Use of itga8 gene in preparation of atrial fibrillation treatment product

Abstract

The application relates to the field of biological medicine, and discloses application of an ITGA8 gene in preparation of an atrial fibrillation treatment product. The inhibitor of the ITGA8 gene and / or an expression product thereof refers to an agent capable of inhibiting ITGA8 expression or inhibiting the function of ITGA8 expression. It is found for the first time that specific high expression of an ITGA8 gene of a subpopulation of atrial fibroblasts is related to induction of atrial fibrillation and fibrotic remodeling and structural changes caused thereby. Targeted intervention reduces ITGA8 expression and activity, can effectively solve the shortcomings that most traditional antiarrhythmic drugs for treating atrial fibrillation cannot effectively intervene in cardiac fibrosis progression, and has a remarkable effect on reducing occurrence of atrial fibrillation and pathological atrial remodeling, atrial fibrosis, and delaying disease progression.

Description

Technical Field

[0001] This application relates to the field of biomedicine, and more specifically, it relates to the application of the ITGA8 gene in the preparation of atrial fibrillation treatment products. Background Technology

[0002] Atrial fibrillation (AF) is one of the most common sustained arrhythmias in clinical practice. It can increase the risk of thrombosis, stroke, heart failure, and death, seriously affecting patient prognosis and quality of life. Epidemiological studies show that the prevalence of AF in adults is approximately 1-2%, but it can be significantly higher in the elderly. With the accelerating aging of the population, the number of AF patients is expected to continue to increase. Therefore, elucidating the cellular and molecular mechanisms of AF occurrence and maintenance, and identifying new diagnostic biomarkers, intervention targets, and treatment strategies, has significant clinical importance and application value.

[0003] Currently, most traditional antiarrhythmic drugs work by affecting ion flow in cardiomyocytes. Examples include flecainide and propafenone, which target sodium channels; and amiodarone, sotalol, and dronedelonone, which target potassium channels. While these drugs control the rhythm, they may also induce new arrhythmias. Beta-blockers / calcium channel blockers control ventricular rate by inhibiting atrioventricular node conduction, rather than directly terminating atrial fibrillation. These interventions fail to effectively address structural matrix factors such as atrial fibrosis and ion channel remodeling, and the disease continues to progress.

[0004] Therefore, exploring novel biological targets that can mediate atrial fibrosis and structural remodeling in atrial fibrillation and developing intervention strategies based on the gene or protein level have become key directions for breaking through the bottlenecks in atrial fibrillation treatment. Summary of the Invention

[0005] The purpose of this application is to provide a novel biological target that mediates the induction of atrial fibrillation and the resulting atrial fibrosis and structural remodeling, thus providing a new intervention strategy for the treatment of atrial fibrillation and the resulting atrial fibrosis.

[0006] Therefore, this application systematically identified the previously unreported gene ITGA8, which mediates atrial fibrosis remodeling in atrial fibrillation, by performing single-cell nuclear sequencing on atrial myocardial samples with structural remodeling and normal atrial myocardial samples. This gene is specifically expressed in atrial fibroblast subsets that are significantly increased in atrial fibrillation fibrosis remodeling, and this increase is significantly higher in the atrial fibrillation group compared to the normal group. In vitro experiments showed that reducing ITGA8 expression can effectively reduce the fibroblast-induced fibrosis process. Animal experiments have also demonstrated that reducing ITGA8 expression can reduce the induction rate and duration of atrial fibrillation, alleviate cardiac fibrosis, and significantly improve cardiac function. The technique of reducing ITGA8 expression and activity effectively addresses the shortcomings of most traditional antiarrhythmic drugs for treating atrial fibrillation, which cannot effectively intervene in the progression of cardiac fibrosis. It has a significant effect on reducing the occurrence of atrial fibrillation and pathological atrial remodeling and fibrosis, and delaying disease progression.

[0007] Specifically, this application provides the following technical solutions:

[0008] In one aspect, this application provides the use of inhibitors of the ITGA8 gene and / or its expression products in the preparation of medicaments for treating atrial fibrillation.

[0009] Furthermore, the inhibitor of the ITGA8 gene and / or its expression product refers to a reagent capable of inhibiting ITGA8 expression or inhibiting the function of ITGA8 expression.

[0010] Furthermore, the reagents include reagents that reduce the production of the functional ITGA8 protein and inhibitors of the ITGA8 protein.

[0011] Furthermore, the reagent for reducing the production of the functional ITGA8 protein includes: (i) Transcribed under favorable conditions into a single-stranded nucleic acid or other form of nucleic acid that has degraded ITGA8 nucleic acid; (ii) An expression vector containing a nucleotide sequence encoding the nucleic acid described in (i); (iii) ITGA8 promoter / enhancer-specific transcriptional inhibitors; and (iv) Specific epigenetic alterers that can lead to reduced ITGA8 expression.

[0012] Furthermore, the single-stranded nucleic acid includes siRNA, miRNA, and shRNA; the other forms of nucleic acid include circRNA and dsRNA. Preferably, the expression vector includes plasmids, granules, bacteriophages, and viruses.

[0013] Furthermore, the inhibitors of the ITGA8 protein include blocking antibodies and small molecule drugs that reduce the activity of the ITGA8 protein.

[0014] Furthermore, the blocking antibody includes monoclonal antibodies, polyclonal antibodies, chimeric antibodies, scFv, Fab, F(ab')2, or Fv fragments; Preferably, the small molecule drug comprises a specific small molecule blocker that targets and reduces the activity of the ITGA8 protein.

[0015] Secondly, this application provides a pharmaceutical composition for treating atrial fibrillation, the pharmaceutical composition comprising an inhibitor of the ITGA8 gene and / or its expression product.

[0016] Furthermore, the pharmaceutical composition further includes a pharmaceutically acceptable carrier; Preferably, the carrier includes a diluent, excipients (such as water), fillers (such as starch, sucrose, etc.), binders (such as cellulose derivatives, alginate, gelatin, polyvinylpyrrolidone, etc.), humectants (such as glycerin, etc.), disintegrants (such as agar, calcium carbonate, sodium bicarbonate, etc.), absorption promoters (such as quaternary ammonium compounds, etc.), surfactants (such as hexadecyl alcohol, etc.), adsorption carriers (such as kaolin, soap clay, etc.), and lubricants (such as talc, calcium and magnesium stearate, polyethylene glycol, etc.). Preferably, the pharmaceutical composition is delivered to the tissue in vivo; Preferably, the in vivo method includes directly injecting a drug containing an inhibitor of ITGA8 gene expression and activity or a protein containing an ITGA8 antibody into in vivo tissues; Preferably, the dosage form of the pharmaceutical composition is an injection; Preferably, the pharmaceutical composition is delivered via liposomes, the liposomes serving to target the drug to specific tissues and increase the drug's half-life; Preferably, the liposomes include emulsifiers, foaming agents, liquid lipids, solid lipids, insoluble monolayers, phospholipid dispersants, and surfactants; the liposomes may also include receptor molecules or other therapeutic or immunogenic compositions that can bind to targeted cells.

[0017] Thirdly, this application provides an inhibitor of the ITGA8 gene and / or its expression product, or the use of the pharmaceutical composition in combination with existing drugs in the preparation of a medicament for treating atrial fibrillation.

[0018] In summary, this application has the following beneficial effects: This invention is the first to discover that the specific high expression of the ITGA8 gene in the atrial myofibroblast subset is associated with fibrotic remodeling and structural changes caused by atrial fibrillation. Targeted intervention to reduce ITGA8 expression and activity can effectively solve the shortcomings of most traditional antiarrhythmic drugs for treating atrial fibrillation, which cannot effectively intervene in the progression of cardiac fibrosis. It has significant effects on reducing atrial remodeling and atrial fibrosis in atrial fibrillation and delaying disease progression. Attached Figure Description

[0019] Figure 1 Single-cell nuclear sequencing revealed a significant increase in FB-C2-ELN fibroblasts in atrial fibrillation samples with structural remodeling (VAF samples) compared to the normal group (SR). ITGA8 was specifically expressed in FB-C2-ELN fibroblasts and was significantly elevated in the VAF group compared to the SR group.

[0020] Figure 2 Overexpression of ITGA8 in fibroblast cell lines leads to an increase in the number of fibroblasts, while knockout leads to a decrease in the number of fibroblasts. NC represents the overexpression control group, OE represents the ITGA8 overexpression group, scramble represents the knockdown control group, and shRNA represents the ITGA8 knockdown group.

[0021] Figure 3 Animal experiments have shown that AAV intervention with ITGA8 improves cardiac function (increases EF and FS values) and reduces the induction rate and duration of atrial fibrillation. Control represents the control group, AF represents the atrial fibrillation induction group, AAV-NC-AF represents the atrial fibrillation induction group that has been switched to the control group, and AAV-ITGA8-AF represents the atrial fibrillation induction group that has been switched to AAV knockdown of ITGA8. Detailed Implementation

[0022] The technical solutions and effects of this application will be further described in detail below with reference to the embodiments and accompanying drawings. It should be understood that the specific embodiments described herein are merely for explaining the invention and are not intended to limit the invention.

[0023] It is worth noting that, in the context of this invention, "treatment of atrial fibrillation" includes both the relief of the disease and a complete cure of the disease.

[0024] Example: ITGA8 Expression and Functional Verification 1. Acquisition of human atrial tissue samples The samples described in this example were derived from human left atrial appendage tissue. Specifically, we collected left atrial appendage tissue from three patients with valvular atrial fibrillation who underwent mitral valve replacement, maze ablation, and left atrial appendage resection at West China Hospital of Sichuan University as the atrial fibrillation group sample; simultaneously, we collected left atrial appendage tissue from three age- and sex-matched healthy donors at West China Hospital of Sichuan University as the control group sample. The healthy donor tissues could be from allogeneic tissue banks that were not used for transplantation due to matching failure, unsuitable recipients, or other clinical reasons and were instead used for research purposes.

[0025] Preferably, each tissue sample is approximately 2 mm × 2 mm × 2 mm in size and weighs approximately 50 mg. Once the sample is confirmed to be suitable for research, it is immediately stored in liquid nitrogen to maximize the preservation of the integrity of nuclear RNA and transcriptome characteristics in the tissue.

[0026] 2. Tissue pretreatment and single-cell nucleus extraction Atrial tissue samples preserved in liquid nitrogen were placed on ice. The tissue was then transferred to sterile culture dishes, and an appropriate amount of pre-chilled 1× Dulbecco's Phosphate-Buffered Saline (DPBS) was added to wash away any residual preservation solution. Subsequently, the tissue was minced to 1 mm on ice. 3 This allows for complete lysis and facilitates the release of the cell nucleus.

[0027] Nuclear extraction was performed on fragmented atrial tissue using a Shbio Nuclei Isolation Kit (SHBIO, #52009-10, China), following the kit's instructions, to obtain a single-nuclear suspension. The resulting nuclear suspension was then counted using a cell counter, and the nuclear concentration was adjusted according to the requirements of the subsequent single-nuclear RNA sequencing platform. This step yields high-quality nuclear samples suitable for single-nuclear transcriptome sequencing.

[0028] 3. Construction and sequencing of single-nuclear RNA sequencing libraries The single-cell nucleus suspension obtained above (concentration of 1000 nuclei / μL) was loaded into a microfluidic single-cell sequencing platform. Library construction was performed using a 10× Genomics Chromium Single Cell 3′ Library and Gel Bead Kit v3, and the cell nuclei were loaded into the Chromium Single Cell Processor system for barcoding RNA derived from single cell nuclei.

[0029] Following the kit instructions, reverse transcription, cDNA amplification, library construction, and quality control were performed. The constructed sequencing library was then sequenced using a high-throughput sequencing platform, specifically the Illumina NovaSeq 6000 sequencing system. This step yielded gene expression data and molecular tag information for each cell nucleus.

[0030] 4. Sequencing data alignment and gene expression matrix generation The raw sequencing data were converted to FASTQ format and then preprocessed using the Cell Ranger analysis workflow. Cell Ranger 3.0.1 software was used, and analysis was performed with default and recommended parameters.

[0031] Sequencing reads were aligned to the human reference genome GRCh38 using the STAR algorithm. Subsequently, gene expression levels in each cell nucleus were counted based on unique molecular identifiers (UMIs), and non-cell-related barcodes were filtered according to the default conditions of Cell Ranger 3.0.1 software to generate a gene-barcode expression matrix for each sample. The resulting matrices were further imported into the Seurat software package for quality control, data integration, and downstream bioinformatics analysis.

[0032] 5. Quality control, integration, and dimensionality reduction clustering of single-nuclear RNA sequencing data The UMI count matrices of each atrial tissue sample were merged into a Seurat object. To obtain high-quality transcriptome data, this invention employs stringent quality control standards. Preferably, cell nuclei that simultaneously meet the following conditions are retained: First, the proportion of mitochondrial gene readings is less than 5% to reduce the influence of low-quality cell nuclei or apoptotic cell nuclei signals; Second, the number of genes detected, i.e., nFeature, is between 500 and 5000 to exclude degraded cell nuclei and potential multinucleate mixtures.

[0033] After quality control, the UMI counting matrix was logarithmically normalized, with a scale factor of 1000 being the preferred setting. Hypervariable genes were then screened, and the top 3000 hypervariable genes were selected for standardization and principal component analysis. To eliminate batch effects caused by different donors and experimental batches, the Harmony algorithm was further used to correct and integrate the principal component analysis results, effectively controlling technical differences between samples while preserving disease-related biological differences.

[0034] Based on the corrected principal component space, UMAP is used for dimensionality reduction visualization, and cell populations are segmented using graph theory clustering. Single cell nuclei are divided into multiple cell clusters at a resolution of 0.5. Furthermore, subpopulation analysis can be performed on major cell types, including cardiomyocytes, fibroblasts, endothelial cells, and myeloid cells; each major cell type can also be batch-corrected using the Harmony algorithm, and subpopulations can be segmented using graph theory clustering.

[0035] 6. Recognition and Removal of Multinucleated Mixtures To reduce the impact of technically-related binucleate or multinucleate hybrids on the analysis results, this invention further detects multinucleate hybrids in the data. Specifically, the optimal pK value is determined through parameter scanning, and the probability of each nucleus being a hybrid is calculated based on the proportion of artificial nearest neighbors (pANN).

[0036] Artificial dual nuclei in cell-cell hybrid form were generated using existing expression matrices and ranked according to pANN scores. Nuclei exceeding the expected hybrid proportion threshold were identified as dual-nucleus or multi-nucleus hybrids and removed from subsequent analyses. The expected hybrid proportion could be corrected based on the nucleus loading concentration.

[0037] 7. Cell type annotation Cell types were annotated based on the expression of marker genes in each cell cluster. The following marker genes were used for identification: Vascular endothelial cell marker genes include FLT1, CDH5, and PECAM1; Smooth muscle cell marker genes include MYH11 and CNN1; Pericyte marker genes include RGS5 and CSPG4; Neuronal cell marker genes include NRXN1 and CADM2; Myeloid cell marker genes include CSF1R, CD14, and CD68; Lymphocyte marker genes include SKAP1 and PTPRC; Lymphatic endothelial cell marker genes include FLT4, CCL21, and MPP7; Fibroblast marker genes include DCN, PDGFRA, COL1A1, COL1A2, and COL3A1; Epicardial cell marker genes include PRG4, LRP2, and WWC1; Endocardial cell marker genes include LEPR, NRG1, and PCDH7; Cardiac cell marker genes include RYR2, FGF12, and TTN; Adipocyte marker genes include PLIN1, FASN, and SCD.

[0038] The aforementioned marker genes can be used to systematically identify and compare the major cell populations and their subpopulations in the atrial tissue of the atrial fibrillation group and the control group.

[0039] 8. Screening for differentially expressed genes After cell population annotation, cell type-specific gene expression differences between the atrial fibrillation group and the control group were analyzed. The FindAllMarkers function in Seurat software was used to identify differentially expressed genes in different cell types or cell subpopulations. Screening criteria could be set to a log2 fold change greater than 0.25 and a percentage (pct.1) greater than 0.3 in the target cell population expressing the gene.

[0040] Furthermore, to improve the robustness of differential expression analysis, this invention employs a pseudo-bulk analysis strategy. Specifically, gene expression counts for the same cell type within each sample are aggregated to form a pseudo-bulk expression matrix at the sample level, and differential expression analysis is performed using DESeq2. This strategy reduces the impact of single-cell level noise and inter-sample differences on the analysis results, making the screening results for key genes related to atrial fibrillation more reliable.

[0041] according to Figure 1 The results showed that the number of FB-C2-ELN fibroblasts was significantly higher in the atrial fibrillation-associated structural remodeling samples (VAF samples) compared to the normal group (SR). ITGA8 was specifically expressed in FB-C2-ELN fibroblasts and was significantly elevated in the VAF group compared to the SR group. These results indicate that ITGA8 is a key pathogenic gene for atrial fibrillation-related atrial fibrosis and structural remodeling.

[0042] 9. Human cardiac fibroblast culture and migration ability detection To further verify the effects of candidate genes or pathways on the function of atrial fibrosis-related cells, this invention used human cardiac fibroblasts (purchased from BLUEFBIO company) for in vitro experiments. These cells were divided into NC (overexpression control group), OE (ITGA8 overexpression group), scramble (knockdown control group), and shRNA (ITGA8 knockdown group). Human cardiac fibroblasts were cultured in DMEM high-glucose medium containing 10% fetal bovine serum and 1% penicillin-streptomycin, or a supplier-recommended DMEM high-glucose medium, 10% fetal bovine serum, and 1% antibiotic mixture. Cells at passage 8 or less were preferably used for experiments to ensure cell functional stability.

[0043] Cell migration ability was assessed using a Boyden chamber or Transwell assay. A 24-well plate with 8.0 μm pores and a Transwell chamber was preferred. During the experiment, human cardiac fibroblasts were digested and counted at a density of 1 × 10⁻⁶ cells / well. 4 -2×10 5 pcs / hole, preferably 5×10 4 Cells were resuspended at a density of 100-200 μL in serum-free DMEM or DMEM / F-12 medium and seeded onto the upper layer of the chamber. The lower layer was supplemented with 500-650 μL of complete medium containing 10% fetal bovine serum as a chemotactic environment. After incubation for 6-24 h, the medium was discarded, the chambers were washed with PBS, and unmigrated cells were gently wiped from the membrane surface with a cotton swab. Cells were then fixed with 4% paraformaldehyde for 15 min, washed with PBS, and stained with 0.1%-0.2% crystal violet for 10 min. After washing three times with PBS or distilled water and air-drying, the cells were observed and photographed under an inverted microscope. The number of cells that migrated to the lower membrane surface was counted from 3-5 randomly selected fields from each chamber to evaluate changes in the migration ability of human cardiac fibroblasts after candidate gene regulation.

[0044] 10. Lentiviral-mediated gene expression regulation To investigate the role of candidate genes in atrial fibroblast function, this invention constructs a lentivirus-mediated gene expression regulation system. The target sequence is CCAGATAAGCAGGAGATAATT (SEQ ID NO:1). An empty vector plasmid is used as the control group. Specifically, HEK293T cells are seeded in culture dishes or plates to achieve 70%-80% cell confluence at transfection. On the day of transfection, the target gene expression vector or interference vector, pCMV-dR8 series packaging plasmids, and pMD2.G envelope plasmid are mixed at a mass ratio of 4:3:1 and added to serum-free culture medium to form a plasmid mixture. PEI, Lipofectamine 2000, Lipofectamine 3000, or other cationic liposome transfection reagents are added to serum-free culture medium to form a transfection reagent mixture. Preferably, when using PEI as the transfection reagent, the mass ratio of total plasmid DNA to PEI is 1:2 to 1:4, preferably 1:3. The transfection reagent mixture was then slowly added to the plasmid mixture and incubated at room temperature for 10–20 min, preferably 15 min, to form a DNA-transfection reagent complex. This complex was then uniformly added dropwise to HEK293T cell culture medium and cultured at 37°C and 5% CO2. The culture medium was replaced with fresh complete medium 6–18 h post-transfection, and the cells were cultured for another 48 h. The cell culture supernatant was then collected, centrifuged to remove cell debris, and filtered through a 0.45 μm filter to obtain viral supernatant containing lentiviral particles.

[0045] Viral supernatant was collected 48 hours after transfection, centrifuged, filtered, and concentrated using a lentivirus concentration kit (#GM-040801, Genomeditech, Shanghai, China) to obtain a high-titer lentivirus solution. The concentrated viral supernatant (MOI = 20) was then added to a human cardiac fibroblast culture system, with polybrene added to a final concentration of 10 μg / ml to improve infection efficiency. The culture medium was changed 6 to 8 hours after infection. 48 hours post-infection, 1 μg / ml puromycin was added to the culture medium, and selection was continued for one week to obtain a cell population stably expressing or stably interfering with the target gene.

[0046] 11. Male 7-8 week old Sprague-Dawley (SD) rats (provided by Shanghai Chest Hospital), weighing between 250 and 300 grams, were selected. They were randomly divided into three groups: Control, AF (atrial fibrillation induced group), AAV9-NC-AF (atrial fibrillation induced group with control), and AAV9-ITGA8-AF (atrial fibrillation induced group with AAV knockdown of ITGA8). Adeno-associated virus serotype 9 (AAV9) was used, driven by the collagen type I α2 chain (COL1A2) promoter, to ensure specific expression of the gene in cardiac fibroblasts. The target sequence was CCAGATAAGCAGGAGATAATT (SEQ ID NO:1). The control group used an empty vector. A dose of 2 × 10⁻⁶ was injected into the rats via the tail vein. 12 AAV9 was administered at a dose of vg / kg. Two weeks after AAV injection, atrial fibrillation was induced in rats by intravenous injection of a mixture of acetylcholine (ACh, 60 μg / mL) and calcium chloride (CaCl2, 10 mg / mL). Echocardiography was performed to assess EF and FS values ​​before sacrifice. For in vivo electrophysiological assessment, rats were anesthetized with intraperitoneal injection of sodium pentobarbital (40-50 mg / kg) and then placed supine on a temperature-controlled operating table. A transesophageal pacing electrode (catheter 1.1, electrode spacing 2 mm) was inserted into the esophagus until it reached the atrium, and the electrode position was confirmed by transesophageal electrocardiography. Surface and transesophageal electrocardiograms were recorded simultaneously using a biosignal acquisition system. Atrial electrophysiological stimulation was performed using a programmable stimulator. Burst pacing was used with parameters of 10 seconds / cycle, 4V voltage, 50ms interval, and 10 consecutive cycles. An AF duration exceeding 1 second is considered a successful induction. Calculate the AF induction rate and cumulative duration.

[0047] Experimental Results: The system identified ITGA8, a previously unreported gene mediating atrial fibrotic remodeling in atrial fibrillation. This gene is specifically expressed in atrial fibroblast subsets that are significantly increased during atrial fibrillation fibrotic remodeling, and this increase is more pronounced in the atrial fibrillation group compared to the normal group. Both in vitro and animal experiments demonstrated that reducing ITGA8 expression effectively slows the fibroblast-mediated fibrosis process, reduces the induction rate and duration of atrial fibrillation, and significantly improves cardiac function.

[0048] This specific embodiment is merely an explanation of this application and is not intended to limit it. After reading this specification, those skilled in the art can make modifications to this embodiment without contributing any inventive step, but such modifications are protected by patent law as long as they fall within the scope of the claims of this application.

Claims

1. The application of inhibitors of the ITGA8 gene and / or its expression products in the preparation of drugs for the treatment of atrial fibrillation.

2. The application according to claim 1, characterized in that, The inhibitor of the ITGA8 gene and / or its expression product refers to a reagent that can inhibit ITGA8 expression or inhibit the function of ITGA8 expression.

3. The application according to claim 1, characterized in that, The reagents include reagents that reduce the production of the functional ITGA8 protein and inhibitors of the ITGA8 protein.

4. The application according to claim 3, characterized in that, The reagents for reducing the production of the functional ITGA8 protein include: (i) Transcribed under favorable conditions into a single-stranded nucleic acid or other form of nucleic acid that has degraded ITGA8 nucleic acid; (ii) An expression vector containing a nucleotide sequence encoding the nucleic acid described in (i); (iii) ITGA8 promoter / enhancer-specific transcriptional inhibitors; (iv) Specific epigenetic alterers that can lead to reduced ITGA8 expression.

5. The application according to claim 4, characterized in that, The single-stranded nucleic acid includes siRNA, miRNA, and shRNA; the other forms of nucleic acid include circRNA and dsRNA. Preferably, the expression vector includes plasmids, granules, bacteriophages, and viruses.

6. The application according to claim 3, characterized in that, The inhibitors of the ITGA8 protein include blocking antibodies and small molecule drugs that reduce the activity of the ITGA8 protein.

7. The application according to claim 6, characterized in that, The blocking antibodies include monoclonal antibodies, polyclonal antibodies, chimeric antibodies, scFv, Fab, F(ab')2 or Fv fragments; Preferably, the small molecule drug comprises a specific small molecule blocker that targets and reduces the activity of the ITGA8 protein.

8. A pharmaceutical composition for treating atrial fibrillation, characterized in that, The pharmaceutical composition comprises an inhibitor of the ITGA8 gene and / or its expression product.

9. The pharmaceutical composition according to claim 8, characterized in that, The pharmaceutical composition also includes a pharmaceutically acceptable carrier; Preferably, the carrier includes a diluent, excipient, filler, binder, wetting agent, disintegrant, absorption promoter, surfactant, adsorbent carrier, and lubricant; Preferably, the dosage form of the pharmaceutical composition is an injection; Preferably, the pharmaceutical composition is delivered via liposomes; Preferably, the liposomes include emulsifiers, foaming agents, liquid lipids, solid lipids, insoluble monolayers, phospholipid dispersants, and surfactants.

10. An inhibitor of the ITGA8 gene and / or its expression product, or the use of the pharmaceutical composition of any one of claims 8-9 in combination with an existing drug in the preparation of a medicament for treating atrial fibrillation.

Images