Application of Lrrc52 supplementing product in preparation of medicine for preventing and / or treating myocardial ischemia-reperfusion injury

Abstract

The invention provides application of a product for supplementing Lrrc52 in preparation of a medicine for preventing and / or treating myocardial ischemia-reperfusion injury, and belongs to the technical field of biological medicine. The invention provides an application of a product for supplementing Lrrc52 as a medicine for preventing and / or treating myocardial ischemia-reperfusion injury, Lrrc52 protein is supplemented into a body, so that the apoptosis and necrosis degree of myocardial cells after myocardial ischemia-reperfusion can be effectively relieved, the pathological ventricular remodeling process is restrained, the cardiac fibrosis condition is relieved, the cardiac function is enhanced, and the myocardial ischemia-reperfusion injury can be prevented and treated. And therefore, heart-related diseases such as acute ischemia-reperfusion injury, pathological ventricular remodeling and heart failure can be prevented and treated. The invention clearly reveals the potential of overexpression Lrrc52 in the aspect of improving myocardial ischemia reperfusion injury for the first time, opens up a brand new drug research and development road and an action target for prevention and treatment of the disease, and shows extremely high medicinal value and significance.

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and particularly relates to the application of a product for supplementing Lrrc52 in the preparation of a medicament for preventing and / or treating myocardial ischemia-reperfusion injury. Background Art

[0002] Myocardial ischemia-reperfusion injury (IRI) refers to the situation where, after myocardial tissue undergoes ischemia, when blood supply is restored, tissue damage is exacerbated and may even lead to irreversible damage. This injury is a key problem in the treatment of cardiovascular diseases because it occurs when blood reflows into the previously ischemic myocardial tissue, thereby triggering more cell damage and dysfunction. Although existing treatment means have certain curative effects, they still face challenges such as unstable curative effects and relatively large side effects. Therefore, it is particularly important to develop a more effective and safer pharmaceutical composition for treating myocardial ischemia-reperfusion injury. Although the specific mechanism of myocardial ischemia-reperfusion injury has not been fully clarified, it is generally believed that the generation of free radicals, intracellular calcium ion overload, and excessive activation of the inflammatory response are its main pathogenic factors.

[0003] LRRC52 (also denoted as Lrrc52) is one of the members of the LRRC family. Proteins in this family are named for containing leucine-rich repeats, which usually consist of 19 to 29 amino acids and have the pattern of LxxLxLxxN, where x represents any amino acid. It is known that LRRC52 can regulate the function of BK channels, which are mainly composed of the α subunit (BKα) and can exist independently or bind to the β subunit. The latest research has also discovered the γ subunit of BK channels, and at least four LRRC family proteins including LRRC52 have been identified as the γ subunit of BK channels.

[0004] In cochlear inner hair cells, the expression and localization of LRRC52 are closely related to those of BKα. The deletion of BKα will lead to the non-expression of LRRC52. LRRC52 gene knockout (KO) mice show auditory defects similar to those of BKα KO mice in inner hair cells (IHCs), indicating the key role of LRRC52 in the regulation of BK channel function. In addition, LRRC52 also participates in the regulation of sperm potassium channels (KSper), which are composed of the sperm-specific pore protein SLO3 and the auxiliary subunit LRRC52. The hyperpolarization of the sperm membrane potential is a key step in sperm capacitation, which is mainly controlled by KSper, and LRRC52 KO mice show significant fertility defects.

[0005] Currently, there is no relevant research or report on the specific role and potential mechanism of Lrrc52 in myocardial ischemia-reperfusion injury. Summary of the Invention

[0006] Aiming at the defects in the prior art, the purpose of the present invention is to provide the application of Lrrc52 in the preparation of drugs for preventing and / or treating myocardial ischemia-reperfusion injury.

[0007] The purpose of the present invention is achieved by the following technical solutions:

[0008] The present invention provides the application of a product for supplementing Lrrc52 in the preparation of drugs for preventing and / or treating myocardial ischemia-reperfusion injury and / or diseases caused by myocardial ischemia-reperfusion injury.

[0009] Preferably, the nucleotide sequence encoding the Lrrc52 protein is as shown in SEQ ID NO.1.

[0010] Preferably, the product for supplementing Lrrc52 includes any one or more of the Lrrc52 protein, a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the Lrrc52 protein, a reagent for expressing the Lrrc52 protein, and an agonist capable of activating Lrrc52.

[0011] Preferably, the reagent for expressing the Lrrc52 protein includes an overexpression reagent for Lrrc52.

[0012] Preferably, the diseases caused by myocardial ischemia-reperfusion injury include any one or more of acute ischemia-reperfusion injury, pathological ventricular remodeling, and heart failure.

[0013] Preferably, the prevention and / or treatment includes any one or more of the following (1) to (4):

[0014] (1) Improving myocardial cell necrosis;

[0015] (2) Reducing the apoptosis rate of myocardial cells;

[0016] (3) Improving cardiac function;

[0017] (4) Alleviating the degree of cardiac fibrosis.

[0018] The present invention provides a reagent for expressing the Lrrc52 protein, which includes a recombinant vector for expressing the Lrrc52 protein; the recombinant vector includes a basic vector and a nucleotide sequence encoding the Lrrc52 protein; the nucleotide sequence encoding the Lrrc52 protein is as shown in SEQ ID NO.1.

[0019] Preferably, the basic vector includes an adenovirus backbone vector.

[0020] The present invention provides a drug for preventing and / or treating myocardial ischemia-reperfusion injury, comprising a product for supplementing Lrrc52 and a pharmaceutically acceptable excipient; the product for supplementing Lrrc52 comprises the reagent described in the above technical solution.

[0021] Preferably, the pharmaceutically acceptable excipient comprises any one or more of a buffer, a diluent, a binder, a disintegrant, a lubricant, a glidant, a plasticizer and a stabilizer.

[0022] Beneficial effects of the present invention:

[0023] The present invention provides the use of a product for supplementing Lrrc52 in the preparation of a drug for preventing and / or treating myocardial ischemia-reperfusion injury and / or a disease caused by myocardial ischemia-reperfusion injury. The present invention proposes a drug for treating myocardial ischemia-reperfusion injury by using a product for supplementing Lrrc52. By supplementing Lrrc52 protein into the body and through the action of specific active ingredients, it can effectively reduce the degree of apoptosis and necrosis of myocardial cells after myocardial ischemia-reperfusion, curb the process of pathological ventricular remodeling, relieve the condition of cardiac fibrosis, and enhance cardiac function. Through experiments on animal models, the present invention verifies that overexpression of Lrrc52 can significantly reduce the apoptosis and necrosis of myocardial cells after myocardial ischemia-reperfusion, optimize pathological ventricular remodeling, relieve cardiac fibrosis, and improve cardiac function, thereby effectively resisting myocardial injury in multiple dimensions, and further being beneficial to the prevention and treatment of heart-related diseases such as pathological ventricular remodeling and heart failure. The present invention for the first time clearly reveals the potential of overexpressing Lrrc52 in improving myocardial ischemia-reperfusion injury, opens up a new drug R & D path and action target for the prevention and treatment of this disease, and shows extremely high medicinal value and significance. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required in the embodiments. Obviously, the drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0025] Figure 1 It is a gene map of the vector pAAVMCS for overexpression;

[0026] Figure 2 It is a partial result diagram obtained by sequencing using a forward primer;

[0027] Figure 3 It is a partial result diagram obtained by sequencing using a reverse primer;

[0028] Figure 4Detection result graph of relative expression levels of Lrrc52 protein in each experimental group;

[0029] Figure 5 Experimental result graph for evaluating the effect of overexpressing Lrrc52 on cardiomyocyte apoptosis in mice with myocardial ischemia-reperfusion injury by TUNEL and α-actinin staining;

[0030] Figure 6 Result graph of the effect of overexpressing Lrrc52 on the activity of lactate dehydrogenase (LDH) in the serum of mice with myocardial ischemia-reperfusion injury;

[0031] Figure 7 Detection result graph of relative expression levels of Lrrc52 protein in each experimental group;

[0032] Figure 8 Result graph of the effect of overexpressing Lrrc52 on cardiac function in mice with myocardial ischemia-reperfusion injury evaluated by echocardiography;

[0033] Figure 9 Result graph of Masson staining for overexpressing Lrrc52 to intervene in cardiac fibrosis in mice with myocardial ischemia-reperfusion injury. Specific implementation manner

[0034] The present invention provides the use of a product for supplementing Lrrc52 in the preparation of a drug for preventing and / or treating myocardial ischemia-reperfusion injury and / or diseases caused by myocardial ischemia-reperfusion injury.

[0035] The present invention relates to a new application, that is, using a product for supplementing Lrrc52 to develop drugs, which are intended to prevent and / or treat the injury caused by blood reperfusion after myocardial ischemia, and are beneficial to preventing and / or treating diseases caused by myocardial ischemia-reperfusion injury.

[0036] As an alternative embodiment of the present invention, the nucleotide sequence of Lrrc52 is as shown in SEQ ID NO.1, specifically: ATGTCCCTTGCTTCAGGCCCTAGCTCCAAGTTGTTACTCTTTTCTCTTGGAATGGGGTTGGTATCAGGGTCCAAGTGTCCAAACAAGTGTGTGTGTCAAGACCAAGAAGTAGCCTGCATAGATTTGCACCTAACGGAATACCCAGCTGATATTCCTCTGAACACCCGGAGACTATACCTGAACAATAACAAAATCACTAGTTTACCAGCTTTGCAGCTGGGATTCCTCAGTGACCTCGTTTACTTGGACTGTCAGAACAACCGGATTCGAGAGGTGATGGATTATACCTTCATCGGGATCTTCAGACTCATCTACCTTGACCTCAGCTCCAACAACCTAACTTCCATCTCCCCTTTCAGCTTCTCAGTGCTCACCAACCTGGTGCGGCTGAACATTTCACACAACCCTCACCTGTTGTATCTTGACAAATACGTCTTTGCCAACACCACGTCTTTGAGGTACCTGGACCTCAGAAACACCGGATTGCACATCATCGACCATAATGGCTTCCACCACCTGGTGGTGCTCCAGACTCTGTACCTAAGTGGGAACCCCTGGATATGCAACTGCTCCTTCCTGGACTTCACCATCCACTTATTAGTGTCCCATATGGACCACCCAGATGCCCAGAACGCCACGTGTACGGAGCCTGCTGAGCTGAAAGGGTGGCCCATCACGAAGGTGGGGAATCCACTCCAGTACATGTGCATCACACACCTGGACCAGCAGGACTACATCTTCTTACTGCTCATCGGCTTCTGCATCTTCGCTGCCGGCACGGTGGCTGCCTGGCTCACGGGTGTATGTGCTGTGCTGTACCAGAATGCCCTCCGAACGTCGAGCGGGGATGATACCGAAGATGAAACTGGGAGTAGATTCGCCAACCAGATTTTTCGAAGCAACACACACTTGGGCCCCATTCGTCGGTTCCCTGAACTGATCTAG。

[0037] As an optional embodiment of the present invention, the product for supplementing Lrrc52 includes any one or more of Lrrc52 protein, a fusion protein obtained by connecting a tag to the N-terminal and / or C-terminal of Lrrc52 protein, a reagent for expressing Lrrc52 protein, and an agonist capable of activating Lrrc52. As an optional embodiment of the present invention, the reagent for expressing Lrrc52 protein includes an Lrrc52 overexpression reagent; the Lrrc52 overexpression reagent includes a reagent for inducing Lrrc52 overexpression by transgene and / or an overexpression reagent mediated by Lrrc52 mRNA; the reagent for inducing Lrrc52 overexpression by transgene includes a reagent related to adeno-associated virus-induced Lrrc52 transgene.

[0038] As an optional embodiment of the present invention, the diseases caused by myocardial ischemia-reperfusion injury include any one or more of acute ischemia-reperfusion injury, pathological ventricular remodeling, and heart failure.

[0039] As an optional embodiment of the present invention, the prevention and / or treatment includes any one or more of the following (1) to (4):

[0040] (1) Improving myocardial cell necrosis;

[0041] (2) Reducing the apoptosis rate of myocardial cells;

[0042] (3) Improving cardiac function;

[0043] (4) Alleviating the degree of cardiac fibrosis.

[0044] In the present invention, the product for supplementing Lrrc52 can improve myocardial cell necrosis. As an optional embodiment of the present invention, the product for supplementing Lrrc52 can improve myocardial cell necrosis after myocardial ischemia-reperfusion. Through experimental verification on an animal model in the present invention, it is obtained that after experiencing ischemia-reperfusion injury, the LDH activity in the serum of overexpressing Lrrc52 is significantly reduced, indicating that overexpression of Lrrc52 helps to improve the necrosis condition of myocardial cells.

[0045] In the present invention, the product for supplementing Lrrc52 can reduce the apoptosis rate of myocardial cells. As an optional embodiment of the present invention, the product for supplementing Lrrc52 can reduce the apoptosis rate of myocardial cells after myocardial ischemia-reperfusion. Through experimental verification on an animal model in the present invention, it is obtained that after experiencing ischemia-reperfusion injury, overexpression of Lrrc52 can significantly reduce the apoptosis rate of cardiac tissue cells.

[0046] In the present invention, the product for supplementing Lrrc52 can improve cardiac function. As an alternative embodiment of the present invention, the product for supplementing Lrrc52 can improve cardiac function in ischemic reperfusion injury. Through experimental verification on an animal model, the present invention finds that overexpression of Lrrc52 can significantly increase the ejection fraction and fractional shortening of the mouse heart after experiencing ischemic reperfusion injury, thereby contributing to the improvement of cardiac function in ischemic reperfusion injury.

[0047] In the present invention, the product for supplementing Lrrc52 can alleviate the degree of cardiac fibrosis. As an alternative embodiment of the present invention, the product for supplementing Lrrc52 can alleviate the degree of cardiac fibrosis caused by myocardial ischemia reperfusion. Through experimental verification on an animal model, the present invention finds that overexpression of Lrrc52 can significantly reduce the proportion of fibrosis in the mouse heart tissue after experiencing ischemic reperfusion injury, alleviating the degree of cardiac fibrosis caused by myocardial ischemia reperfusion.

[0048] The present invention provides a reagent for expressing Lrrc52 protein, comprising a recombinant vector for expressing Lrrc52 protein; the recombinant vector comprises a basic vector and a nucleotide sequence encoding the Lrrc52 protein; the nucleotide sequence encoding the Lrrc52 protein is as shown in SEQ ID NO.1. As an alternative embodiment of the present invention, the basic vector comprises an adenovirus backbone vector. The present invention has no special requirements for the adenovirus backbone vector, and any conventional adenovirus backbone vector in the art can be used. The present invention has no special limitation on the construction method of the recombinant vector, and any conventional construction method in the art can be used.

[0049] In the present invention, the reagent for expressing Lrrc52 protein preferably overexpresses the Lrrc52 in vivo through a method mediated by Lrrc52 adeno-associated virus. The present invention has no special requirements for the source of the Lrrc52 adeno-associated virus. By using the conventional method of constructing plasmids, the nucleotide sequence of the above Lrrc52 gene can be cloned into an adeno-associated virus overexpression vector to obtain a recombinant adeno-associated virus. After obtaining the recombinant adeno-associated virus, the present invention preferably further includes packaging the recombinant adeno-associated virus. The present invention has no special limitation on the packaging method.

[0050] The present invention provides a drug for preventing and / or treating myocardial ischemia reperfusion injury, comprising a product for supplementing Lrrc52 and a pharmaceutically acceptable excipient; the product for supplementing Lrrc52 comprises the reagent described in the above technical solution. As an alternative embodiment of the present invention, the pharmaceutically acceptable excipient comprises any one or more of a buffer, a diluent, a binder, a disintegrant, a lubricant, a glidant, a plasticizer, and a stabilizer. The dosage form of the drug of the present invention includes an injection.

[0051] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below with reference to the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0052] Example 1

[0053] 1. Construction and virus packaging of AAV9-Lrrc52 adeno-associated virus vector

[0054] Search for mouse-derived CDS through NCBI, design primers for the Lrrc52 fragment. The forward primer is as shown in SEQ ID NO.2, specifically: GGATCCATGTCCCTTGCTTCAGGCCCT, and the reverse primer is as shown in SEQ ID NO.3, specifically: GAATTCCTAGATCAGTTCAGGGAACCG. After extracting mouse heart RNA as a template, the Lrrc52 fragment was obtained by gel recovery after gene amplification, as shown in SEQ ID NO.1. Use restriction endonucleases BamHI and SalI to digest the vector pAAV-MCS (VPK-410, Cell Biolabs) and the Lrrc52 fragment in a 42°C water bath for 30 min, and then gel recovery was used to obtain the digested products of the vector and Lrrc52 respectively. Use a ligase to ligate the two overnight at room temperature, and perform heat shock transformation on Escherichia coli Stabl 3 competent cells. After the transformation was completed, the target strain was screened using LB medium supplemented with ampicillin (the mass concentration of ampicillin was 100 μg / mL). Then, use a plasmid extraction kit to extract the plasmid, and sequence verification was performed on the recombinant plasmid pAAV MCS-Lrrc52. When the sequencing results were verified to be correct, the adeno-associated virus overexpression vector pAAVMCS-Lrrc52 containing the full-length coding sequence of Lrrc52 was obtained.

[0055] The map of the vector pAAVMCS is as Figure 1 shown, and the partial sequencing results of the plasmid pAAVMCS-Lrrc52 are as Figures 2-3 shown. Figure 2 This is a partial result diagram obtained by sequencing using the forward primer, which covers the starting region of the Lrrc52 nucleotide sequence; Figure 3 This is a partial result obtained by sequencing using the reverse primer, which contains the termination region of the Lrrc52 nucleotide sequence. Through the Figures 2-3 sequencing data, we can confirm that it is completely consistent with the Lrrc52 target sequence, which strongly proves that the recombinant adeno-associated virus Lrrc52 overexpression vector pAAVMCS-Lrrc52 has been successfully constructed.

[0056] Use 293T cells with a confluence between 80% and 90% to perform transfection operations on the target plasmid pAAVMCS-Lrrc52 and the packaging plasmids (AAV2 / 9, pAdDeltaF6).

[0057] When the cell area in the cell dish reaches more than 80%, start packaging adeno-associated virus. A total of three plasmids are required, AAV shuttle vector (AAV2 / 9): 10 μg; pAdDeltaF6 (Helper): 10 μg; target plasmid: 10 μg.

[0058] According to the amount of lentivirus to be packaged and the plasmid concentration, calculate the required plasmid volume and prepare it with empty medium (the volume of added blank DMEM = total volume - plasmid volume - PEI volume, PEI is the transfection reagent). Add 500 μL of empty medium to a 1.5 mL EP tube, and then sequentially add AAV shuttle vector: 10 μg; Helper: 10 μg; target plasmid: 10 μg; PEI: 90 μL. Finally, make up to 1 mL with empty medium. After vortexing for 30 s, let it stand at room temperature for 15 min.

[0059] Add 9 mL of normal medium to the cell dish in advance. After the plasmid mixture solution has stood, use a pipette to add it drop by drop to the culture dish.

[0060] Put the cell dish into the cell culture incubator and continue to culture for 10 h, then change to normal medium.

[0061] Change the medium 10 to 12 hours after transfection to a new complete medium containing 10% FBS and 1% penicillin-streptomycin. 48 hours after changing the medium, collect the generated virus particles and purify these viruses. The specific steps are as follows: Starting from changing the medium, after 48 h, collect the supernatant and cells.

[0062] Collect the supernatant into a 50 mL centrifuge tube, centrifuge at 4000 rpm at 4 °C for 30 min, then transfer the supernatant to a clean empty bottle. Add PEG8000 to the solution at a ratio of 1:5 of PEG8000 to supernatant volume, and add a rotor. Rotate at 4 °C for 1 h, then let it stand for 3 h. After standing, aliquot the supernatant into 50 mL centrifuge tubes, centrifuge at 4000 rpm at 4 °C for 30 min, and discard the supernatant. Resuspend the precipitate obtained after the two centrifugations with 10 mL of lysis buffer, and add nuclease and 1 mM MgCl2 at a volume ratio of 1:1000 respectively, and incubate in a 37 °C water bath for 1 h. Centrifuge at 4000 rpm at 4 °C for 30 min, and purify the supernatant by iodixanol density gradient centrifugation. Concentrate the purified product to a volume of 1 mL with an ultrafiltration tube.

[0063] The titer of the concentrated and purified Lrrc52 overexpressing adeno-associated virus AAV9-Lrrc52 was determined and finally stored frozen at -80 °C.

[0064] 2. Construction and packaging of AAV9-Control adeno-associated virus vector

[0065] Similar to the packaging of AAV9-Lrrc52 adeno-associated virus in Step 1, the pAAV-MCS plasmid was used instead of pAAVMCS-Lrrc52 in the above Step 1 to package the control adeno-associated virus, denoted as AAV9-Control.

[0066] Example 2

[0067] 1. Grouping of mice and model establishment

[0068] The experimental mice were purchased from Beijing Vital River Laboratory Animal Technology Co., Ltd. Subsequently, by means of random allocation, they were equally divided into two groups: one group was the experimental group (I / R group) that received myocardial ischemia-reperfusion surgery, and the other group was the control group (Sham group) that received sham surgery.

[0069] Method for establishing an ischemia-reperfusion surgery model (I / R) in the experimental group: First, 4% chloral hydrate prepared with 1×PBS was intraperitoneally injected into the mice at a dose of 10 μL per gram of body weight to anesthetize the mice. Subsequently, the mice were fixed on the operating table, and the hair on the neck and left chest area was removed with depilatory cream. With the assistance of a stereomicroscope, scissors were used to separate the neck skin, muscles, and tissues covering the trachea until the trachea was fully exposed. Subsequently, a small incision was precisely made between two tracheal cartilage rings below the glottis, and a tracheal intubation was inserted and fixed. During this period, the thoracic fluctuation frequency of the mice was continuously monitored to ensure smooth ventilation of both lungs. Next, in the magnified field of the stereomicroscope, a transverse incision was made at the fourth and fifth intercostal spaces on the left side of the sternum of the mice with scissors, and the chest wall muscles and intercostal muscles were gently bluntly separated with micro forceps to fully expose the heart area. Subsequently, the left anterior descending artery of the heart was ligated, and the thoracic cavity was sutured to close the incision. After 30 minutes, the thoracic cavity was opened again, the previous ligature was cut and removed to restore blood supply to the heart. Finally, the intercostal muscles, chest wall muscles, and skin were sutured in sequence, and the surgical site was disinfected with iodine.

[0070] Control group: The operation steps were the same as those of the experimental group except for not performing the ligation part.

[0071] After the surgery, observe whether the mice have respiratory obstruction. Once detected, the respiratory tract should be cleared immediately. After the mice wake up, remove them from the thermostatic pad and safely return them to the cage.

[0072] 2. Tail vein injection of virus

[0073] The mice in the experimental group (I / R group) were evenly divided into two groups, named AAV9-Control+AIRI group and AAV9-Lrrc52+AIRI group respectively.

[0074] To construct an acute ischemia-reperfusion injury model (acute IRI, AIRI), samples were taken for detection 24 hours after the ischemia-reperfusion surgery (I / R).

[0075] The specific experimental steps were as follows: Three weeks before the start of step 1, that is, three weeks before the implementation of the ischemia-reperfusion surgery (I / R), the mice in each group were placed on a tail vein injection device, and the tails of the mice were disinfected with alcohol. A one-time insulin needle was used to inject each mouse with a 1×10 11 vg dose of virus solution via tail vein injection. Among them, the AAV9-Lrrc52+AIRI group was injected with AAV9-Lrrc52 obtained in Example 1; the AAV9-Control+AIRI group was injected with AAV9-Control obtained in Example 1. After injection, gently press with absorbent cotton to stop bleeding, and then put the mice back into the cage for continued feeding. Three weeks after feeding, that is, three weeks after virus injection, the subsequent experimental operations were performed on the experimental group mice according to the aforementioned step 1. 24 hours after the I / R surgery, the mice were anesthetized and sacrificed, and then tissue samples were taken to detect the relevant indicators of cell apoptosis and necrosis.

[0076] The mice in the control group (Sham group) were evenly divided into two groups, named AAV9-Control+Sham group and AAV9-Lrrc52+Sham group respectively. The specific experimental steps were the same as above, that is, the AAV9-Control+Sham group was injected with the same amount of AAV9-Control as in the above steps, and the AAV9-Lrrc52+Sham group was injected with the same amount of AAV9-Lrrc52 as in the above steps. After feeding for 3 weeks, a sham operation was performed. 24 hours after the sham operation, the mice were anesthetized and sacrificed, and then tissue samples were taken to detect the relevant indicators of cell apoptosis and necrosis.

[0077] Test Example 1

[0078] 1. Detection of the relative expression level of Lrrc52 protein in each treatment group of acute ischemia-reperfusion injury (AIRI)

[0079] After the treatment of Example 2 ended, that is, 24 hours after IRI surgery or sham surgery, the collected heart samples were lysed with protein lysate to extract total protein. Subsequently, the extracted protein was quantified by a BCA kit. Next, the quantified protein samples were loaded onto a polyacrylamide gel with the same loading amount and separated by electrophoresis. Then, an immunoblotting experiment was performed using an Lrrc52-specific antibody (Proteintech, 25584-1-AP) to detect the expression of the Lrrc52 protein. β-actin was used as an internal reference protein, and the gray value of the protein bands in the immunoblotting experiment was analyzed by Image J software to calculate the relative expression of the Lrrc52 protein relative to β-actin.

[0080] The detection results of the relative expression of the Lrrc52 protein in each experimental group are shown in Table 1 and Figure 4 as follows. Figure 4 In [Figure], A is the detection result diagram of the protein bands in the immunoblotting experiment of each experimental group; Figure 4 In [Figure], B is the detection result diagram of the relative expression of the Lrrc52 protein in each experimental group. From left to right in the figure are: the control group injected with AAV9 empty vector and receiving sham surgery (AAV9-Control+Sham), the experimental group injected with AAV9 vector overexpressing Lrrc52 and receiving sham surgery (AAV9-Lrrc52+Sham), the experimental group injected with AAV9 empty vector and receiving myocardial ischemia-reperfusion injury treatment (AAV9-Control+AIRI), and the experimental group injected with AAV9 vector overexpressing Lrrc52 and receiving myocardial ischemia-reperfusion injury treatment (AAV9-Lrrc52+AIRI). The same applies hereinafter.

[0081] Table 1 Detection results of the relative expression of the Lrrc52 protein in each experimental group

[0082]

[0083]

[0084] Note: The relative expression of the protein was detected in 6 mice in each experimental group. The same applies hereinafter.

[0085] As shown in Table 1 and Figure 4As shown, compared with the AAV9-Control+Sham group, the relative expression levels of Lrrc52 protein in the heart tissues of mice in the AAV9-Lrrc52+Sham group were significantly increased; similarly, compared with the AAV9-Control+AIRI group, the relative expression levels of Lrrc52 protein in the heart tissues of mice in the AAV9-Lrrc52+AIRI group were also significantly increased. This result indicates that AAV9-Lrrc52 can effectively increase the protein expression level of Lrrc52, and the difference is highly statistically significant (*** indicates p<0.001).

[0086] 2. TUNEL and α-actinin staining: After the treatment in Example 2 was completed, that is, 24 hours after the I / R surgery or sham surgery, the mice were anesthetized and then sacrificed to collect heart tissue samples. After the heart tissues were cross-sectioned, they were quickly immersed in OCT embedding medium and stored frozen in a -80°C refrigerator. The tissue blocks were taken out of the refrigerator for frozen sectioning. After sectioning, TUNEL and α-actinin staining were performed. After the tissue sections were air-dried, they were mounted with 50% glycerol prepared with sterilized water and stored in the dark. Finally, the sections were observed using a laser confocal microscope, images were collected, and the apoptosis rate of mouse heart tissues was calculated and analyzed using ImageJ software.

[0087] The experimental results of evaluating the effect of overexpressing Lrrc52 on cardiomyocyte apoptosis in mice with myocardial ischemia-reperfusion injury by TUNEL and α-actinin staining are shown in Table 2 and Figure 5 as follows. In the figure, A is a representative image of TUNEL and α-actinin staining of mouse myocardial tissues. In the figure, B is a statistical analysis of the apoptosis rate of heart tissues in each experimental group based on the results of TUNEL and α-actinin staining. In the statistical results, the *** symbol indicates that the difference in the apoptosis rate is extremely statistically significant compared with the control group (p<0.001), and ns indicates no significant difference.

[0088] Table 2 Effect of overexpressing Lrrc52 on cardiomyocyte apoptosis in mice with myocardial ischemia-reperfusion injury

[0089]

[0090]

[0091] As shown in Table 2 and Figure 5 it can be seen that compared with the Sham group, the apoptosis rate of the heart tissues of mice in the IRI group was significantly increased, and compared with the AAV9-Control group, the apoptosis rate of the heart tissues of mice in the AAV9-Lrrc52 group was significantly reduced after IRI. It shows that overexpression of Lrrc52 helps to improve the necrosis of mouse cardiomyocytes.

[0092] 3. Determination of lactate dehydrogenase (LDH) activity: After the treatment in Example 2 ended, that is, 24 hours after the I / R surgery or sham surgery, the mice were anesthetized and sacrificed, and then the blood samples of the mice were collected immediately. The collected blood was left standing overnight at 4°C. After the blood coagulated, the upper-layer serum was separated and obtained. Then, the serum sample was appropriately diluted to meet the operation requirements of the lactate dehydrogenase (LDH) activity detection kit, and further quantitative analysis of the LDH activity was carried out.

[0093] The effect of overexpressing Lrrc52 on the activity of lactate dehydrogenase (LDH) in the serum of mice with myocardial ischemia-reperfusion injury is shown in Table 3 and Figure 6 as follows.

[0094] Table 3 Effect of overexpressing Lrrc52 on the activity of lactate dehydrogenase (LDH) in the serum of mice with myocardial ischemia-reperfusion injury

[0095]

[0096] As shown in Table 3 and Figure 6 as follows, the activities of lactate dehydrogenase (LDH) in the sera of mice in the AAV9-Control+Sham group and the AAV9-Lrrc52+Sham group were both maintained at a low level. In contrast, the LDH activity in the serum of mice in the AAV9-Control+IRI group increased significantly, reflecting a significant increase in the degree of myocardial cell necrosis. After the mice overexpressing Lrrc52 experienced ischemia-reperfusion injury, the LDH activity in their sera decreased significantly, indicating that the overexpression of Lrrc52 helps to improve the necrosis condition of myocardial cells in mice. Statistical significance is indicated by asterisks, where * represents p<0.05, and ** represents a highly significant p<0.01, and ns indicates no significant difference.

[0097] Example 3

[0098] 1. The grouping of mice and the establishment of the I / R surgery model were the same as in Example 2.

[0099] 2. Tail vein injection of the virus

[0100] The mice in the experimental group (I / R group) were evenly divided into two groups, named the AAV9-Control+IRI group and the AAV9-Lrrc52+IRI group respectively.

[0101] For the pathological ventricular remodeling model induced after myocardial ischemia-reperfusion (I / R) surgery, sampling and detection were carried out 3 weeks after the I / R surgery.

[0102] The specific experimental procedures are as follows: One week before the implementation of Experimental Step 1, that is, one week before the implementation of the ischemia-reperfusion surgery model (I / R), the experimental group mice were respectively placed on the tail vein injection device. First, the skin of the mice's tails was thoroughly disinfected with alcohol. Then, using a disposable insulin needle, through tail vein injection, each mouse was precisely injected once with a dose of 1×10 11 vg of the virus. Among them, the AAV9-Lrrc52+IRI group was injected with AAV9-Lrrc52 prepared in Example 1; the AAV9-Control+IRI group was injected with AAV9-Control prepared in Example 1. After injection, absorbent cotton was used to gently press the tails of the mice to stop bleeding, and then the mice were safely placed back into the cage. One week after virus injection, the subsequent experimental procedures were carried out on the experimental group mice according to the aforementioned Step 1, that is, an induced ventricular adverse remodeling model (IRI) of ischemia-reperfusion injury was constructed. Three weeks after the I / R surgery, echocardiography was performed on the mice to evaluate their in vivo cardiac function status. After the echocardiography detection, the mice were anesthetized and sacrificed, and then cardiac tissue samples were taken for detecting the level of myocardial fibrosis.

[0103] The control group (Sham group) mice were evenly divided into two groups, named AAV9-Control+Sham group and AAV9-Lrrc52+Sham group respectively. The specific experimental procedures were the same as above, that is, the AAV9-Control+Sham group was injected with the same amount of AAV9-Control as in the above steps, and the AAV9-Lrrc52+Sham group was injected with the same amount of AAV9-Lrrc52 as in the above steps. After breeding for 1 week, a sham operation was performed. Three weeks after the sham operation, relevant indicators of the mice were detected.

[0104] Test Example 2

[0105] 1. After the treatment in Example 3 was completed, that is, three weeks after the I / R surgery or sham operation, the relative expression levels of Lrrc52 protein in each treatment group were detected. The detection method was the same as that in Test Example 1.

[0106] The detection results of the relative expression levels of Lrrc52 protein in each experimental group are shown in Table 4 and Figure 7 as follows.

[0107] Table 4 Detection results of the relative expression levels of Lrrc52 protein in each experimental group

[0108]

[0109]

[0110] As shown in Table 4 and Figure 7As shown, compared with the AAV9-Control+Sham group, the relative expression levels of Lrrc52 protein in the heart tissues of mice in the AAV9-Lrrc52+Sham group were significantly increased; similarly, compared with the AAV9-Control+IRI group, the relative expression levels of Lrrc52 protein in the heart tissues of mice in the AAV9-Lrrc52+IRI group were also significantly increased. This result indicates that AAV9-Lrrc52 can effectively increase the protein expression level of Lrrc52, and the difference is highly statistically significant.

[0111] After the treatment in Example 3 was completed, that is, 3 weeks after the I / R surgery or sham surgery, the mice were placed in a closed glass box, anesthetized with 1.5% - 2% isoflurane, and the cardiac function of the mice was detected using a Visual Sonics 2100 small animal cardiac ultrasound device with a frequency of 30 MHz. During the detection process, the left ventricular long-axis images of the mouse heart and their corresponding M-mode images were collected to comprehensively evaluate the cardiac function status of the mice. To ensure the accuracy of the data, each evaluation index was measured three times repeatedly, and the average value was finally taken as the result.

[0112] The effects of overexpressing Lrrc52 on the cardiac function of mice with myocardial ischemia-reperfusion injury evaluated by echocardiography are shown in Tables 5 - 6 and Figure 8 as follows. Figure 8 A in Figure 8 shows representative echocardiogram images of the mouse heart, which are helpful for visually demonstrating the cardiac structure and function; Figure 8 B in

[0113] Table 5 Statistical results of the ejection fraction (EF) of the mouse heart

[0114]

[0115]

[0116] Table 6 Statistical results of the fractional shortening (FS) of the mouse heart

[0117]

[0118] The results are shown in Tables 5 - 6 and Figure 8 as follows. Overexpressing Lrrc52 can improve the cardiac function of mice with ischemia-reperfusion injury. ** indicates p < 0.01, *** indicates p < 0.001.

[0119] 3. Masson staining: After the experimental treatment in Example 3 was completed, that is, 3 weeks after the I / R surgery or sham surgery, the mice were anesthetized and sacrificed, and then the heart tissue samples of the mice were taken out. The heart tissue was cross-sectioned and immersed in a 4% paraformaldehyde solution for fixation for 48 hours. The fixed tissue was dehydrated and embedded in paraffin to prepare tissue sections with a thickness of 5 micrometers. After the section preparation was completed, dewaxing treatment was carried out, and then the tissue sections were stained using a Masson trichrome staining kit (KeyGen Biotech). After the stained tissue sections were air-dried, they were sealed with neutral resin to protect the samples and facilitate observation. Finally, the sealed tissue sections were observed through a bright-field microscope, and images were collected. Quantitative analysis was performed using ImageJ software to evaluate the content level of collagen fibers in the myocardium.

[0120] The Masson staining results of overexpressing Lrrc52 to intervene in cardiac fibrosis in mice with myocardial ischemia-reperfusion injury are shown in Table 7 and Figure 9 as follows. Figure 9 In A of, it is a representative image of the mouse heart tissue after Masson staining, and the scale bar is set to 100 micrometers; Figure 9 In B of, it is a statistical analysis of the proportion of cardiac fibrosis in each experimental group based on the Masson staining results. In the statistical results, the *** symbol indicates that the difference in the proportion of fibrosis is extremely statistically significant compared with the control group (p < 0.001).

[0121] Table 7 Statistical results of the proportion of cardiac fibrosis in each experimental group

[0122]

[0123] The results are shown in Table 7 and Figure 9 as follows. Overexpressing Lrrc52 can improve cardiac fibrosis in mice with ischemia-reperfusion injury.

[0124] In summary, a reagent overexpressing Lrrc52 protein provided by the present invention can prevent the apoptosis of cardiomyocytes after myocardial ischemia-reperfusion, optimize and improve the condition of pathological ventricular remodeling, relieve the degree of cardiac fibrosis caused by myocardial ischemia-reperfusion, and enhance the cardiac function after myocardial ischemia-reperfusion. The reagent overexpressing Lrrc52 protein opens up a new drug R & D path for the diagnosis and treatment of myocardial ischemia-reperfusion injury and / or heart failure, and determines a potential drug action target, with extremely high medicinal value and clinical significance.

[0125] Although the above embodiments have made a detailed description of the present invention, they are only a part of the embodiments of the present invention, rather than all embodiments. People can also obtain other embodiments without creative efforts based on this embodiment, and these embodiments all belong to the protection scope of the present invention.

Claims

1. Use of a product for supplementing Lrrc52 in the preparation of a medicament for preventing and / or treating myocardial ischemia-reperfusion injury and / or a disease caused by myocardial ischemia-reperfusion injury.

2. The application according to claim 1, wherein The nucleotide sequence encoding the Lrrc52 protein is as shown in SEQ ID NO.

1.

3. The application according to claim 1, wherein The product for supplementing Lrrc52 includes any one or more of the Lrrc52 protein, a fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the Lrrc52 protein, a reagent for expressing the Lrrc52 protein, and an agonist capable of activating Lrrc52.

4. The application according to claim 3, characterized in that The reagent for expressing the Lrrc52 protein includes a Lrrc52 overexpression reagent.

5. The application according to claim 1, wherein The diseases caused by myocardial ischemia-reperfusion injury include any one or more of acute ischemia-reperfusion injury, pathological ventricular remodeling, and heart failure.

6. The application according to claim 1, wherein The prevention and / or treatment includes any one or more of the following (1) to (4): (1) Improving myocardial cell necrosis; (2) Reducing the apoptosis rate of myocardial cells; (3) Improving cardiac function; (4) Alleviating the degree of cardiac fibrosis.

7. A reagent expressing Lrrc52 protein, characterized in that, It includes a recombinant vector expressing the Lrrc52 protein; the recombinant vector includes a basic vector and the nucleotide sequence encoding the Lrrc52 protein; the nucleotide sequence encoding the Lrrc52 protein is as shown in SEQ ID NO.

1.

8. The reagent according to claim 7, characterized in that, The basic vector includes an adenovirus backbone vector.

9. A drug for preventing and / or treating myocardial ischemia-reperfusion injury, characterized in that, It includes a product for supplementing Lrrc52 and a pharmaceutically acceptable excipient; the product for supplementing Lrrc52 includes the reagent described in claim 7 or 8.

10. The drug according to claim 9, wherein, The pharmaceutically acceptable excipient includes any one or more of a buffer, a diluent, a binder, a disintegrant, a lubricant, a glidant, a plasticizer, and a stabilizer.

Images