Table 3), 2 μL 10x buffer 3.1, and 500 nM scFv-Rad51 protein (amino acid sequence shown in SEQ ID NO: 9) were incubated at room temperature for 10 min to form the RNP complex (Cas12a-GCN4-scFv-Rad51 complex). Figure 3 -B), then add 1000 nM ssDNA fluorescent probe and enzyme-free water in sequence, and finally add 5 × 10 10HPV18 plasmid copies / μL were added to make a total volume of 20 μL. After brief centrifugation, the sample was quickly placed on a Bio-Rad quantitative PCR instrument, and fluorescence values were collected every 3 min at 480 nm for a total of 90 min. Figure 3 -C).
[0120] (6) Comparison of the single-tube detection capabilities of Lt-WT, Lt-G372-GCN4, and Lt-T1183-GCN4:
[0121] The one-tube method involves simultaneous RPA amplification and LtCas12a cleavage in the same tube. The reaction system and procedure used in this application are as follows: buffer A 29.4 μL, buffer B 2 μL, upstream primer 2 μL, downstream primer 2 μL, and enzyme-free water 7 μL. To conserve reagents, this application divides one RPA amplification system into four equal parts, i.e., four 10 μL reaction systems, which are then sequentially reacted with the RNP complex at the same final concentration as described above, and 5 x 10 μL of enzyme-free water. 5 Add copies / μL of HPV16 or HPV18 template, then add the fluorescent probe, and bring the total volume to 20μL with enzyme-free water. Quickly place the sample on a Bio-Rad quantitative PCR instrument to read the fluorescence value. Figure 4 -A). The primer sequences used in this embodiment are shown in Table 2.
[0122] Table 2 Primer sequences used in this embodiment
[0123]
[0124] Table 3. The crRNA sequences used in this embodiment.
[0125]
[0126] (7) Single-tube method for detecting amplification product accumulation:
[0127] As mentioned earlier, in the one-tube reaction system, RPA amplification and LtCas12a cleavage compete with each other, and ultimately the detection capability of the one-tube method depends on whether the system can accumulate enough amplification products as cleavage substrates for LtCas12a.
[0128] This embodiment detects the accumulation of amplification products in the L-WT and Lt-T1183-GCN4 one-tube reaction systems at different time points. Specifically, in this embodiment, 3 volumes of phenol-chloroform were added to the one-tube reaction system after 15 min, 18 min, 21 min, 24 min, 27 min, and 30 min of reaction. After centrifugation at 5000 rpm for 5 min, 10 μL of supernatant was collected, and 2 μL of 6x DNA Loading was added. The accumulation of amplification products was detected by agarose gel electrophoresis. Figure 4 -B, such as Figure 4 (As shown).
[0129] Results analysis:
[0130] This embodiment illustrates the advantages of the one-tube detection system based on Cas protein modification in this application. Experiments were conducted to compare the detection capabilities from three dimensions: cis-cutting capability, isolated trans-cutting capability, and one-tube capability.
[0131] Regarding cis-cleavage ability, compared with Lt-WT, the modified Lt-G372-GCN4 and Lt-T1183-GCN4 showed significant increases and decreases, respectively, indicating that protein modification at different amino acid sites alters the overall protein performance. Figure 3 -A). Regarding trans-cleavage ability, the antigenic epitope GCN4, after being enriched with Rad51 by antibody scFv, significantly enhanced the trans-cleavage ability of both Lt-G372-GCN4 and Lt-T1183-GCN4 protein variants. Figure 3 -C).
[0132] Based on the combined results of cis- and anti-cis ... Figure 4 As shown in -A, the fluorescence results show that the Lt-T1183-GCN4 one-tube method is indeed significantly better than the Lt-WT one-tube method, and obvious fluorescence accumulation can be observed over time.
[0133] To further illustrate the detection principle of the single-tube detection system using Lt-T1183-GCN4, this embodiment detects the accumulation changes of amplification products at different time points during a single-tube reaction.
[0134] like Figure 4As shown in Figure -B, the one-tube detection system using Lt-T1183-GCN4 began accumulating amplified products after 18 minutes, while Lt-WT showed no significant accumulation of amplified products even after 30 minutes. Therefore, this application suggests that the weaker CRISPR cis-cleavage ability of Lt-T1183-GCN4 in the early stages of the one-tube detection system allows for further RPA amplification and effective product accumulation. In the later stages of the reaction, the accumulated amplified products from RPA continuously activate the trans-cleavage activity of Lt-T1183-GCN. In contrast, the one-tube detection system using Lt-WT exhibits strong CRISPR-Cas12a substrate cleavage activity, failing to provide an amplification template for RPA, resulting in no product accumulation and further hindering the continuous activation of CRISPR-Cas12a trans-cleavage activity. Therefore, unmodified LtCas12a is unsuitable for one-tube detection. This application designates the single-tube detection system mediated by Engineered-Lt-T1183-GCN4 as the ECOT-LtCas12a system (abbreviated as ECOT-Lt).
[0135] Example 3: Fluorescence detection using the ECOT-LtCas12a system
[0136] Previous studies have shown that using subPAM crRNAs or PAM-less crRNAs in the Cas12a one-tube assay system can improve the sensitivity of the one-tube assay. Therefore, this application compares the performance of the ECOT-LtCas12a system with one-tube assay systems mediated by subPAM crRNAs and PAM-less crRNAs.
[0137] like Figure 5 As shown, this embodiment designed 3 canonical PAM crRNAs, 5 subPAM crRNAs, and 3 PAM-less crRNAs for the HPV18-L1 region. Figure 5 -A), the fluorescence value was detected using the single-tube method with ECOT-Lt and Lt-WT respectively.
[0138] The crRNA sequences used in this embodiment are shown in Table 4.
[0139] Table 4 shows the crRNA sequences used in this embodiment.
[0140]
[0141] This example compares the performance of the ECOT-Lt and Lt-WT systems with canonical PAMcrRNAs, subPAM crRNAs, and PAM less crRNAs targeting the HPV18-L1 region. First, the Lt-T1183-GCN4 and Lt-WT systems showed very low fluorescence values when binding to both subPAM crRNAs and PAM less crRNAs. Figure 5 -B to 5-E) indicates that the one-tube detection method for subPAMcrRNAs and PAM less crRNAs is not applicable to LtCas12a.
[0142] Secondly, the fluorescence values of the Lt-T1183-GCN4-mediated ECOT-Lt system binding canonical PAM crRNAs were significantly higher than those binding subPAM crRNAs and PAM less crRNAs. This indicates that in the protein-engineered ECOT-Lt system, high detection sensitivity can be achieved using canonical PAM crRNAs without any modification to the crRNAs. This finding highlights the advantages of protein engineering strategies in improving sensitivity, avoiding the complexity of modifying crRNAs, thus simplifying the detection process and ensuring high sensitivity and reproducibility, further emphasizing the application potential of protein engineering methods in one-tube detection.
[0143] Example 4: Detection sensitivity and specificity of the ECOT-Lt single-tube method system
[0144] Early detection of HPV infection is extremely important for the prevention and treatment of cervical cancer. Based on the ECOT-Lt one-tube method established in Example 2, the detection rate of serially diluted HPV18 and HPV16 was 1×10⁻⁶. 0 copies / μL-1×10 5 Five plasmids at concentration gradients of 5 copies / μL were used as templates to evaluate the sensitivity of this method. The plasmid dilution method was as described in Example 2. The crRNA sequences used in this example are shown in Table 3.
[0145] (1) Sensitivity of the ECOT-Lt one-tube method system by fluorescence value detection:
[0146] The fluorescence detection method is as described in Example 2(6). Gradual dilutions of HPV18 and HPV16 plasmids were used as templates, and two groups, ECOT-Lt and Lt-WT, were set up for comparison.
[0147] Results analysis:
[0148] like Figure 6As shown, in HPV16 testing, the ECOT-Lt group showed results at 5×10⁻⁶. 2 copies / μL, 5×10 3 copies / μL, 5×10 4 Significant fluorescence accumulation was detected in the Lt-WT group at template concentrations of 5 × 10⁻⁶ copies / μL; the Lt-WT group only showed fluorescence accumulation at 5 × 10⁻⁶ copies / μL template concentration. 3 copies / μL, 5x10 4 Fluorescence was detected in the template concentration of copies / μL, and the fluorescence intensity was much lower than that of the ECOT-Lt group ( Figure 6 -A). This indicates that ECOT-Lt, compared to Lt-WT, can detect fluorescence accumulation at relatively low HPV copy numbers. In HPV18 detection, the ECOT-Lt group showed fluorescence accumulation at 1.3 × 10⁻⁶. 1 Significant fluorescence accumulation was detected at template concentrations of copies / μL; however, no fluorescence was detected in the Lt-WT group at any of the five set concentration gradients. Figure 6 -C).
[0149] (2) Sensitivity of the ECOT-Lt single-tube method system was tested using LFA:
[0150] This embodiment establishes the sensitivity of the ECOT-Lt system for visual detection using LFA. The principle of this experiment is as follows: colloidal gold particles labeled with anti-FAM antibody are coated on the binding pad. LFA has a lower control line (C line) and an upper detection line (T line). Figure 6 -B), the C line is coated with streptavidin, which can bind to biotin, and the T line is coated with goat anti-mouse secondary antibody. The ssDNA reporter molecule used in this system is 5'FAM-TTTTTTTATTTTTTT-biotin 3'. When the CRISPR system does not cleave the ssDNA reporter molecule, it remains intact and can capture all the colloidal gold at the C line. When the ssDNA reporter molecule is cleaved by CRISPR, the colloidal gold, lacking biotin, cannot be trapped at the C line and can flow to the T line, where it binds to the anti-FAM secondary antibody coated at the T line, resulting in color development. Therefore, the presence or absence of the T line can indicate whether cleavage has occurred, and the intensity of the T line can be used to determine the detection sensitivity of the one-tube method.
[0151] Results analysis:
[0152] In HPV16 and HPV18 detection, Lt-WT failed to detect the T-line in all five concentration gradients, while the ECOT-Lt system detected the T-line at 5 × 10⁻⁶ concentrations. 2 HPV16 was detected at 1.3 × 10⁻¹¹ copies / μL. 1HPV18 was detected at copies / μL. Combined with the fluorescence value experiments in this embodiment, it demonstrates that the sensitivity of the ECOT-Lt system is significantly higher than that of the Lt-WT system, with a detection limit of 5 × 10⁻⁶ for HPV16. 2 copies / μL ( Figure 6 -B), the limit of detection for HPV18 is 1.3 × 10⁻⁶. 1 copies / μL ( Figure 6 -D).
[0153] (3) Specificity detection of the ECOT-Lt single-tube method:
[0154] Following the method described in Example 4, the plasmid templates for HPV16, HPV18, HPV31, HPV33, HPV35, HPV39, HPV45, HPV51, HPV52, HPV56, HPV58, HPV59, and HPV68 were all diluted to 5x×10⁻⁶. 5 copies / μL. Fluorescence values and the specificity of the ECOT-Lt one-tube method were tested using the method described in Example 4.
[0155] The results show:
[0156] like Figure 7 As shown, in the fluorescence value experiment, the ECOT-Lt one-tube method system could only detect HPV16 and HPV18 in systems containing HPV18 and HPV16, respectively. Figure 7 -B); LFA can only detect T-lines of HPV16 and HPV18 ( Figure 7 -A); Neither test could detect other similar HPV genotypes, indicating that the ECOT-Lt tube method system of this application has good specificity.
[0157] Example 5: Cis-cutting capability and single-tube detection capability of Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4
[0158] Example 1 designed four LbCas12a variants (Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4), as follows: Figure 8 -A.
[0159] The purpose of this embodiment is to compare the cis-cleavage ability and single-tube detection ability of four LbCas12a variants. In this embodiment, three canonical PAM crRNAs and four subPAM crRNAs were designed for the HPV18-L1 region. The crRNA sequences used in this embodiment are shown in Table 5. The results are as follows: Figure 8 As shown.
[0160] (1) Comparison of cis-cutting capabilities of LbCas12a:
[0161] The cis-cleavage ability of Lb-WT (unmodified wild-type LbCas12a) and the protein-modified Lb-S1119-GCN4, Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 was evaluated using the high-throughput amplicon sequencing method described in Example 2(4). The target sequences of the three endogenous genes used in this example are shown in Table 1.
[0162] The results showed that modifications at L371, C965, and N825 successfully reduced cis-cutting activity, while insertion at S1119 increased cis-cutting activity. Figure 8 These findings provide promising directions for the modification of the LbCas12a protein, particularly for the Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 variants, where attenuated cis-cleavage may improve its detection capability in one-tube assays, a key property for sensitive one-tube detection.
[0163] (2) Comparison of single-tube detection capabilities of LbCas12a:
[0164] To determine the one-tube detection capability of these engineered LbCas12a variants compared to Lb WT, this example used canonical PAM crRNAs to detect HPV18. The results showed that Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 produced significantly higher fluorescence signals than Lb-WT, indicating that the one-tube detection performance of these three modified variants was significantly improved. Figure 8 This enhancement is consistent with observations from the ECOT Lt system, further demonstrating the general applicability of the ECOT strategy in improving CRISPR-based diagnostics.
[0165] Subsequently, this embodiment explored the synergistic effect of binding these engineered LbCas12a variants to subPAM crRNAs, a strategy previously shown to improve the one-pot sensitivity of LbCas12a. Compared to canonical PAM crRNAs, the Lb-WT, Lb-L371-GCN4, Lb-C965-GCN4, and Lb-N825-GCN4 variants exhibited higher fluorescence intensity when paired with subPAM crRNAs. Figure 8 -C). In contrast, Lb-S1119-GCN4 performed poorly regardless of the crRNA type used, likely due to its excessively high cis-cleavage activity, resulting in insufficient amplification product in a single reaction. Importantly, the Lb-C965-GCN4 variant reached maximum fluorescence within just 30 minutes, with subPAM-2crRNA exhibiting 5.2-fold and 8.3-fold higher fluorescence compared to Lb-WT, respectively. Figure 8 -C). This application names this combination of the Lb-C965-GCN4 variant and subPAM crRNAs as the ECOT-LbCas12a one-tube detection system. The crRNA sequences used in this embodiment are shown in Table 5.
[0166] Table 5. The crRNA sequences used in this embodiment.
[0167]
[0168] Example 6: Sensitivity Detection of the ECOT-LbCas12a One-Pipe Detection System
[0169] Referring to Example 4, this application uses the LFA visualization detection of the ECOT-LbCas12a one-tube detection system. Similarly, serially diluted HPV16 and HPV18 plasmids are used as detection templates. The detection limit of ECOT-LbCas12a is determined by the presence or absence of color development at the T line on the test strip. The reaction system used in this example is as follows: the RPA amplification system is as shown in Example 2 (6), and the CRISPR system consists of 500 nM Lb-C965-GCN4 protein, 1000 nM HPV16 or HPV18 crRNA, 2 μL 10x buffer 3.1, and 50 nM scFv-Rad51 protein, incubated at room temperature for 10 min to form an RNP complex ( Figure 3Add 1000 nM ssDNA fluorescent probe and enzyme-free water sequentially, then add serially diluted HPV16 and HPV18 plasmids to a total volume of 20 μL. After brief centrifugation, quickly place the mixture in a PCR instrument at 37 degrees Celsius for 30 min. Take 10 μL of the reaction solution, dilute it with 90 μL of water, and observe the color using test strips. The crRNA sequences used in this example are shown in Table 6.
[0170] Table 6 shows the crRNA sequences used in this embodiment.
[0171]
[0172] The results are as follows Figure 9 As shown, the EECOT-LbCas12a single-tube detection system can detect 3×10⁻⁶ samples within 30 minutes. 0 HPV16 copies / μL ( Figure 9 -A) and HPV18 ( Figure 9 -B).
[0173] These results indicate that, firstly, the engineered ECOT-LbCas12a one-tube detection system exhibits higher sensitivity, and the ECOT protein modification strategy is applicable to various CRISPR systems, demonstrating broad applicability. Secondly, the ECOT-LbCas12a one-tube detection system has a faster response time, completing in vitro detection in just 30 minutes, making it ideal for point-of-care testing (POCT) and home self-testing.
[0174] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of this application and are not intended to limit the scope of protection of this application. Although this application has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of this application without departing from the substance and scope of the technical solutions of this application.
Claims
1. A Cas protein, characterized in that, The Cas protein is a protein with reduced cis-cleavage activity formed by inserting the antigenic epitope GCN4 after the threonine position at position 1183 of the amino acid sequence shown in SEQ ID NO:
1. The amino acid sequence of the Cas protein is shown in SEQ ID NO:
4.
2. A nucleic acid molecule, characterized in that, The nucleic acid molecule encodes the Cas protein as described in claim 1.
3. A one-tube detection system based on modified Cas protein, characterized in that, The single-tube detection system includes an RPA amplification mixture and a CRISPR-Cas mixture; The CRISPR-Cas mixture comprises the Cas protein, crRNA, ssDNA, and scFv-Rad51 protein as described in claim 1; The ssDNA is a single-stranded DNA with fluorescent and quenching groups modified at both ends, respectively; the crRNA is a specific guide RNA sequence that guides the Cas protein to target and recognize the target product. The antigenic epitope GCN4 in the Cas protein was enriched in the Rad51 protein using the single-chain antibody scFv.
4. The one-tube detection system based on Cas protein modification as described in claim 3, characterized in that, The detection targets include nucleic acid molecules, including HPV.
5. The one-tube detection system based on Cas protein modification as described in claim 4, characterized in that, The RPA amplification mixture includes upstream primer RPA-F and downstream primer RPA-R for amplifying RPA products; The HPV is HPV18, and the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 10, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO: 11; Alternatively, the HPV is HPV16, the nucleotide sequence of the upstream primer RPA-F is shown in SEQ ID NO: 12, and the nucleotide sequence of the downstream primer RPA-R is shown in SEQ ID NO:
13.
6. The one-tube detection system based on Cas protein modification as described in claim 3, characterized in that, The nucleotide sequence of the ssDNA is 5'FAM-TTATT-BHQ 3'.
7. The one-tube detection system based on Cas protein modification as described in claim 3, characterized in that, The nucleotide sequence of the crRNA is shown in SEQ ID NO: 14 or SEQ ID NO: 15; The sequence of SEQ ID NO: 14 is: AUUUCUACUGAAAGUGUAGAUAAGGAGUACCUACGACAUGGGGAG; The sequence of SEQ ID NO: 15 is: AUUUCUACUGAAAGUGUAGAUAAGCAGUAUAGCAGACAUGUUGAG.
8. The application of the one-tube detection system based on Cas protein modification as described in claim 3 in the preparation of nucleic acid detection products.