Pirna markers for diagnostic evaluation of cardiac muscle aging, kits and uses thereof

By detecting the piRNA biomarker piR-hsa-014388, the sensitivity and specificity issues in the early diagnosis of myocardial aging have been resolved, providing an efficient diagnostic and assessment method and enabling early identification and treatment targets for myocardial aging.

CN120193066BActive Publication Date: 2026-06-30SECOND MEDICAL CENT OF CHINESE PLA GENERAL HOSPITAL
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510307091.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-09-24
Filing Date
2025-03-16
Publication Date
2026-06-30
Estimated Expiration
2045-03-16

Smart Images

  • Figure CN120193066B_ABST
    Figure CN120193066B_ABST
Patent Text Reader

Abstract

This invention discloses the application of a substance for detecting piRNA biomarkers, including one or more of the following applications: A1) application in the preparation of products for diagnosing myocardial aging; A2) application in the preparation of products for screening myocardial aging; A3) application in the preparation of products for treating myocardial aging; A4) application in the preparation of products for assessing the condition of myocardial aging; A5) application in the preparation of products for differentiating myocardial aging from other diseases; the piRNA biomarker is piR-hsa-014388, and its nucleotide sequence is shown in SEQ ID No. 1. The piR-hsa-014388 biomarker provided by this invention shows a significantly higher expression level in the plasma of patients with myocardial aging than in healthy controls, indicating that piR-hsa-014388 is a potential biomarker for myocardial aging. The ROC curve of piR-hsa-014388's efficacy in diagnosing patients with myocardial aging shows that piR-hsa-014388 has good diagnostic efficacy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to a biomarker for diagnosing myocardial aging, specifically a piRNA biomarker, and also to a kit for detecting the piRNA biomarker and its application, belonging to the field of medical molecular diagnostics. Background Technology

[0002] With the continuous advancement of medical technology, the health care of the elderly has gradually become a major concern. Statistics show that cardiovascular disease is the leading cause of death among the elderly population, and myocardial aging further increases the incidence of cardiovascular disease, and is associated with high hospitalization rates, increased mortality, and rising medical costs. Myocardial aging has unique histological and biochemical characteristics, including oxidative stress, protein misfolding, cell death, and mitochondrial abnormalities. These changes lead to impaired cardiac pumping function, altered myocardial compliance, increased afterload, and insufficient coronary perfusion / oxygenation, clinically manifesting as early decline in cardiac function, which may eventually develop into heart failure. The aging process mainly involves the aging of cardiomyocytes, and its changes include autophagy, oxidative stress, epigenetic modifications, and chronic inflammation.

[0003] Improving the early diagnostic capability of myocardial aging has always been an important research direction in cardiovascular diseases. Currently, the most commonly used methods for assessing cardiac function in clinical practice are echocardiography and electrophysiological testing. However, these methods can only detect abnormalities when there are organic changes in the heart and a significant decline in function. Furthermore, there is a lack of ideal biomarkers with high sensitivity and specificity that can be obtained from peripheral blood. Currently used biomarkers are protein markers, such as cardiac troponin (cTn), creatine kinase isoenzyme (CK), and myoglobin (Myo), released by cardiomyocytes during myocardial injury. However, these markers have limitations, such as only detecting myocardial injury and not myocardial aging, and requiring a certain time to rise. Therefore, they cannot be used as biomarkers for detecting myocardial aging. Thus, it is urgent in clinical practice to discover a new biomarker for myocardial aging.

[0004] PIWI-interacting RNAs (piRNAs) are a class of RNAs that interact with PIWI proteins. First discovered in Drosophila germ cells in 2001, they consist of 24-31 nucleotides and lack a defined secondary structure motif. Unlike miRNAs and tsRNAs, piRNAs typically rely on RNA type III enzymes to be converted into functional small RNA molecules. piRNAs can bind to PIWI proteins to form piRNA / PIWI complexes, thereby affecting transposon silencing and subsequently regulating downstream genes. Recent studies have reported that piRNAs can serve as biomarkers for evaluating cancer prognosis, but their application in cardiovascular diseases, particularly myocardial aging, is still limited. Given the characteristics and potential biological functions of piRNAs, they hold promise as biomarkers with high sensitivity, convenient detection, short detection window, and the ability to assess different stages of myocardial aging, making them a current research hotspot. Summary of the Invention

[0005] The primary technical problem this invention aims to solve is to provide a novel application of piRNA biomarkers. These piRNA biomarkers can not only be used to prepare substances for diagnosis, screening, disease assessment, and differentiation of myocardial aging from other heart diseases, but also serve as new therapeutic targets for diseases related to myocardial aging.

[0006] Another technical problem to be solved by this invention is to provide a kit for detecting this piRNA biomarker. This kit can be used for diagnosis, screening, disease assessment, and differentiating myocardial aging from other heart diseases.

[0007] The third technical problem to be solved by this invention is to provide a primer for detecting this piRNA biomarker. This primer can be used for diagnosis, screening, disease assessment, and differentiation of myocardial aging from other heart diseases.

[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0009] According to a first aspect of the present invention, an application of a substance for detecting piRNA biomarkers is provided, comprising one or more of the following applications:

[0010] A1) Application in the preparation of diagnostic products for myocardial aging;

[0011] A2) Application in the preparation of products for screening myocardial aging;

[0012] A3) Application in the preparation of products for treating myocardial aging;

[0013] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0014] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0015] The piRNA marker is piR-hsa-014388, and its nucleotide sequence is shown in SEQ ID No. 1.

[0016] The "product" described above can be a product for diagnosing myocardial aging by detecting the expression level of piR-hsa-014388 through RT-PCR, real-time quantitative PCR, in situ hybridization, microarray or high-throughput sequencing platforms.

[0017] In the above applications, piR-hsa-014388 was significantly upregulated in plasma samples from patients with myocardial aging; the expression level of piR-hsa-014388 in healthy individuals was significantly lower than that in aging patients.

[0018] Preferably, the substance is a reagent for detecting the expression level of piR-hsa-014388, or for specifically recognizing piR-hsa-014388, or for detecting the content of piR-hsa-014388.

[0019] Preferably, the substance is a substance used to detect piR-hsa-014388, specifically a), b), or c) below.

[0020] a) Primers used for the detection or specific identification of piR-hsa-014388;

[0021] b) A reagent group containing the reagents described in a);

[0022] c) A kit containing either a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0024] According to a second aspect of the present invention, a kit for detecting piRNA biomarkers is provided, the kit comprising one or more of the following applications:

[0025] A1) Application in the preparation of diagnostic products for myocardial aging;

[0026] A2) Application in the preparation of products for screening myocardial aging;

[0027] A3) Application in the preparation of products for treating myocardial aging;

[0028] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0029] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0030] The piRNA marker is piR-hsa-014388, and its nucleotide sequence is shown in SEQ ID No. 1. The kit includes reagents for detecting or specifically recognizing piR-hsa-014388, or reagents for detecting the expression level of piR-hsa-014388.

[0031] Using the kit provided by this invention, the expression of the characteristic gene sequence piR-hsa-014388 shown in SEQ ID NO.1 in the peripheral blood of the subject can be detected. Then, based on the information of upregulation or downregulation of these gene expressions, the probability of myocardial aging in the subject can be determined, thereby realizing the diagnosis of myocardial aging.

[0032] The kit provided by this invention may include appropriate packaging and instructions for use in the methods disclosed herein. The detection kit provided by this invention is a nucleic acid detection kit, including reagents required for RNA extraction and quantitative real-time PCR (qRT-PCR). The kit may further include appropriate buffers and polymerases. This kit also includes control primers and / or probes.

[0033] Preferably, the reagent used for detecting or specifically identifying piR-hsa-014388 is a specific primer, which is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0034] According to a third aspect of the present invention, a primer for detecting piRNA biomarkers is provided, the primer comprising one or more of the following applications:

[0035] A1) Application in the preparation of diagnostic products for myocardial aging;

[0036] A2) Application in the preparation of products for screening myocardial aging;

[0037] A3) Application in the preparation of products for treating myocardial aging;

[0038] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0039] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0040] The primers are used to detect the expression level of piR-hsa-014388 or to specifically recognize piR-hsa-014388.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The piRNA piR-hsa-014388 provided by this invention can serve as a novel biomarker for the diagnosis of myocardial aging. Clinical validation trials have shown that the expression level of piR-hsa-014388 in the plasma of patients with myocardial aging is significantly higher than that in the plasma of healthy controls, indicating that piR-hsa-014388 is a potential biomarker for myocardial aging.

[0044] (2) The ROC curve of piR-hsa-014388 in diagnosing patients with myocardial aging shows that piR-hsa-014388 has good sensitivity and specificity, indicating that it has good diagnostic efficacy.

[0045] (3) In clinical trials, the relationship between human plasma BNP and piR-hsa-014388 expression levels showed a positive correlation between BNP and piR-hsa-014388 expression. BNP is a peptide hormone synthesized by the heart when the ventricular wall is expanded or stretched. It can reflect the heart's compensatory function and is a marker for evaluating cardiac function, mainly used to diagnose myocardial aging and heart failure. piR-hsa-014388 and BNP levels were positively correlated. These results indicate that the level of piR-hsa-014388 in plasma can reflect the severity of myocardial aging and can be used for assessing the condition of myocardial aging.

[0046] (4) The expression levels of galactosidase, a marker of myocardial cell aging, and piR-hsa-014388 showed a good correlation and a positive correlation, indicating that the relationship between piR-hsa-014388 and cell aging is conclusive and has good diagnostic efficacy.

[0047] (5) In in vitro cell experiments, the expression level of piR-hsa-014388 in D-gal-treated AC16 cells was higher than that in normal controls; this indicates that the level of piR-hsa-014388 increases during cardiomyocyte senescence, which is the cellular and molecular basis for piR-hsa-014388 as a diagnostic biomarker for myocardial senescence. This experiment further verified the relationship between piR-hsa-014388 and myocardial senescence. Knockdown of related small RNAs in the D-gal-induced cell senescence model alleviated the senescence condition, which also proves that piR-hsa-014388 is a promising new diagnostic biomarker and therapeutic target for myocardial senescence.

[0048] (6) Immunofluorescence assay to determine the expression level of β-gal galactosidase (a marker protein of cellular senescence) in AC16 cells after D-gal treatment with knockdown piR-hsa-014388 and control group. The experiment showed that the fluorescence intensity of β-gal galactosidase decreased after knockdown of piR-hsa-014388, indicating that the expression level of β-gal galactosidase in cells was lower than that in the control group. The decrease in β-gal galactosidase expression after knockdown of piR-hsa-014388 suggests that the degree of D-gal-induced cellular senescence is reduced after knockdown of piR-hsa-014388, achieving an anti-senescence effect. This further demonstrates at the cellular level that piR-hsa-014388 may serve as a therapeutic target for myocardial aging. Attached Figure Description

[0049] Figure 1 Volcano plot showing the differential expression of piRNA in senescent cardiomyocytes and normal controls obtained through sequencing;

[0050] Figure 2 To determine the piR-hsa-014388 content in the plasma of patients with myocardial aging and normal controls using qRT-PCR;

[0051] Figure 3 ROC curve for piR-hsa-014388 in patients with myocardial aging;

[0052] Figure 4 To further determine the piR-hsa-014388 content in the plasma of patients with myocardial aging and normal controls in the external validation population using qRT-PCR;

[0053] Figure 5 ROC curves for piR-hsa-014388 in an external validation population of patients with myocardial aging;

[0054] Figure 6 The relationship between human plasma BNP and piR-hsa-014388 expression levels;

[0055] Figure 7 The relationship between the positive rate of galactosidase, a marker of aging, in D-gal-induced cardiomyocytes and the expression level of piR-hsa-014388;

[0056] Figure 8A The graph shows the expression level of piR-hsa-014388 after transfection of cardiomyocytes with piR-hsa-014388 small interfering RNA.

[0057] Figure 8B This is a graph showing the mRNA expression levels in cardiomyocytes after transfection with piR-hsa-014388 small interfering RNA.

[0058] Figure 9A The expression of D-gal-induced P21 mRNA in cardiomyocytes after siRNA knockdown of piR-hsa-014388;

[0059] Figure 9B The expression of D-gal-induced IL-1β mRNA in cardiomyocytes after siRNA knockdown of piR-hsa-014388;

[0060] Figure 10 To knock down the expression level of piR-hsa-014388 in cardiomyocytes of the control group after D-gal treatment;

[0061] Figure 11 To determine the expression of galactosidase, a marker of cellular senescence, by immunofluorescence assay after knocking down piR-hsa-014388. Detailed Implementation

[0062] The technical content of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods provided by the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0063] The research and development process and approach of this invention: First, total RNA was extracted from three naturally aging cardiomyocytes (AC16) and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for piRNA sequencing. piRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. Then, the levels of the top 10 miRNAs in the patient's plasma were measured using qRT-PCR, and the most significantly elevated piRNA was used for subsequent experiments. The inventors then further verified the relationship between the expression level of piR-hsa-014388 and myocardial aging using in vitro cellular experiments. Specific data are as follows: Example 1: Myocardial aging Screening and Correlation Study of piRNA Biomarkers

[0064] 1. Clinical Samples:

[0065] Venous blood was collected upon admission from 50 patients aged 60-90 years who were hospitalized at the General Hospital of the People's Liberation Army between 2020 and 2023, excluding other heart diseases. Venous blood was also collected from 50 healthy individuals aged ≤30 years during physical examinations. The participants were divided into a control group and an aging group for subsequent measurement of plasma piRNA levels.

[0066] The external validation population consisted of 52 inpatients aged 60-90 years who were hospitalized at Fuwai Hospital, Chinese Academy of Medical Sciences, between 2022 and 2023, excluding those with other heart diseases. Additionally, 44 healthy individuals aged ≤30 years were included. Venous blood samples were collected upon admission, and the participants were divided into a control group and an aging group. Clinical data were recorded for all participants.

[0067] Inclusion criteria:

[0068] (1) Inpatients aged 60 to 90 years;

[0069] (2) Healthy individuals aged ≤30 years undergoing physical examinations;

[0070] (3) Complete blood sample data is available.

[0071] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe hematologic diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and peripheral vascular disease.

[0072] 2. Plasma extraction:

[0073] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes. The tubes were centrifuged at 2500g for 15 minutes, and the supernatant plasma was transferred to a 2ml sterile tube and stored at -80℃.

[0074] 3. RNA extraction and quantitative real-time PCR (qRT-PCR):

[0075] Total RNA was extracted from AC16 using the RNA Simple Total RNA Kit (DP419, TIANGEN, Beijing, China).

[0076] 3.1 RNA Extraction

[0077] RNA was extracted from plasma samples according to the TRIZOL Reagent (Invitrogen) instructions. 1 ml of TRIZOL Reagent (Invitrogen) and 200 μL of chloroform were added to the plasma, vortexed for 20 seconds, and incubated at room temperature for 10 minutes. The plasma was then centrifuged at 13000 rpm for 15 minutes at 4°C. The supernatant was carefully aspirated, and 800 μL of isopropanol was added. The mixture was gently mixed by inverting the container and incubated at -20°C for 1 hour. The supernatant was then discarded. 1 ml of 75% ethanol was added to gently wash the precipitate. The precipitate was centrifuged at 4°C for 13000 rpm for 5 minutes, and the supernatant was removed. The precipitate was dried. An appropriate amount of enzyme-free water was added, and the precipitate was dissolved at 65°C for 10 minutes. The OD value and concentration of the RNA were then measured. The RNA was stored at -80°C for later use.

[0078] 3.2 RNA reverse transcription to synthesize cDNA

[0079] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A). 3.3 Reverse transcription of piRNA:

[0080] The reaction was performed on ice, with 20 μL of each reaction system, as shown in the table below:

[0081] Table 1

[0082]

[0083] 3.4 Reverse transcription of mRNA:

[0084] The reaction was performed on ice, with 20 μL of each reaction system, as shown in the table below:

[0085] Table 2

[0086]

[0087] The reaction procedure was: 37℃ for 45 min, 85℃ for 5 min, and maintained at 4℃.

[0088] 3.5 qRT-PCR

[0089] piRNA primer sequences were designed based on the principles of piRNA primer design.

[0090] The cDNA obtained from the reverse transcription reaction was diluted at a ratio of 1:10 and subjected to the following qRT-PCR reaction.

[0091] The reaction was performed on ice, with 20 μL of each reaction system, as shown in the table below:

[0092] Table 3

[0093]

[0094] After mixing the reaction solution, the Real-time PCR program is as follows:

[0095] Stage 1: 95℃ for 2 minutes;

[0096] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0097] Stage 3: 95℃15s, 60℃1min, 95℃5s;

[0098] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.

[0099] 4. piRNA sequencing analysis:

[0100] Total RNA was extracted from three naturally aging AC16 cardiomyocytes and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for piRNA sequencing. piRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. The levels of the top 10 piRNAs in the patient's plasma were then measured using qRT-PCR, and the most significantly elevated piRNA was used for subsequent experiments. Figure 1 As shown, Figure 1 The volcano plot shows the differential expression of piRNAs in senescent cardiomyocytes and normal controls obtained by sequencing; Table 4 shows the top 10 upregulated piRNAs obtained by sequencing, and piR-hsa-014388 with the highest expression level was selected for subsequent experiments.

[0101] Table 4 shows the top 10 upregulated piRNAs obtained from sequencing data.

[0102]

[0103] 5. ROC curve plotting:

[0104] The receiver operating characteristic (ROC) curve is a curve obtained by plotting the true positive rate and false positive rate, and it can be used to reflect the relationship between sensitivity and specificity. It is plotted with sensitivity on the ordinate and 1-specificity on the abscissa, using a series of cutoff values ​​based on the measurements of the experimental and control groups. Sensitivity and specificity are calculated separately for each cutoff value, and the lines connecting these points form the ROC curve. The ROC curve was plotted using GraphPad Prism software. The ROC curve reflects the diagnostic efficacy of the biomarker for the disease.

[0105] 6. Statistical Analysis:

[0106] For normally distributed variables, t-tests and ANOVA were used; for non-normally distributed variables, Mann-Whitney U tests and Kruskal-Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism software (v 8.00). Biological replicates were displayed as individual data points superimposed on a bar chart. P < 0.05 was considered statistically significant.

[0107] 7. Experimental Results:

[0108] like Figure 2 As shown, the level of piR-hsa-014388 in the plasma of patients with myocardial aging was determined by qRT-PCR. The results showed that the expression level of piR-hsa-014388 in the plasma of patients with myocardial aging was significantly higher than that in the plasma of healthy controls, indicating that piR-hsa-014388 is a potential biomarker of myocardial aging.

[0109] like Figure 3 The figure shows the ROC curve of piR-hsa-014388's efficacy in diagnosing patients with myocardial aging. piR-hsa-014388 exhibits excellent diagnostic sensitivity and specificity, indicating that it has good diagnostic efficacy.

[0110] like Figure 4 As shown, after selecting an external validation population, the piR-hsa-014388 level in the plasma of patients with myocardial aging was measured by qRT-PCR. The results showed that the expression level of piR-hsa-014388 in the plasma of patients with myocardial aging was significantly higher than that in the plasma of healthy controls, verifying the reliability of piR-hsa-014388 as a biomarker of myocardial aging.

[0111] like Figure 5 As shown in the ROC curve, piR-hsa-014388 demonstrates excellent specificity and sensitivity in diagnosing patients with myocardial aging in the external validation set, indicating that piR-hsa-014388 also exhibits good diagnostic efficacy in the external validation set.

[0112] Example 2: Relationship between BNP and piR-hsa-014388 expression levels

[0113] 1. Experimental objective:

[0114] B-type natriuretic peptide (BNP) and its N-terminal precursor (N-terminal BNP) (in patients with median levels or higher) are biomarkers of cardiac function and are the preferred biomarkers for the diagnosis and differential diagnosis of heart failure, as well as for assessing disease severity and prognosis. In healthy adults, the normal BNP level should be <100 ng / L. BNP levels gradually increase with age and decline in cardiac function, and are generally considered abnormal when greater than 100 ng / L. Diagnostic criteria are based on the 2004 American College of Cardiology (ACC) expert consensus: if BNP <100 ng / L, the likelihood of heart failure is extremely low (90% negative predictive value); if BNP >500 ng / L, the likelihood of heart failure is extremely high (90% positive predictive value). A normal BNP level should be <100 ng / L; BNP levels within the normal range can rule out acute heart failure.

[0115] BNP is mainly found in the left and right atria of the heart, with the right atrium containing more than three times the amount in the left atrium. The ventricular BNP content is low because BNP precursors are not stored in the ventricles. Only when the ventricular wall tension increases will it rapidly stimulate the high expression of the BNP gene, resulting in the synthesis and secretion of large amounts into the blood. In other words, the increase in plasma BNP indicates that the heart's systolic or diastolic function is impaired, which prevents the heart from fully expelling venous blood, causing ventricular traction. Moreover, the increase in BNP exhibits a dynamic pattern.

[0116] Myocardial aging is the process by which the heart muscle gradually loses function and efficiency with age. This process may lead to weakened cardiac pumping function and poor blood circulation, thereby increasing the release of BNP. Therefore, BNP levels can serve as an important indicator for assessing myocardial aging and the risk of heart failure.

[0117] 2. Experimental Methods:

[0118] BNP assay: The BNP / Brain Natriuretic Peptide (BNP) EILSA assay kit (ZC-34225) was used to measure plasma or cell supernatant. First, add 100 μL of standard or test sample to each well. Equilibrate the kit to room temperature for 30 min. Then, remove the required strips from the aluminum foil bag, and seal the remaining strips in a resealable bag and return to 4℃. Add 50 μL of different concentrations of standard to each standard well. Add 50 μL of the test sample to each sample well; do not add any to the blank wells. Except for the blank wells, add 100 μL of horseradish peroxidase (HPP)-labeled detection antibody to each standard and sample well. Seal the reaction wells with sealing film and incubate at 37℃ for 60 minutes in a water bath or incubator. Discard the liquid.

[0119] Pat the plate dry on absorbent paper, fill each well with washing buffer (350 μL), let stand for 1 minute, shake off the washing buffer, pat dry on absorbent paper, and repeat this washing process 5 times (or a plate washer can be used). Add 50 μL each of substrate A and B to each well, and incubate at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well, and within 15 minutes, measure the OD value of each well at a wavelength of 450 nm.

[0120] 3. Experimental Results:

[0121] Figure 6 The figure shows the relationship between plasma BNP and piR-hsa-014388 expression levels in patients. As can be seen from the figure, BNP and piR-hsa-014388 expression are positively correlated. BNP is a marker protein of heart failure, and piR-hsa-014388 is positively correlated with BNP levels. These results indicate that plasma piR-hsa-014388 levels can reflect the severity of the disease.

[0122] Example 3 further verified the relationship between piR-hsa-014388 and myocardial aging using a galactosidase staining experiment. relation

[0123] 1. Experimental objective:

[0124] Normal cells cease dividing after a finite number of divisions, exhibiting irreversible growth arrest, at which point the cell enters a senescent state, and galactosidase, an enzyme associated with senescence, becomes activated. Galactosidase is a hydrolytic enzyme within lysosomes, but its activity is upregulated in senescent cells. Based on this phenomenon and principle, using galactosides as substrates, senescent cell-specific galactosidases catalyze the substrate to produce a blue product, manifested as blue deposits in the cytoplasm. These blue-expressing cells or tissues can be easily observed under a light microscope. Galactosidase staining is the gold standard for determining cellular senescence in cell and molecular experiments.

[0125] 2. Cell culture:

[0126] Human cardiomyocyte line (AC16) was purchased from Wuhan Pronosai. The cells were cultured in RPMI-1640 medium with 10% fetal bovine plasma in a 37°C 5% carbon dioxide incubator.

[0127] 3. Cell-induced senescence treatment:

[0128] Cultured AC16 cardiomyocytes were exposed to 10 mM D-gal to induce cellular senescence. D-galactose (D-gal) is a well-established senescence model inducing agent, a more potent glycation agent than glucose, and capable of inducing oxidative stress. D-gal concentrations induced cytotoxicity and senescence-like changes, leading to increased BNP secretion levels in AC16 cells. Further analysis was performed 24 h after treatment.

[0129] 4. Galactosidase staining:

[0130] Staining was performed using the Beyotime galactosidase staining kit (C0602). Cardiomyocytes cultured in 6-well plates were stained. The cell culture medium was aspirated, and the cells were washed once with PBS. 1 mL of β-galactosidase staining fixative was added, and the cells were fixed at room temperature for 15 minutes. The cell fixative was aspirated, and the cells were washed three times with PBS for 3 minutes each time. PBS was then aspirated, and 1 mL of staining working solution was added to each well. The staining working solution was prepared as follows: 10 μl of galactosidase staining solution a, 10 μl of galactosidase staining solution b, 930 μl of galactosidase staining solution c, and 50 μl of X-Gal solution. The cells were incubated overnight at 37°C, and the 6-well plates were sealed with plastic wrap to prevent evaporation. Note: Incubation at 37°C cannot be performed in a CO2 incubator. Observation was performed under a regular optical microscope.

[0131] 5. Statistical Analysis:

[0132] Cells stained blue under an optical microscope were considered positive cells. The number of positive cells per 100 cells in a randomly selected field of view was counted to determine the percentage of positive cells (%). Correlation analysis was performed between the percentage of positive cells in each sample and the piR-hsa-014388 standard.

[0133] 6. Experimental Results:

[0134] like Figure 7 As shown, the expression levels of galactosidase and piR-hsa-014388, markers of cardiomyocyte aging, showed a good correlation and a positive correlation, indicating that the relationship between piR-hsa-014388 and cellular senescence is conclusive and that it has good diagnostic efficacy.

[0135] Example 4: In vitro experiments to verify the relationship between piR-hsa-014388 expression level and myocardial aging at the cellular level. relation

[0136] 1. Cell culture:

[0137] The cell culture method is the same as in Example 3.

[0138] Small interfering RNA (siRNA) knockdown method: siRNA was ordered from Thermo Fisher Scientific. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was measured by qRT-PCR after 24 hours of induction.

[0139] 2. Cell-induced senescence treatment is the same as in Example 3.

[0140] 3. The method for measuring BNP in myocardial cell supernatant is the same as in Example 3.

[0141] 4. The qRT-PCR method is the same as in Example 1.

[0142] 5. Immunofluorescence staining galactosidase experiment:

[0143] Cells were incubated in 4% paraformaldehyde for 10 minutes at room temperature. Cells were washed three times with ice-cold PBS. Cells were then incubated with 1% BSA and PBST for 30 minutes to block non-specific antibody binding. Cells were then incubated with a specific galactosidase antibody (Abcam, catalog number AB136775) at 4°C for 6 hours. The solution was discarded, and cells were washed three times with PBS for 5 minutes each time. Cells were then incubated with a fluorescent secondary antibody (Abcam, catalog number AB150113) (dissolved in 1% BSA) in the dark for 1 hour at room temperature. The secondary antibody solution was discarded, and cells were washed three times with PBS for 5 minutes each time in the dark. Finally, cell nuclei were stained with DAPI solution, and the fluorescence intensity of galactosidase was observed under a fluorescence microscope.

[0144] 6. Experimental Results:

[0145] Figure 8A The expression of piR-hsa-014388 was decreased after AC16 cardiomyocytes were transfected with siRNA. Figure 8B The results showed that the total amount of mRNA remained unchanged after transfection, indicating that the transfection and knockdown of piR-hsa-014388 was successful, and subsequent experiments were carried out based on this.

[0146] Figure 9A and Figure 9B To detect the mRNA expression of two cellular senescence markers (P21, a cellular senescence protein marker, and IL-1β, a cellular senescence secretion-related phenotypic marker) in AC16 cardiomyocytes after transfection with siRNA, it was found that after knocking down piR-hsa-014388, Figure 9A P21 and Figure 9B The reduced expression of IL-1β mRNA suggests that knocking down piR-hsa-014388 can slow down cellular senescence, and piR-hsa-014388 may serve as a therapeutic target for myocardial aging.

[0147] Figure 10 To reduce the expression levels of piR-hsa-014388 and BNP in the cardiomyocyte supernatant of AC16 cardiomyocytes after D-gal treatment, the results showed that D-gal-induced senescence increased piR-hsa-014388 expression, while BNP expression decreased after piR-hsa-014388 knockdown. This provides the cellular and molecular basis for piR-hsa-014388 as a biomarker for diagnosing myocardial aging.

[0148] Figure 11The expression levels of galactosidase (a marker protein of cellular senescence) in D-gal-treated AC16 cardiomyocytes after knockdown of piR-hsa-014388 and control groups were determined using immunofluorescence assays. Immunofluorescence assays are experiments that observe the expression levels of related proteins in cells or tissues by observing the interaction between primary and secondary antibodies and the substrate under a fluorescence microscope. Knockdown of piR-hsa-014388 resulted in decreased fluorescence intensity of galactosidase, indicating that the expression level of galactosidase in cells was lower than that in the control group. The reduced galactosidase expression after knockdown of piR-hsa-014388 suggests that the degree of D-gal-induced cellular senescence is mitigated, achieving an antagonistic effect on senescence. This demonstrates at the cellular level that piR-hsa-014388 may serve as a therapeutic target for myocardial senescence.

[0149] The above experimental results indicate that piR-hsa-014388 is significantly correlated with myocardial aging, making it a novel biomarker for myocardial aging. piR-hsa-014388 expression was upregulated in cardiomyocytes treated with the aging-inducing agent D-gal; ROC curves showed that piR-hsa-014388 possesses good diagnostic capabilities for patients with myocardial aging, suggesting that piR-hsa-014388 may be involved in the aging-inducing effect of D-gal on cardiomyocytes. In conclusion, piR-hsa-014388 shows promise as a novel diagnostic biomarker and therapeutic target for myocardial aging.

[0150] Example 5: Composition of the sequence, primers, and reagent kit involved in this invention.

[0151] The nucleotide sequence of the myocardial aging biomarker piR-hsa-014388 provided by this invention is shown in SEQ ID No. 1.

[0152] SEQ ID No.1:TGGGTTGGCTGGTAAAGACAGGGGTAC

[0153] The primer pair specifically recognizing piR-hsa-014388 provided by this invention includes the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3:

[0154] SEQ ID No.2: AACGATATGGGTTGGCTGGTAAAGAC

[0155] SEQ ID No.3: GTCGTATCCAGTGCAGGGTCC

[0156] The reagent kit provided by this invention consists of:

[0157] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primers, RNase-free purified water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10μM), ROX Reference dye (50x).

Claims

1. The application of a reagent for detecting the expression level of piRNA biomarkers, characterized in that... It can be one or more of the following applications: A1) Application in the preparation of diagnostic products for myocardial aging; A2) Application in the preparation of products for screening myocardial aging; The piRNA marker is piR-hsa-014388, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The application as described in claim 1, characterized in that: The product is designed to diagnose myocardial aging by detecting the expression level of piR-hsa-014388 using RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms.

3. The application as described in claim 1, characterized in that... The reagent is specifically one of the following a), b), or c). a) Primers used for the detection or specific recognition of piR-hsa-014388; b) A reagent group containing the reagents described in a); c) A kit containing either a) or b).

4. The application as described in claim 3, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.