Primer probe combination for detecting Klebsiella

Abstract

The invention provides a primer probe combination for detecting klebsiella oxytoca and / or klebsiella aerotoca. The combination comprises a combination of a forward primer, a reverse primer and a probe. The invention further provides a kit containing the primer probe combination and application of the kit.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, in particular to a primer-probe combination for detecting Klebsiella. Background Art

[0002] Klebsiella oxytoca is a Gram-negative coccus. It is commonly found in the intestines and respiratory tract of healthy individuals. It is a conditionally pathogenic bacterium that is prone to infection symptoms when the body's immune system is weakened or when undergoing surgery or various medical procedures. This bacterium is a common pathogen of community-acquired pneumonia and hospital-acquired pneumonia. When the body's resistance is reduced, normal carriers can develop local or systemic infections. In addition, there are various exogenous infections, which mainly occur in hospitals. The bacteria can be transmitted through contact between patients, between staff and patients, and various medical devices and utensils.

[0003] Klebsiella aerogenes is a member of the normal intestinal flora and an important opportunistic pathogen that can cause diseases such as urinary tract infection, respiratory tract infection, wound infection and sepsis.

[0004] Establishing sensitive, specific and rapid detection technology to monitor Klebsiella oxytoca and Klebsiella oxytoca can play a positive guiding role in the early prevention of the disease.

[0005] The biochemical reactions of Klebsiella aerogenes, Klebsiella pneumoniae, and Klebsiella oxytoca are relatively similar. The difference between Klebsiella pneumoniae and Klebsiella oxytoca during biochemical identification is that Klebsiella pneumoniae is indole-negative. The indole test typically requires inoculating the strain to be tested into culture medium and incubating at 35°C for 1-2 days, resulting in a lengthy testing process.

[0006] Because Klebsiella oxytoca and Klebsiella aerogenes have distinct serotypes, traditional bacterial morphological and physiological and biochemical characterization methods cannot meet the needs of disease prevention and control. Molecular detection methods can significantly reduce detection time, facilitating faster clinical diagnosis. Molecular biological methods have begun to be applied in pathogen detection. With the development of genomics and proteomics, an increasing number of molecular biological techniques, such as polymerase chain reaction (PCR), mass spectrometry, gene chips, and high-throughput sequencing, are being used to detect Klebsiella oxytoca and Klebsiella aerogenes in clinical laboratories.

[0007] The hydrolysis probe method in real-time quantitative PCR (RT-qPCR) is a polymerase chain reaction (PCR) method. Whether this method can directly detect Klebsiella oxytoca and Klebsiella aerogenes pathogens in samples depends on the design of a set of primers and probes with high sensitivity and specificity.

[0008] In addition, before PCR detection, it is necessary to extract pathogen nucleic acid, select internal standard genes, and design and synthesize gene primers. The sample pre-treatment is complex, the process control is strict, and the laboratory is highly dependent, which limits its application in practice. Summary of the Invention

[0009] Given the lack of methods in the art for detecting Klebsiella oxytoca and Klebsiella aerogenes pathogens with improved sensitivity and efficiency, the inventors provide a primer-probe combination for real-time quantitative PCR amplification. Compared with existing products, it has a lower Ct value, exhibits higher efficiency and higher sensitivity.

[0010] In one aspect, the present invention provides a composition comprising a combination of a forward primer, a reverse primer and a probe for detecting Klebsiella oxytoca, wherein the forward primer and the reverse primer are the forward primer shown in SEQ ID NO: 1 and the reverse primer shown in SEQ ID NO: 2.

[0011] In some embodiments, the probe is the probe shown in SEQ ID NO:3.

[0012] In some preferred embodiments, the combination of the forward primer, the reverse primer and the probe is the forward primer shown in SEQ ID NO: 1, the reverse primer shown in SEQ ID NO: 2 and the probe shown in SEQ ID NO: 3.

[0013] In some embodiments, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group, preferably wherein the fluorescent reporter group is selected from 6-FAM, HEX and ROX, and the fluorescent quencher group is selected from BHQ1 and BHQ2.

[0014] In some embodiments, the probe set forth in SEQ ID NO: 3 is labeled with 6-FAM at the 5' end and with BHQ1 at the 3' end.

[0015] In another aspect, the present invention provides a composition comprising a combination of a forward primer, a reverse primer and a probe for detecting Klebsiella aerogenes, wherein the forward primer and the reverse primer are the forward primer shown in SEQ ID NO: 4 and the reverse primer shown in SEQ ID NO: 5.

[0016] In some embodiments, the probe is the probe shown in SEQ ID NO:6.

[0017] In some preferred embodiments, the combination of the forward primer, the reverse primer and the probe is the forward primer shown in SEQ ID NO: 4, the reverse primer shown in SEQ ID NO: 5 and the probe shown in SEQ ID NO: 6.

[0018] In some embodiments, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group, preferably wherein the fluorescent reporter group is selected from 6-FAM, HEX and ROX, and the fluorescent quencher group is selected from BHQ1 and BHQ2.

[0019] In some embodiments, SEQ ID NO: 6 is tagged with ROX at the 5' end and with BHQ2 at the 3' end.

[0020] In another aspect, the present invention provides a composition comprising: a combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella oxytoca; and / or a combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella aerogenes.

[0021] In some embodiments, the forward primer and reverse primer for detecting Klebsiella oxytoca are the forward primer shown in SEQ ID NO: 1 and the reverse primer shown in SEQ ID NO: 2.

[0022] In some embodiments, the forward primer and reverse primer for detecting Klebsiella aerogenes are the forward primer shown in SEQ ID NO: 4 and the reverse primer shown in SEQ ID NO: 5.

[0023] In some embodiments, the probe for detecting Klebsiella oxytoca is the probe shown in SEQ ID NO:3.

[0024] In some embodiments, the combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella oxytoca is a forward primer represented by SEQ ID NO: 1, a reverse primer represented by SEQ ID NO: 2, and a probe represented by SEQ ID NO: 3.

[0025] In some embodiments, the probe for detecting Klebsiella aerogenes is the probe shown in SEQ ID NO:6.

[0026] In some embodiments, the combination of a forward primer, a reverse primer, and a probe for detecting Klebsiella aerogenes is a forward primer represented by SEQ ID NO: 4, a reverse primer represented by SEQ ID NO: 15, and a probe represented by SEQ ID NO: 6.

[0027] In some embodiments, the 5' end of the probe is labeled with a fluorescent reporter group, and the 3' end of the probe is labeled with a fluorescent quencher group.

[0028] In some embodiments, the fluorescent reporter group is selected from 6-FAM, HEX, and ROX, and the fluorescent quencher group is selected from BHQ1 and BHQ2.

[0029] In some embodiments, the probe set forth in SEQ ID NO: 3 is labeled with 6-FAM at the 5' end and with BHQ1 at the 3' end.

[0030] In some embodiments, the probe shown in SEQ ID NO: 6 is labeled with ROX at the 5' end and with BHQ2 at the 3' end.

[0031] In another aspect, the present invention provides a kit comprising the composition disclosed in any aspect of the present invention.

[0032] In another aspect, the present invention provides use of the composition disclosed herein in the preparation of a kit for detecting Klebsiella oxytoca and / or Klebsiella aerogenes.

[0033] In another aspect, the present invention provides a use of the composition disclosed herein in preparing a kit for diagnosing and preventing an infection or disease associated with Klebsiella oxytoca and / or Klebsiella aerogenes. In some embodiments, the disease is selected from pneumonia, antibiotic-associated hemorrhagic colitis, sepsis, and meningitis.

[0034] In another aspect, the present invention provides a method for detecting Klebsiella oxytoca and / or Klebsiella aerogenes in a sample, comprising:

[0035] Amplifying the sample using a combination of the forward primer, reverse primer, and probe disclosed in the present invention; and determining the presence or absence of Klebsiella oxytoca and / or Klebsiella aerogenes in the sample based on the amplification result.

[0036] In some embodiments, the methods are used for non-diagnostic purposes.

[0037] In some embodiments, the sample is a sample from a human or an animal, more preferably a human respiratory tract sample. In a specific embodiment, the sample is a human lung sample.

[0038] In some embodiments, the amplification is performed by real-time quantitative PCR. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 Shown are the qPCR amplification curves of the K.oxytoca-3 combination and the K.aerogenes-1 combination against a simulated human bronchoalveolar lavage fluid sample that was positive for Klebsiella aerogenes and negative for Klebsiella oxytoca.

[0040] Figure 2 Shown are the qPCR amplification curves of the K.oxytoca-3 combination and the K.aerogenes-1 combination against a simulated human bronchoalveolar lavage fluid sample that was positive for Klebsiella oxytoca and negative for Klebsiella aerogenes. DETAILED DESCRIPTION

[0041] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as those commonly understood by those of ordinary skill in the art. In addition, any methods or materials similar or equivalent to those described herein can be used in the practice of the present disclosure. All publications cited herein are incorporated by reference in their entirety.

[0042] A method for rapidly, accurately, reliably, specifically and sensitively detecting Klebsiella oxytoca and Klebsiella aerogenes infections is provided by nucleic acid amplification diagnosis of Gram-negative cocci (such as Klebsiella oxytoca and Klebsiella aerogenes). This paper describes a real-time PCR assay for quantitatively and / or qualitatively detecting Klebsiella oxytoca and Klebsiella aerogenes nucleic acids (including DNA and / or RNA) in non-biological samples or biological samples. Primers and probes for detecting and / or quantifying Klebsiella oxytoca and Klebsiella aerogenes, as well as products or test kits containing such primers and probes, are provided. Compared with other methods, the specificity and sensitivity of real-time PCR detection of Klebsiella oxytoca and Klebsiella aerogenes are improved, and real-time PCR has improved features, including real-time detection and quantification of sample accommodation and amplification products, making this technology implemented in the routine diagnosis of Klebsiella oxytoca and Klebsiella aerogenes infections in clinical laboratories. In addition, this technology can also be used for blood screening and prognosis. The K. oxytoca and K. aerogenes detection assays can also be multiplexed in parallel with other assays to detect other nucleic acids, for example, other bacteria and / or viruses.

[0043] The present invention includes oligonucleotide primers and fluorescently labeled hydrolysis probes that bind to the genomes of Klebsiella oxytoca and Klebsiella aerogenes to specifically identify Klebsiella oxytoca and Klebsiella aerogenes using amplification and detection techniques.

[0044] As used herein, the term "amplification" refers to the process of synthesizing a nucleic acid molecule that is complementary to one or both strands of a template nucleic acid molecule (e.g., a nucleic acid molecule from the genome of Klebsiella oxytoca or Klebsiella aerogenes). Amplifying a nucleic acid molecule typically involves denaturing the template nucleic acid, annealing a primer to the template nucleic acid at a temperature below the melting temperature of the primer, and enzymatically extending the primer to produce an amplified product. Amplification typically requires the presence of deoxyribonucleoside triphosphates, a DNA polymerase (e.g., Taq), and an appropriate buffer and / or cofactors for optimal polymerase activity (e.g., MgCl and / or KCl).

[0045] The terms "primer", "forward primer" and "reverse primer" as used herein have the meanings known to those of ordinary skill in the art, and refer to oligomeric compounds capable of initiating DNA synthesis by template-dependent DNA polymerase, primarily oligonucleotides, but also modified oligonucleotides, for example, the 3' end of the primer provides a free 3'-OH group, and in addition, a "nucleotide" can be linked to it by the template-dependent DNA polymerase to establish a 3' to 5' phosphodiester bond, thereby using deoxynucleoside triphosphates and thereby releasing pyrophosphate.

[0046] The terms "bind", "specifically bind" and "specifically bind" as used in the context of primers and probes refer to the annealing of one or more primers or probes to an amplification product.

[0047] The terms "extension" or "elongation" as used in the context of nucleic acids refer to when additional nucleotides (or other similar molecules) are incorporated into the nucleic acid. For example, the nucleic acid is optionally extended by a biocatalyst that incorporates nucleotides, such as a polymerase that typically adds nucleotides to the 3' end of the nucleic acid.

[0048] As used herein, the terms sequence "identity" or "similarity" refer to, in the context of two or more nucleic acid sequences, two or more sequences or subsequences that are identical or have a specified percentage of identical nucleotides when compared and aligned for maximum correspondence (e.g., as measured by sequence comparison algorithms available to those of ordinary skill in the art or by visual inspection). An exemplary algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST program, which is described in, e.g., Altschul et al., (1990), "Basic local alignment search tool", J. Mol. Biol. 215:403-410; Gish et al., (1993), "Identification of protein coding regions by database similarity search", Nature Genet. 3:266-272; Madden et al., (1996) "Applications of network BLAST server", Meth. Enzymol. 266:131-141; Altschul et al., (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res. 25:3389-3402; and Zhang et al., (1997), "PowerBLAST: A new network BLAST application for interactive or automated sequence analysis and annotation” Genome Res. 7:649-656. Each of these documents is incorporated herein by reference.

[0049] Primer probe combinations for qualitative / quantitative detection

[0050] The present disclosure provides a method for detecting Klebsiella oxytoca by amplifying a portion of a Klebsiella oxytoca nucleic acid sequence. Specifically, the present disclosure provides primers and probes for amplifying and qualitatively and / or quantitatively detecting Klebsiella oxytoca nucleic acid molecule targets.

[0051] In order to qualitatively and / or quantitatively detect Klebsiella oxytoca, the present disclosure provides a primer-probe combination for amplifying and detecting Klebsiella oxytoca.

[0052] The present disclosure provides a method for detecting Klebsiella aerogenes by amplifying a portion of a Klebsiella aerogenes nucleic acid sequence. Specifically, the present disclosure provides primers and probes for amplifying and qualitatively and / or quantitatively detecting Klebsiella aerogenes nucleic acid molecular targets.

[0053] In order to qualitatively and / or quantitatively detect Klebsiella aerogenes, the present disclosure provides a primer-probe combination for amplifying and detecting Klebsiella aerogenes.

[0054] In one embodiment, the Klebsiella primer and probe combinations shown in Table 2 and / or Table 3 herein are used to provide for detecting Klebsiella in a biological sample suspected of containing Klebsiella. The primer and probe combination can comprise or consist of primers and probes that are specific for a nucleic acid sequence of Klebsiella.

[0055] In one embodiment, the probe disclosed herein can be a Taqman probe. A Taqman probe is an oligonucleotide labeled with a fluorescent dye reporter group (Reporter, R) at its 5' end and a quencher group (Quencher, Q) at its 3' end. When the probe is intact, the fluorescent signal emitted by the reporter group is absorbed by the quencher group. As the reaction proceeds, the probe is cleaved by the Taq enzyme, the 5'-end reporter group is freed, and fluorescence is detected.

[0056] In one embodiment, the quencher group can be selected from the group consisting of BHQ series (Black Hole Quencher), MGB probe (Minor Groove Binder), MGB probe (Minor Groove Binder), Eclipse probe and Super Quencher (SQ).

[0057] In one embodiment, the reporter group may be selected from the following table:

[0058] Table 1. Fluorescent reporter groups for labeling Taqman probes

[0059]

[0060] polymerase chain reaction (PCR)

[0061] U.S. Patent Nos. 4,683,202, 4,683,195, 4,800,159 and 4,965,188 disclose conventional PCR techniques. PCR typically employs two oligonucleotide primers that are combined with a selected nucleic acid template (e.g., DNA or RNA). Primers used in some embodiments include oligonucleotides that can serve as nucleic acid synthesis starting points within the described acidogenic and / or aerogenic Klebsiella nucleic acid sequences. For maximum efficiency in amplification, primers are preferentially single-stranded, but primers may be double-stranded. First, the double-stranded primers are denatured to separate the strands. One method of denaturing double-stranded nucleic acids is by heating.

[0062] If the template nucleic acid is double-stranded, the two chains must be separated before it can be used as a template in PCR. Chain separation can be accomplished by any suitable denaturation method, including physical, chemical or enzymatic methods. One method for separating nucleic acid chains involves heating the nucleic acid until most of it is denatured (e.g., denaturation is greater than 50%, 60%, 70%, 80%, 90% or 95%). The heating conditions necessary for denaturing the template nucleic acid will depend on, for example, the buffer salt concentration and the length and nucleotide composition of the denatured nucleic acid, but typically range from about 90°C to about 105°C for a period of time, depending on reaction characteristics, such as temperature and nucleic acid length. Denaturation is typically performed for about 30 seconds to 4 minutes (e.g., 1 minute to 2.5 minutes, such as 1.5 minutes, 2 minutes).

[0063] If the double-stranded template nucleic acid is denatured by heating, the reaction mixture is allowed to cool to a temperature that promotes annealing of each primer to its target sequence. The annealing temperature is typically about 35°C to about 65°C (e.g., about 40°C to about 60°C; about 45°C to about 50°C). The annealing time may be about 10 seconds to about 1 minute (e.g., about 20 seconds to about 50 seconds; about 30 seconds to about 40 seconds). The reaction mixture is then adjusted to a temperature at which the activity of the polymerase is promoted or optimized, i.e., a temperature sufficient to allow extension to occur from the annealed primers to generate products complementary to the template nucleic acid. The temperature should be sufficient to synthesize extension products from each primer annealed to the nucleic acid template, but should not be so high as to denature the extension products from their complementary templates (e.g., temperatures for extension typically range from about 40°C to about 80°C (e.g., about 50°C to about 70°C; about 60°C). The extension time may be about 10 seconds to about 5 minutes (e.g., about 30 seconds to about 4 minutes; about 1 minute to about 3 minutes; about 1 minute 30 seconds to about 2 minutes).

[0064] PCR assays can employ nucleic acids from acid- and / or gas-producing Klebsiella and primers / probes for amplifying and / or detecting acid- and / or gas-producing Klebsiella. The template nucleic acid does not require purification; it can be a small portion of a complex mixture, such as Klebsiella nucleic acid contained in human cells. Klebsiella nucleic acid molecules and / or primers / probes for amplifying and / or detecting Klebsiella can be extracted from biological samples by conventional techniques, such as those described in Diagnostic Molecular Microbiology: Principles and Applications (Persing, et al. (eds.), 1993, American Society for Microbiology, Washington DC). Nucleic acids can be obtained from many sources, such as plasmids, or natural sources, including bacteria, yeast, viruses, organelles, or higher organisms, such as plants or animals.

[0065] The newly synthesized chain forms a double-stranded molecule, which can be used for the subsequent steps of the reaction. The steps of chain separation, annealing and extension can be repeated as needed to produce a desired number of amplified products corresponding to the target nucleic acid molecules of Klebsiella. The limiting factor in the reaction is the amount of primers, thermostable enzymes and nucleoside triphosphates present in the reaction. The cycling step (i.e., denaturation, annealing and extension) is preferably repeated at least once. For use in detection, the number of cycling steps will depend on, for example, the properties of the sample. If the sample is a complex mixture of nucleic acid, more cycling steps will be needed to increase the target sequence that is enough to detect. Typically, the cycling step repeats at least about 20 times, but can repeat up to 40, 60 or even 100 times.

[0066] Products / Kits

[0067] Embodiments of the present disclosure further provide articles or kits for detecting acid-producing and / or gas-producing Klebsiella. Articles may include primers and probes for detecting acid-producing and / or gas-producing Klebsiella gene targets, as well as suitable packaging materials. Representative primers and probes for detecting acid-producing and / or gas-producing Klebsiella are capable of specifically binding to acid-producing and / or gas-producing Klebsiella target nucleic acid molecules. In addition, the kit may also include reagents and materials required for DNA fixation, binding and detection, such as solid supports, buffers, enzymes and DNA standards, in appropriate packaging. Representative examples of primers and probes for amplifying and hybridizing acid-producing and / or gas-producing Klebsiella target nucleic acid molecules are provided herein.

[0068] The product or kit disclosed herein can be used in the Flash10 fully automatic nucleic acid detection and analysis system, which has independent nucleic acid extraction, reagent mixing, temperature control and fluorescence detection components. The experimenter only needs to place the sample to be tested into the sample cavity of the test box and tighten the tube cover, then place the test box into the loading tray, click to start the instrument to start the experiment, and protect medical staff from infection and harm. After the experiment is completed, the system can automatically determine the positive and negative results, solving problems such as lack of testing personnel and lack of experience.

[0069] The integrated rapid nucleic acid detection platform for Klebsiella oxytoca and / or Klebsiella aerogenes bacteria frees the nucleic acid testing process from the constraints of standard PCR laboratories. It is widely applicable in primary healthcare settings or where testing conditions are limited. It enables rapid diagnosis of suspected patients and on-site screening of close contacts. It provides a rapid, on-site testing method for confirming patient diagnosis, thereby enabling precise and intelligent control of infectious risks, protecting medical staff from harmful infections, and promoting modern management within primary healthcare institutions and scientific decision-making for epidemic prevention and control.

[0070] Example

[0071] The embodiments of the present application will be described in detail below in conjunction with the examples. It will be appreciated by those skilled in the art that the following examples are merely illustrative of the present application and should not be construed as limiting the scope of the present application. Specific conditions not specified in the examples are carried out according to conventional conditions or manufacturer recommendations. Reagents used or instruments not specified in the manufacturer are conventional products that can be obtained commercially. Unless otherwise specified, the amounts listed are based on gross weight and are described in parts by weight. The present application should not be construed as being limited to the specific examples described.

[0072] 1. Sample

[0073] Standard samples: Klebsiella oxytoca (CCUG 59412) and Klebsiella aerogenes (ATCC 13048) were diluted to weakly positive samples. The sample concentrations were prepared according to the following examples.

[0074] Clinical samples: human bronchoalveolar lavage fluid negative samples.

[0075] Bronchoalveolar lavage fluid simulation sample: Add a quantitative positive bacterial solution of a standard sample to a negative human bronchoalveolar lavage fluid sample to simulate samples with different bacterial concentrations in the human alveolar environment.

[0076] 2. Primer probe sequence

[0077] The sequences of the primer-probe combinations used in this example are shown in the table below.

[0078] Table 2. Oligonucleotides (primers and probes) for detection of Klebsiella oxytoca:

[0079]

[0080] Table 3. Oligonucleotides (primers and probes) for detection of Klebsiella aerogenes:

[0081]

[0082] In the table above, "F" represents the forward primer; "R" represents the reverse primer; and "P" represents the probe. The 5' and 3' ends of the probe are modified with a fluorescent group and a quencher group, respectively.

[0083] 3. Detection method

[0084] The samples were tested using real-time quantitative PCR using the primer-probe combinations listed in Tables 2 and 3. Detection can be performed using conventional amplification procedures and reaction systems. In this example, the following amplification protocol was used: 96°C for 2 minutes; 96°C for 1 second, 58°C for 1 second (fluorescence collection), and 72°C for 1 second x 45 cycles.

[0085] The following reagents were used in the qPCR reaction system in this example:

[0086] Table 4. Reagent system for simultaneous detection of Klebsiella oxytoca and Klebsiella aerogenes

[0087]

[0088]

[0089] Among them, RNaseP-F, RNaseP-R and RNP-P-CY5 are the forward primer, reverse primer and probe for detecting RNase, respectively, and are added to the system as internal controls.

[0090] The sequences of the internal reference primers and probes used in this application are as follows.

[0091] RNaseP-F: TTTGCCAATTGTACAGGGAA (SEQ ID NO:7)

[0092] RNaseP-R: GCCCTTGAAGAAGTGCCTCT (SEQ ID NO:8)

[0093] RNP-P: TGTCTCGGATCCATCTCACTGCAA (SEQ ID NO: 9) (5' end modified with CY5 fluorescent group; 3' end modified with BHQ2 quenching group).

[0094] qPCR was performed on the Flash10 fully automatic nucleic acid detection and analysis system.

[0095] 4. Test results

[0096] (1) Testing of standard samples

[0097] The standard samples were detected using the primer-probe combination for K.oxytoca-3 in Table 2 and the primer-probe combination for K.aerogenes-1 in Table 3. The qPCR amplification results are shown in Tables 5 and 6.

[0098] Table 5. Detection Ct values ​​of Klebsiella oxytoca standard samples

[0099]

[0100]

[0101] NA means not detected.

[0102] Table 6. Detection Ct values ​​of Klebsiella aerogenes standard samples

[0103] Standard samples Sample concentration K.aerogenes-1 primer probe Control primer probe Sample 1 4500 copies / mL 34.74 37.72 Sample 2 4500 copies / mL 35.39 NA Sample 3 1500 copies / mL 37.73 NA Sample 4 500 copies / mL 38.94 NA Sample 5 500 copies / mL 41.79 NA

[0104] NA means not detected.

[0105] The control primer probes in Tables 5 and 6 are detection primers for Klebsiella aerogenes and Klebsiella oxytoca in the prior art. The sequences of the control primer probes are as follows:

[0106] F:CGGTGAATACGTTCYCGG(SEQ ID NO:10)

[0107] R:GGWTACCTTGTTACGACTT(SEQ ID NO:11)

[0108] P:FAM-CTTGTACACACCGCCCGTC-TAM(SEQ ID NO:12)

[0109] (2) Detection of simulated alveolar lavage fluid samples

[0110] Simulated human bronchoalveolar lavage fluid samples were tested using the K.oxytoca-3 primer combination in Table 2 and the K.aerogenes-1 primer-probe combination in Table 3. The average value was obtained by multiple tests under the same conditions. The qPCR amplification results are shown in Tables 7 and 8.

[0111] Table 7. Amplification results of Klebsiella oxytoca in simulated bronchoalveolar lavage fluid samples

[0112]

[0113]

[0114] Table 8. Amplification results of Klebsiella aerogenes in simulated bronchoalveolar lavage fluid samples

[0115]

[0116] NA means not detected.

[0117] The results of Tables 5 to 8 above show that the primer-probe combination for Klebsiella aeruginosa or Klebsiella oxytoca is provided in the present application, and the detection Ct values ​​for different samples are all lower than those of the control primer-probe combination. This shows that compared with the prior art, the primer-probe combination provided in the present application can reach the fluorescence threshold with fewer cycles. In addition, the results also show that the primer-probe combination of the present application has a minimum detection limit of less than 55.5 copies / mL for Klebsiella oxytoca and less than 500 copies / mL for Klebsiella aeruginosa, which has a lower detection limit than the control primer-probe combination. The primer-probe combination provided in the present application achieves more efficient and sensitive detection of pathogens.

[0118] (3) Detection of simulated alveolar lavage fluid samples

[0119] Human bronchoalveolar lavage fluid (BALF) simulation samples were amplified using the system shown in Table 4. Specifically, the K.oxytoca-3 combination listed in Table 2, the K.aerogenes-1 combination listed in Table 3, and the internal control combination were simultaneously amplified for the same sample. The samples were: a) a Klebsiella aerogenes-positive, Klebsiella oxytoca-negative BALF simulation sample; and b) a Klebsiella oxytoca-positive, Klebsiella aerogenes-negative BALF simulation sample. Both samples were prepared at a concentration of 4500 copies / mL.

[0120] The test results for sample a) are as follows Figure 1 As shown, the test results for sample b) are as follows Figure 2 shown. Figure 1 and Figure 2 The corresponding results of each fluorescence channel are shown in Table 9 below.

[0121]

[0122] NA means not detected.

[0123] The above results show that the primers in the K.aerogenes-1 combination of the present application only amplify Klebsiella aerogenes in the sample but not Klebsiella oxytoca; the primers in the K.oxytoca-3 combination only amplify Klebsiella oxytoca in the sample but not Klebsiella aerogenes, indicating that the primers provided in the present application are highly specific.

[0124] The invention described and claimed herein is not limited in scope to the specific aspects disclosed herein, as these aspects are intended to be illustrative of several aspects of the invention. Any equivalent aspects are intended to be within the scope of the invention. Indeed, various modifications of the invention in addition to those shown and described herein will become clear to those skilled in the art from the foregoing description. Such modifications are also intended to fall within the scope of the appended claims. In the event of a conflict, the present disclosure, including definitions, will control.

Claims

1. A composition comprising: a combination of a forward primer, a reverse primer and a probe for detecting Klebsiella oxytoca; and / or, a combination of a forward primer, a reverse primer and a probe for detecting Klebsiella pneumoniae, Among them, The forward primer and the reverse primer for detecting Klebsiella oxytoca are the forward primer shown in SEQ ID NO:1 and the reverse primer shown in SEQ ID NO:2; and / or, the forward primer and the reverse primer for detecting Klebsiella pneumoniae are the forward primer shown in SEQ ID NO:4 and the reverse primer shown in SEQ ID NO:

5.

2. The composition of claim 1, wherein the probe for detecting Klebsiella oxytoca is the probe shown in SEQ ID NO:3; and / or, the probe for detecting Klebsiella pneumoniae is the probe shown in SEQ ID NO:

6.

3. The composition of claim 1 or 2, wherein: The combination of the forward primer, the reverse primer and the probe for detecting Klebsiella oxytoca is: the forward primer shown in SEQ ID NO:1, the reverse primer shown in SEQ ID NO:2 and the probe shown in SEQ ID NO:3, and / or, the combination of the forward primer, the reverse primer and the probe for detecting Klebsiella pneumoniae is: the forward primer shown in SEQ ID NO:4, the reverse primer shown in SEQ ID NO:5 and the probe shown in SEQ ID NO:

6.

4. The composition of any one of claims 1-3, wherein the 5' end of the probe is labeled with a fluorescent reporter group and the 3' end of the probe is labeled with a fluorescent quenching group.

5. The composition of claim 4, wherein the fluorescent reporter group is selected from 6-FAM, HEX and ROX, and the fluorescent quenching group is selected from BHQ1 and BHQ2.

6. The composition of any one of claims 2-5, wherein: the probe shown in SEQ ID NO:3 is labeled with 6-FAM at the 5' end and BHQ1 at the 3' end; and / or the probe shown in SEQ ID NO:12 is labeled with ROX at the 5' end and BHQ2 at the 3' end.

7. A kit comprising the composition of any one of claims 1-6.

8. Use of the composition of any one of claims 1-6 or the kit of claim 7 in the preparation of a kit for diagnosing or preventing an infection or disease associated with Klebsiella oxytoca and / or Klebsiella pneumoniae, Preferably, the disease is selected from pneumonia, antibiotic-associated hemorrhagic colitis, sepsis and meningitis.

9. A method for detecting Klebsiella oxytoca and / or Klebsiella pneumoniae in a sample, comprising: amplifying the sample using the combination of the forward primer, the reverse primer and the probe defined in any one of claims 1-6; and determining the presence or absence of Klebsiella oxytoca and / or Klebsiella pneumoniae in the sample according to the amplification result, Preferably, the sample is a sample from a human or an animal, more preferably a human respiratory sample, such as a lung sample.

10. The method of claim 9, wherein the amplification is performed by real-time quantitative PCR.

Images