Kasp marker EL-5-KASP-387 closely linked with corn ear length and application of Kasp marker EL-5-KASP-387
By developing the KASP marker EL-5-KASP-387, which is closely linked to ear length in maize, the problems of low linkage and insufficient detection throughput of existing maize ear length markers have been solved. This enables early and accurate identification of the ear length trait and efficient breeding, and is adaptable to various breeding materials and ecological environments, forming a complete breeding solution.
Patent Information
- Application Number
- CN202610355505.2
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2026-03-23
- Publication Date
- 2026-05-12
AI Technical Summary
Existing molecular markers related to maize ear length suffer from insufficient linkage, low detection throughput, cumbersome operation, unstable genetic effects, and inability to meet the needs of high-throughput genotyping and breeding of large-scale germplasm resources. Furthermore, the lack of a standardized application system leads to low selection efficiency and poor phenotypic prediction accuracy, making it difficult to widely apply to maize germplasm improvement in different ecological zones.
We developed a KASP marker EL-5-KASP-387 that is closely linked to maize ear length. Using a specific Indel site and the corresponding KASP molecular marker primer set, we achieved genotyping by reading fluorescence signals. Combined with multi-environment validation and quantitative formulas, we established a standardized technical process from genotyping to field breeding.
It enables early and accurate identification of maize ear length traits, shortens the breeding cycle, improves selection accuracy and efficiency, is applicable to various types of breeding materials, adapts to different ecological environments and planting seasons, forms a complete molecular marker-assisted breeding process, and has broad industrial applicability and industrial application value.
Smart Images

Figure CN122012792A_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant molecular breeding technology, and more specifically, to a Kasp marker EL-5-KASP-387 closely linked to maize ear length and its applications. Background Technology
[0002] With the rapid development of molecular biology and high-throughput sequencing technologies, molecular marker-assisted breeding has become a core technology for crop genetic improvement. Through molecular markers closely linked to target traits, precise screening of target genotypes can be completed at the seedling stage, overcoming the time and environmental limitations of phenotypic identification and significantly improving breeding efficiency and selection accuracy. Single nucleotide polymorphisms (SNPs) and insertion / deletion (Indel) markers, as the most widely distributed and genetically stable types of genetic variation in the genome, are ideal materials for molecular marker development. Competitive allele-specific PCR (KASP) technology is a PCR-based biallelic genotyping technique that eliminates the need for gel electrophoresis separation, allowing genotype determination solely through fluorescence signal reading. It boasts significant advantages such as high throughput, high precision, low cost, and ease of operation, and has been widely applied throughout the entire breeding process, including crop gene mapping, germplasm resource identification, and molecular marker-assisted selection, becoming a core genotyping platform for modern crop molecular breeding.
[0003] Although molecular marker technology has been widely used in maize breeding, the development and application of functional molecular markers for the maize ear length trait still suffers from significant technical shortcomings, failing to meet the practical needs of breeding. Firstly, existing QTL mapping studies related to maize ear length mostly locate large genomic regions, resulting in insufficient linkage between markers and major ear length QTLs. In breeding applications, these markers are prone to genetic recombination with target loci, leading to low marker selection efficiency and poor phenotypic prediction accuracy. Most markers remain at the theoretical research level and cannot be directly applied to large-scale breeding practices. Secondly, most publicly available maize ear length-related molecular markers are SSR markers and traditional Indel markers requiring gel electrophoresis detection. These have low throughput, cumbersome procedures, and are time-consuming and labor-intensive, failing to meet the high-throughput genotyping requirements of thousands of germplasm resources in modern breeding. Furthermore, the few developed maize ear length KASP markers lack systematic validation in diverse ecological environments and large-sample natural populations. The genetic effects of these markers are unstable, exhibiting low phenotypic prediction concordance in maize materials with different genetic backgrounds and planting regions, severely limiting their application scope. Third, the development of existing maize ear length-related markers is mostly based on parental segregating populations. These markers can only achieve effective genotyping in offspring materials derived from specific parents, resulting in poor universality within natural populations composed of core maize breeding materials in my country. They cannot be widely applied to maize germplasm improvement in different heterotic groups and ecological zones. There is a lack of KASP functional markers that are directly associated with major functional loci of ear length, have tight linkage, and strong universality. Fourth, existing technologies lack a standardized application system for maize ear length KASP markers. The PCR reaction system and amplification procedure for the markers have not been systematically optimized, and genotyping lacks quantitative correction methods and clear thresholds. This leads to poor repeatability of test results from different laboratories and operators, preventing the formation of a standardized technical process from genotyping to field breeding applications, severely limiting the industrialization and large-scale application of the markers. Summary of the Invention
[0004] The purpose of this invention is to provide a Kasp marker EL-5-KASP-387 closely linked to maize ear length and its application, in order to solve the problems mentioned in the background art, which suggest that traditional maize ear cob color screening relies on phenotypic observation at maturity, resulting in long cycles, low efficiency, and strong subjectivity.
[0005] To achieve the above objectives, the present invention provides a Kasp marker EL-5-KASP-387 closely linked to maize ear length. 1. A Kasp marker EL-5-KASP-387 closely linked to maize ear length, characterized in that it includes a specific Indel site and a corresponding set of KASP molecular marker primers; the Indel site is located at position 184049387 on maize chromosome 5, and has a polymorphism of - / TGA; The KASP is labeled EL-5-KASP-387, and the corresponding primer set includes forward primer 1, forward primer 2, and reverse primer; The sequence of forward primer 1 is GAAGGTGACCAAGTTCATGCTAAACGTCGAAGGACCATCAA; the sequence of forward primer 2 is GAAGGTCGGAGTCAACGGATTAAACGTCGAAGGACCATCAT; and the sequence of reverse primer is TCTTGTGCCATCTCACATGCT. The degree of linkage between the KASP marker and the major QTL for ear length in maize was calculated using the following formula, and the genetic effect of the ear length trait corresponding to the marker was quantified using the following formula: ; ; ; ; ; ; In the above formula, D' is the linkage disequilibrium coefficient between the marker and the major QTL for spike length, and D is the linkage disequilibrium degree between loci. This represents the frequency of the TGA allele in a natural population. This represents the frequency of the long spike phenotype in natural populations. The haplotype frequencies of TGA alleles coexisting with the long spike phenotype are represented. This represents the theoretical maximum value of the chain imbalance. The value ranges from 0 to 1. When the value is ≥0.9, it indicates a close linkage between the marker and the ear length trait; 'a' is the additive effect value of the ear length trait, and 'd' is the dominant effect value of the ear length trait. For dominance, The mean spike length phenotype of the TGA:TGA homozygous genotype population. The mean spike length phenotype of the -:- homozygous genotype population. The mean spike length phenotype of the TGA:- heterozygous population was used to determine the gene action mode of the dominant locus, providing a quantitative basis for the genetic effect of molecular marker-assisted selection.
[0006] Preferably, the concentrations of forward primer 1 and forward primer 2 are independently 4 to 10 μmol / L, and the concentration of the reverse primer is 4 to 10 μmol / L. The concentration range is suitable for PCR reaction systems of different sizes, such as 10 μL, 20 μL, and 50 μL. When the reaction system is expanded or reduced by a factor of 1, the primer concentration is adjusted synchronously in proportion to ensure that the molar ratio of primer to template DNA is maintained between 1:5 and 1:10.
[0007] Preferably, the volume ratio of forward primer 1, forward primer 2, and reverse primer in the primer set is 2:2:5. The volume ratio is determined based on the difference in primer Tm values and optimization of binding efficiency. The Tm values of forward primer 1 and forward primer 2 are both 60℃ to 62℃, and the Tm value of the reverse primer is 58℃ to 60℃. This volume ratio can ensure the balance of competitive binding of the three primers in the PCR reaction. When preparing the primer mix, take 6μL of forward primer 1, 6μL of forward primer 2, and 15μL of reverse primer according to the above volume ratio, add 23μL of ddH2O and mix well to form a 50μL primer mix for later use.
[0008] Preferably, the genetic contribution of the KASP marker to the spike length trait is verified by the phenotypic variation explanation rate formula after correction by a multi-environment mixed linear model, as follows: ; ; In the above formula, PVE is the marker-explained phenotypic variation rate of the ear length trait, Vp is the total phenotypic variance of the ear length trait, Vg is the genetic variance corresponding to the marker, Vs is the variance component caused by population structure, Vk is the variance component caused by inter-material kinship, Ve is the environmental error variance, and Vg+e is the sum of residual variances not including marker effects. This formula corrects for the interference of population structure and kinship on phenotypic variation, accurately quantifies the true genetic contribution of markers to the ear length trait, and the PVE is not less than 10%.
[0009] Preferably, the forward primer 1 and forward primer 2 have a single base difference at the 3' end, specifically matching the two allelic variations of the Indel site. The GC content of the 15 consecutive bases from the 3' end to the 5' end of the primer is 40% to 60%, and there are no primer dimers or hairpin structures, ensuring the specificity of PCR amplification and the accuracy of genotyping.
[0010] On the other hand, the present invention also provides an application of screening long-eared maize using the above-mentioned Kasp marker EL-5-KASP-387, wherein the method for screening long-eared maize using the Kasp marker EL-5-KASP-387 includes the following steps: Step 1: Extract genomic DNA from maize samples; Step 2: Using the genomic DNA as a template, perform PCR amplification using the primer set to obtain the amplification product; Step 3: Perform KASP genotyping on the amplified products, calculate the corrected fluorescence signal-to-noise ratio using the following formula, and perform clustering based on the signal-to-noise ratio to determine the genotype; Step 4: Identify the ear length trait of maize based on genotype and screen for maize with the target long ear length; The fluorescence signal-to-noise ratio correction formula is as follows: ; ; The multi-environment weighted genotype-phenotype matching verification formula is as follows: ; ; In the above formula, This represents the signal-to-noise ratio after FAM channel correction. for Signal-to-noise ratio after channel correction. , This represents the measured fluorescence value of the corresponding channel in the sample well. , This represents the mean background fluorescence value of the corresponding channel in the blank control well. The measured fluorescence value of the reference dye ROX in the sample well. The mean background fluorescence value of ROX in the blank control wells; the genotype determination rule is as follows: / When the value is ≥10, it is determined to be a TGA:TGA homozygous type. / A value ≥10 indicates a homozygous type, and 0.1 < / <10 indicates a TGA:- heterozygous type; the ear length trait identification rule is that TGA:TGA homozygous and TGA:- heterozygous types correspond to long ear length traits, while -:- homozygous types correspond to short ear length traits; WMC is the multi-environment weighted matching degree, and m is the total number of experimental environments. Let be the weight coefficient for the j-th environment. Let be the number of samples in the j-th environment whose genotype and phenotype match. Let J be the total number of samples detected in the j-th environment. For the broadly heritable power of the spike length trait in the j-th environment, the WMC is not less than 99%.
[0011] Preferably, the PCR amplification reaction system in step 2, in 10 μL increments, includes 2 μL of maize genomic DNA, 0.14 μL of primer set, 5 μL of 2xProbeMixA solution, and the remainder ddH2O; the concentration of the maize genomic DNA is 50 to 100 ng / μL, and the DNA purity must meet the requirements of an OD260 / OD280 ratio between 1.8 and 2.0, and an OD260 / OD230 ratio not less than 1.5; the 2xProbeMixA solution contains hot-start Taq enzyme, dNTPs, and Mg... 2+ FAM fluorescently labeled probe, HEX fluorescently labeled probe and PCR buffer, wherein Mg 2+ The concentration of the active ingredient was 2.0 to 2.5 mmol / L, and the concentration of dNTPs was 0.2 to 0.3 mmol / L; the balance ddH2O was enzyme-free sterile water, which was filtered through a 0.22 μm filter membrane to avoid nuclease contamination.
[0012] Preferably, the PCR amplification reaction program in step 2 is as follows: First stage: pre-denaturation at 95℃ for 10 min, used to activate the hot-start Taq enzyme and completely unwind the maize genomic DNA; Second stage: denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s, for a total of 10 cycles, with the annealing temperature gradually decreasing to 56℃ in a 0.5℃ gradient per cycle; Third stage: denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 31 cycles, with the annealing temperature matching the Tm value range of the primer set to ensure specific primer binding; Fourth stage: holding at 25℃ for 10 min, used to terminate the reaction and stabilize the product; After the reaction, the amplified product can be stored at 4℃ for a short period, not exceeding 72 hours.
[0013] Preferably, the genomic DNA extraction in step 1 is performed using the CTAB method. The specific steps are as follows: Weigh 1.0g of fresh corn leaves, chop them, grind them into powder using liquid nitrogen, add 3mL of 1.5×CTAB and grind into a homogenate, transfer to a 15mL centrifuge tube, rinse the mortar with 1mL of 1.5×CTAB and transfer to the same centrifuge tube, incubate at 65℃ for 30min with occasional gentle shaking; after cooling to room temperature, add an equal volume of chloroform-isoamyl alcohol mixture, wherein the volume ratio of chloroform to isoamyl alcohol in the chloroform-isoamyl alcohol mixture is 24:1, and gently... Invert the centrifuge tube and mix until the lower layer turns dark green; centrifuge at 4200 rpm for 10 min, transfer the upper aqueous phase to a new 15 mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix gently and let stand for 5 min, then place in a -20℃ freezer for 30 min to precipitate DNA; centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to air dry the DNA at room temperature, add 50 μL of TE buffer to dissolve the DNA, the pH of the TE buffer is 8.0.
[0014] As a preferred option, after screening to obtain the target long-eared maize in step 4, a breeding step is also included: selecting the TGA:TGA homozygous long-eared maize obtained from the screening as the parent, artificially pollinating it according to conventional hybridization techniques, obtaining F1 generation seeds and planting them; Genomic DNA was extracted from leaves during the F1 generation seedling stage. Steps 1 to 4 were repeated for detection and screening, and individuals with the TGA:- heterozygous genotype were retained. The F1 generation heterozygous individuals were used as female parents and backcrossed with the target long-eared long parent to obtain BC1F1 generation seeds. After planting the BC1F1 generation seeds, genotyping was performed, and individuals carrying the TGA allele were retained. After 3 to 5 generations of backcrossing and self-pollination purification, a stable genetic long-eared long maize inbred line was cultivated. The maize samples include one or more of maize inbred lines, maize hybrids, and maize DH lines. Maize inbred line samples are suitable for screening homozygous genotypes and purifying breeding materials; maize hybrid samples are suitable for predicting F1 ear length and detecting seed purity; and maize DH line samples are suitable for verifying genetic stability and analyzing marker effects. The samples are taken from fresh leaves from the seedling stage to maturity, with a sample size of not less than 0.5g. After sampling, the samples should be frozen at -80℃ or DNA extracted immediately to avoid nucleic acid degradation. The applications cover maize samples from different planting seasons, such as spring sowing, summer sowing, and autumn sowing.
[0015] Compared with the prior art, the beneficial effects of the present invention are as follows: First, this invention is the first to accurately locate the Indel functional site at position 184049387 on maize chromosome 5, which is closely linked to the ear length trait. The KASP marker EL-5-KASP-387 developed based on this site has a linkage disequilibrium coefficient D' of 0.94 with the major QTL for maize ear length, exhibiting extremely high linkage tightness. This fundamentally solves the technical defects of existing technologies, such as low linkage degree, insufficient genotyping specificity, and poor phenotypic prediction consistency of molecular markers related to maize ear length. It possesses outstanding substantive features and significant technological advancements, meeting the core inventiveness requirements for patent authorization. This invention fully discloses the primer sequence corresponding to the marker, the PCR amplification system and procedure, and the rules and quantitative methods for genotyping. Furthermore, it has completed the systematic verification of marker effectiveness through a large-sample experiment involving 465 natural populations in three independent ecological environments. The technical solution is complete and reproducible. Those skilled in the art can replicate the technical effects of this invention based on the content disclosed in the specification without any inventive effort, fully complying with the statutory requirements of the Patent Law regarding full disclosure in the specification. Furthermore, this invention establishes corresponding quantitative calculation formulas and judgment thresholds for the linkage tightness of markers, genetic effects, phenotypic variation explanatory power, and genotype-phenotype matching degree, clearly defining the protection boundaries of core technical features, avoiding ambiguity in the scope of protection of claims, and providing clear quantitative basis for stable protection of patent rights and infringement determination.
[0016] Secondly, the technical solution of this invention possesses the core practicality required by patent law. The developed KASP marker eliminates the need for gel electrophoresis separation, enabling precise genotyping solely through fluorescence signal reading. This allows for early identification and screening of ear length traits during the corn seedling stage, eliminating the need to wait for field phenotypic surveys after corn physiological maturity. This significantly shortens the breeding cycle for long-eared corn germplasm, reduces the workload of field phenotypic identification and breeding costs, and solves the industry pain points of long phenotypic selection cycles, low efficiency, and susceptibility to environmental factors in traditional corn ear length breeding. It can produce stable and reproducible positive technical effects. Furthermore, the technical solution of this invention is adaptable to various breeding material types, including corn inbred lines, hybrids, and DH lines. It can cover multiple core aspects of corn breeding, such as homozygous parent screening, hybrid purity identification, backcrossing and conversion of target traits, and germplasm resource identification and evaluation. Its applicability covers different ecological environments and breeding scenarios in various corn-producing areas and planting seasons across my country, demonstrating broad industrial applicability. Based on this, the present invention establishes a complete molecular marker-assisted breeding process for long-eared maize based on core markers, forming a complete technical solution from genotype detection to directional variety improvement. This technical solution not only has single-point innovation of core markers, but also forms a complete technical system that can be directly applied to industrialization, with clear industrial application value and patent transformation prospects. Attached Figure Description
[0017] The accompanying drawings are provided to further illustrate the invention and form part of the specification. They are explained in detail together with the embodiments of the invention, but do not constitute a limitation thereof.
[0018] Figure 1 This is a distribution diagram of ear length traits in an embodiment of the present invention; Figure 2 This is a chromosome distribution diagram of SNP markers according to an embodiment of the present invention; Figure 3 The Manhattan plot and QQ plot are shown in the genome-wide association analysis of maize ear length in this embodiment of the invention. Figure 4 Regional correlation analysis and LD heatmap of candidate factor Zm00001eb246010 in embodiments of the present invention; Figure 5 This is a phenotypic analysis diagram of haplotype ear length in an embodiment of the present invention; Figure 6 This is a graph showing the phenotypic effect value analysis of spikelet length based on the Indel site at position 184049387 in resequencing data, according to an embodiment of the present invention. Figure 7 This is a graph showing the KASP molecular marker typing results for maize ear length in an embodiment of the present invention; Figure 8This is a graph showing the correlation between KASP marker genotype and spike length phenotype in an embodiment of the present invention. Detailed Implementation
[0019] The technical solutions of the present invention will be clearly and completely described below with reference to the embodiments and accompanying drawings. Obviously, the described embodiments are only some embodiments of the present invention, and not all embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of the present invention.
[0020] This invention locates an Indel functional locus closely linked to the ear length trait in maize through genome-wide association analysis. Based on this locus, a specific KASP molecular marker and matching primer set were developed, enabling precise identification of ear length trait at the maize seedling stage without waiting for phenotypic surveys at maturity. This significantly shortens the breeding cycle for maize varieties with long ears and long stems, improves the screening efficiency and selection accuracy of maize germplasm with long ears and long stems, and provides precise, efficient, and high-throughput technical support for high-yield molecular breeding of maize. Unless otherwise specified, all experimental materials, reagents, and instruments used in this invention can be obtained through conventional commercial channels; and unless otherwise specified, all experimental methods and data analysis methods used are conventional techniques in the field.
[0021] Example 1: Investigation and Phenotypic Data Analysis of Ear Length Trait in Maize Inbred Lines This embodiment uses 465 high-quality maize inbred lines (DH lines) with diverse phenotypes and broad breeding representativeness selected in the past 15 years as experimental materials. In 2025, they were planted in three independent ecological environments: Guangxing Village, Yangshu Street, Acheng District, Harbin City, Heilongjiang Province (126°53′8.73″E, 45°29′39.88″N); Huojian Town, Wangkui County, Suihua City, Heilongjiang Province (126°20′23″E, 46°35′34″N); and Changfu Village, Liming Town, Zhaodong City, Heilongjiang Province (125°22′28″E, 45°11′24″N). Phenotypic identification and genetic characteristic analysis of ear length traits were systematically carried out.
[0022] The experiment employed a randomized block design, with each maize inbred line planted in two rows, 3m long, with a row spacing of 0.65m and a plant spacing of 0.2m. Field management of fertilizer and water, as well as pest and weed control, remained consistent with local conventional field production. After the maize reached physiological maturity, marginal plants with abnormal growth at both ends of each row were removed. Five representative healthy plants were randomly selected from each material. After harvesting the ears, ear length traits were measured indoors, and the raw data of ear length phenotypes for all materials under the three environments were recorded and compiled.
[0023] Descriptive statistical analysis was performed on the ear length phenotypic data under three environments using Microsoft Excel 2022 and IBM SPSS Statistics V27.0 software. The mean, maximum, minimum, standard deviation, coefficient of variation, skewness, and kurtosis were calculated to systematically evaluate the distribution characteristics and variation amplitude of the phenotypic data. Origin 2021 software was used to plot the frequency distribution histogram of ear length trait and perform normality tests. The R language lme4 package was used to perform multi-environment joint ANOVA on the ear length phenotypic data to estimate the generalized heritability h² under each environment and in the multi-environment joint analysis. The calculation formula is as follows: ; In the formula, Vg is the genotype variance, Vge is the genotype-environment interaction variance, Ve is the error variance, m is the number of experimental environments, and r is the number of replicates in each environment.
[0024] Phenotypic analysis showed that the mean ear length of maize under the three environments ranged from 15.09 cm to 16.06 cm, with phenotypic variation ranges of 8.12 cm to 23.06 cm, 8.60 cm to 22.66 cm, and 7.90 cm to 24.22 cm, respectively. The coefficient of variation ranged from 14.98% to 16.94%, with all environments having a coefficient of variation exceeding 14%. This indicates that the ear length trait of this maize inbred line population exhibits extremely rich phenotypic variation, possessing excellent genetic improvement potential and gene mining value. The absolute values of skewness and kurtosis of the ear length trait were both less than 1, conforming to the normal distribution characteristics of continuous quantitative traits, and meeting the data analysis requirements for subsequent genome-wide association studies.
[0025] Heritability analysis results showed that the single-environment heritability of ear length in the three environments was 85%~90%, and the broad-sense heritability in the multi-environment combined analysis reached 92%. This indicates that the ear length trait of maize is mainly controlled by genetic factors, with environmental influence accounting for a relatively small proportion. The trait has strong genetic stability and provides a solid genetic basis for carrying out molecular marker development and molecular marker-assisted selection.
[0026] Example 2: Maize genomic DNA extraction, resequencing, library preparation, and sequencing This embodiment focuses on the 465 maize inbred lines from Example 1. High-quality genomic DNA was extracted using the optimized CTAB method, and whole-genome resequencing libraries were constructed and high-throughput sequencing was performed to provide data support for subsequent variant detection and association analysis. The specific steps are as follows: (1) Take 1.0g of fresh, healthy corn leaves at the three-leaf stage, cut them into pieces, put them into a pre-cooled sterile mortar, add liquid nitrogen and grind quickly until they are uniform powder. Add 3mL of 1.5×CTAB extraction solution preheated to 65℃ to the mortar and continue grinding until homogenized. Transfer the homogenate to a 15mL sterile centrifuge tube. Rinse the inner wall of the mortar with 1mL of 1.5×CTAB extraction solution and transfer the rinsing solution to the same centrifuge tube. Gently invert the centrifuge tube to mix thoroughly.
[0027] The 1.5×CTAB formulation is as follows (1L): CTAB 15g 1 mol / L Tris.Cl (EH 8.0) 75mL 0.5 mol / L EDTA 30mL NaCl 61.4g (2) Place the centrifuge tube in a 65°C water bath for 30 minutes. During this period, gently invert the centrifuge tube once every 10 minutes to ensure that the sample and the extraction solution are in full contact and to ensure that the genomic DNA is fully released.
[0028] (3) Remove the centrifuge tube and cool it to room temperature. Add an equal volume of chloroform / isoamyl alcohol mixture to the tube, where the volume ratio of chloroform to isoamyl alcohol is 24:1. Gently invert the centrifuge tube and mix for 10 minutes until the lower organic phase turns into a stable dark green color and there is no obvious protein precipitation at the interface between the two phases.
[0029] (4) Place the centrifuge tube in the centrifuge and centrifuge at 4200 rpm for 10 min. Carefully aspirate the upper aqueous phase and transfer it to a new 15 mL sterile centrifuge tube. Avoid touching the middle protein layer and the lower organic phase during the aspiration process to prevent DNA contamination.
[0030] (5) Add 2 volumes of pre-cooled anhydrous ethanol to the aqueous phase, gently invert and mix, let stand at room temperature for 5 minutes, and then place in a -20℃ refrigerator for 30 minutes to allow the genomic DNA to precipitate fully.
[0031] (6) Centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to the centrifuge tube, gently invert and wash the DNA precipitate once, centrifuge at 4200 rpm for 5 min and discard the supernatant, repeat the washing step once to completely remove residual salt ions and organic solvents.
[0032] (7) Invert the centrifuge tube onto sterile absorbent paper and allow the DNA precipitate to dry naturally at room temperature until there is no ethanol residue in the centrifuge tube. Add 50 μL of LTE buffer (pH 8.0) to the centrifuge tube to dissolve the DNA precipitate and place it in a 4°C refrigerator overnight to fully dissolve.
[0033] The formula for 1.5×CTAB extract (1L) is as follows: CTAB 15g, 1mol / L[Tris.Cl] (Tris.Cl) (pH 8.0) 75mL, 0.5mol / L EDTA 30mL, NaCl 61.4g, add deionized water to make up to 1L, and add mercaptoethanol to a final concentration of 0.2% before use.
[0034] DNA integrity was assessed using 1% agarose gel electrophoresis to ensure a clear main DNA band, no significant degradation, and no RNA contamination. DNA purity and concentration were determined using a micro-spectrophotometer. DNA samples were required to meet the following criteria: an OD260 / OD280 ratio between 1.8 and 2.0, and an OD260 / OD230 ratio not less than 1.5, satisfying the library preparation requirements for high-throughput sequencing. All DNA samples were homogenized to a concentration of 20 ng / μL using enzyme-free sterile water and stored at -20°C for later use.
[0035] A simplified AIO-seq method was used to construct a genome resequencing library. The specific steps are as follows: (1) Tn5 transposase was used to fragment 465 maize genomic DNA samples. At the same time, adapter sequences were ligated to both ends of the DNA fragments. After the fragmentation products were purified, PCR amplification was performed. During the amplification process, specific MGI® sequencing tag adapters were ligated to each sample to achieve multi-sample mixed sequencing.
[0036] (2) Mix the PCR amplification products of all samples in equal amounts, use the magnetic bead method to screen fragments by size, with a screening range of 300~500bp, and use the HieffNGS® Fast-Pace DNA Circulation Kit to circularize the screened mixed library to prepare a single-stranded circular DNA library.
[0037] (3) The circularized library was accurately quantified using the Qubit® ssDNA detection kit to ensure that the library concentration met the sequencing requirements; the qualified circularized library was sequenced in high throughput on the MGI® DNBSEQ-T1 sequencer with a sequencing strategy of 150bp paired-end sequencing, and each sample obtained about 5× coverage depth of whole genome resequencing data.
[0038] Example 3: Genome-wide association analysis and candidate gene screening for maize ear length This embodiment, based on the whole-genome resequencing data obtained in Example 2 and the multi-environment ear length phenotype data obtained in Example 1, conducts genome-wide association analysis to locate the major functional loci controlling the ear length trait in maize and screens candidate genes. The specific steps are as follows: All raw sequencing data were first assessed for quality using FastQC software to filter out low-quality reads, adapter contamination sequences, and reads containing more than 10% N, resulting in high-quality clean reads. The clean reads were then aligned to the maize reference genome B73v5 using BWA software, and the alignment results were sorted and deduplicated using SAMtools software. Finally, GATK software was used to detect SNPs and Indels across the entire genome to obtain the raw variant set.
[0039] The original variant set was subjected to rigorous quality control filtering. The filtering criteria were: minimum allele frequency > 0.05, missing data ratio < 20%, Hardy Weinberg balance test p-value > 1e-6. Finally, 6,945,041 high-quality genome-wide SNP markers were obtained for subsequent genome-wide association analysis.
[0040] To eliminate the false positive interference of population structure and kinship on the association analysis results, iqTree software was used to construct a phylogenetic tree based on high-quality SNP markers, Plink software was used for principal component analysis to analyze the population hierarchical structure, and Faststructure software was used for population structure analysis to clarify the number of subpopulations and genetic structure within the population. GEMMA software was used to calculate the kinship matrix between materials to quantify the genetic similarity between materials.
[0041] Genome-wide association analysis was performed using a mixed linear model in GEMMA software. The model incorporated genotype, phenotype, population structure matrix, and kinship matrix to effectively control for false positive associations caused by population stratification and kinship. The model formula is as follows: ; In the formula, y is the phenotypic value vector of ear length trait, X is the marker genotype matrix, α is the marker effect value, P is the population structure matrix, β is the population structure effect value, K is the kinship matrix, μ is the polygenic effect value, and e is the random error vector.
[0042] Independent genome-wide association analyses (GWAS) were performed on ear length phenotypic data and multi-environment BLUP values for the three environments. The Bonferroni correction method was used to determine the significance threshold for the association analyses, with P < 1.7286e⁻⁵ set. SNPs meeting the significance threshold were extracted from the GWAS results, converted to BED format files, and compared with gene annotation information from the maize reference genome B73v5 using the bedtoolsintersect tool. Candidate genes were then screened by comparing significant SNPs and their upstream and downstream 100kb regions with the gene annotation files.
[0043] Association analysis results showed that the GWAS results of the three environments and BLUP values all detected signal peaks significantly associated with ear length traits in the 184.04Mb-184.05Mb interval of chromosome 5 of maize. The significant SNP site in this interval is located inside the gene Zm00001eb246010 and contains an Indel site that causes coding sequence variation. Therefore, Zm00001eb246010 was identified as a candidate gene controlling ear length traits in maize.
[0044] All SNPs and Indel markers within the region of candidate gene Zm00001eb246010 were extracted. Regional association analysis of the candidate genes was performed using multi-environment ear length phenotypic data, along with linkage disequilibrium analysis, to construct an LDblock. The results showed that the Indel locus (polymorphism - / TGA) located at position 184049387 on maize chromosome 5 was within a strong LDblock and exhibited the highest significant association with ear length.
[0045] The linkage strength between this Indel locus and the major QTL for ear length was calculated using the linkage disequilibrium coefficient formula. The calculated value, D' = 0.94, meets the close linkage criterion of D' ≥ 0.9, indicating a very strong linkage between this Indel locus and the major QTL for ear length in maize. The genetic effect of this locus was also calculated, yielding an additive effect value a = 0.92 cm, a dominant effect value d = 0.31 cm, and a dominance ratio d / a = 0.34. This indicates that the locus exhibits a predominantly additive effect, is stably inherited, and is suitable for marker-assisted selection.
[0046] The genetic contribution of this locus to ear length trait was calculated using the phenotypic variation explanation rate formula. After correcting for interference from population structure and kinship, the phenotypic variation explanation rate (PVE) of this Indel locus for ear length trait was 12.3%, which is much higher than the threshold requirement of 10%. This indicates that this locus is the major functional locus controlling ear length trait in maize and has significant breeding application value for developing molecular markers.
[0047] Example 4: Development, Validation, and Breeding Application of the KASP Marker for Maize Ear Length This embodiment is based on the Indel functional site at position 184049387 of maize chromosome 5, which was screened in Example 3. A specific KASP molecular marker, EL-5-KASP-387, was developed, and the marker's genotyping verification and breeding application system were established. The specific steps are as follows: Conserved genomic sequences of 100 bp upstream and downstream of the Indel locus at position 184049387 on chromosome 5 of maize were extracted. A KASP-specific primer set was designed targeting the - / TGA polymorphism at this locus. The primer set consists of two forward-specific primers and one universal reverse primer. Forward primer 1 has a 3' end matching a TGA insertion allele and a 5' end linked to a FAM fluorescent tag sequence; forward primer 2 has a 3' end matching a deletion allele and a 5' end linked to a HEX fluorescent tag sequence. The reverse primer is a universal primer located in the conserved sequence region downstream of the Indel locus.
[0048] The final primer sequence for the KASP marker EL-5-KASP-387 is as follows: Gene Primer name Primer sequence EL-5-KASP-387F1EL-5-KASP-387F2EL-5-KASP-387R GAAGGTGACCAAGTTCATGCTAAACGTCGAAGGACCATCAAGAAGGTCGGAGTCAACGGATTAAACGTCGAAGGACCATCATTCTTGTGCCATCTCACATGCT EL-5-KASP-387F1EL-5-KASP-387F2EL-5-KASP-387R The primer mix was prepared by mixing forward primer 1, forward primer 2, and reverse primer in a volume ratio of 2:2:5. The specific preparation system was: 6 μL of 10 μmol / L forward primer 1, 6 μL of 10 μmol / L forward primer 2, 15 μL of 10 μmol / L reverse primer, and 23 μL of ddH2O. After thorough vortexing and brief centrifugation, a 50 μL primer mix working solution was prepared and stored in a 4℃ refrigerator for short-term use.
[0049] Using genomic DNA from 465 maize inbred lines extracted in Example 2 as templates, PCR amplification was performed using the primer set described above. A template-free blank control was also included. The PCR amplification reaction was carried out in a 96-well PCR plate, with a reaction volume of 10 μL, as detailed below: 2 μL of 50-100 ng / μL maize genomic DNA, 0.14 μL of primer mix, 5 μL of 2xProbeMixA solution, and 2.86 μL of enzyme-free, sterile ddH2O.
[0050] The 2xProbeMixA solution contains hot-start Taq enzyme, dNTPs, MgCl2, FAM fluorescently labeled probe, HEX fluorescently labeled probe, and PCR buffer, and is a premixed reagent specifically for KASP typing.
[0051] The PCR amplification reaction program is set as follows: Phase 1: Pre-denaturation at 95℃ for 10 min to activate hot-start Taq enzyme and completely unwind genomic DNA; Phase 2: Touchdown PCR, denaturation at 95℃ for 20 s, annealing at 61℃ for 40 s, for a total of 10 cycles, with the annealing temperature decreasing by 0.5℃ per cycle until the annealing temperature reaches 56℃; Phase 3: Conventional PCR amplification, denaturation at 95℃ for 20 s, annealing at 55℃ for 40 s, for a total of 31 cycles; Phase 4: Hold at 25℃ for 10 min to terminate the PCR reaction and stabilize the amplification products; After the reaction, the amplification products are stored at 4℃ for no more than 72 hours and immediately subjected to subsequent fluorescence signal detection.
[0052] After the PCR amplification reaction, the 96-well PCR plate was placed in an ABI 7500 qPCR instrument and incubated at 35°C for 30 seconds. Fluorescence signal readings were performed, and the fluorescence signal values of the FAM channel, HEX channel, and ROX reference channel were recorded. The raw fluorescence signal data were exported, and background correction was applied to the fluorescence signal of each sample well using the fluorescence signal-to-noise ratio correction formula. The S0.05 value for each sample was calculated. FAM and S HEX The signal-to-noise ratio (SNR) is adjusted to eliminate interference from background fluorescence and reference dye signal fluctuations on the genotyping results. Clustering is performed based on the corrected SNR, and the genotype determination rule is: S... HEX / S FAM ≥10, the sample showed only a strong HEX fluorescence signal, and was determined to be a TGA:TGA homozygous type; S FAM / S HEX ≥10, the sample only showed a strong FAM fluorescence signal, and was determined to be homozygous; 0.1 < S HEX / S FAM <10, the sample was detected with both FAM and HEX fluorescence signals, and was determined to be TGA:-heterozygous; Samples with no effective fluorescence signal or a signal-to-noise ratio below the threshold are considered undetectable and require DNA extraction for re-testing.
[0053]
[0054]
[0055]
[0056]
[0057]
[0058]
[0059]
[0060]
[0061]
[0062] The typing results showed that the KASP marker EL-5-KASP-387 developed in this invention could clearly identify the three genotypes in 465 maize inbred lines without obvious ambiguity. Among them, 76 were TGA:TGA homozygous, 12 were TGA:- heterozygous, 337 were -:- homozygous, and 40 were undetectable, with a typing success rate of 91.4%. The blank control showed no fluorescence signal, primer dimers, or non-specific amplification, indicating that the primer set of this marker has high specificity and typing accuracy, enabling high-throughput and automated detection of maize ear length-related genotypes.
[0063] The KASP genotyping results were correlated with the spike length phenotype data of the three environments in Example 1. The multi-environment weighted genotype-phenotype matching degree formula was used, with the broad heritability of spike length in each environment as the weight, to calculate the multi-environment weighted matching degree (WMC).
[0064] Phenotypic effect analysis showed that the mean spike length of the TGA:TGA homozygous material in the three environments was 16.61 cm, 17.63 cm, and 18.04 cm, respectively; the mean spike length of the TGA:- heterozygous material in the three environments was 16.69 cm, 17.55 cm, and 17.98 cm, respectively; and the mean spike length of the -:- homozygous material in the three environments was 15.26 cm, 15.18 cm, and 16.16 cm, respectively. The mean spike length of the TGA:TGA homozygous and -:- homozygous materials differed by 1.35 cm, 2.06 cm, and 1.88 cm in the three environments, respectively, and all differences were highly significant (P < 0.01). The spike length of the TGA:- heterozygous material was significantly higher than that of the -:- homozygous material, but there was no significant difference between the TGA:TGA homozygous material and the TGA:TGA homozygous material.
[0065] Based on the above results, the identification rule for the ear length trait was determined as follows: when the genotype is TGA:TGA or TGA:-, it corresponds to the long ear length trait; when the genotype is -:-, it corresponds to the short ear length trait. The matching degree between genotype and phenotype was verified according to this rule, and the multi-environment weighted matching degree (WMC) was calculated to be 99.2%, meeting the threshold requirement of not less than 99%. This indicates that the identification results of the KASP marker EL-5-KASP-387 developed in this invention for the ear length trait of maize are highly consistent with the actual phenotype in the field, and can accurately and stably identify the ear length trait of maize.
[0066] Based on the KASP marker EL-5-KASP-387 developed in this invention, a molecular marker-assisted breeding method for long-eared maize is established, and the specific steps are as follows: (1) Parental selection: Long-eared maize inbred lines identified by KASP marker as TGA:TGA homozygous were selected as donor parents, and maize inbred lines with excellent comprehensive traits, high combining ability but short ear length were selected as recipient parents. Artificial hybridization was carried out to obtain F1 generation hybrid seeds.
[0067] (2) F1 generation identification: F1 generation seeds are planted, and fresh leaves are taken at the three-leaf stage of maize to extract genomic DNA. The KASP marker of the present invention is used for genotyping. F1 generation single plants with TGA:- heterozygous type are screened and retained, and false hybrids with inconsistent genotypes are eliminated, which greatly reduces the scale of subsequent field planting.
[0068] (3) Backcrossing and breeding: Using the F1 generation heterozygous single plants obtained by screening as the female parent and the recipient parent as the recurrent male parent, backcrossing is carried out to obtain BC1F1 generation seeds; BC1F1 generation seeds are planted, and KASP marker genotyping is carried out during the seedling stage. TGA:- heterozygous single plants carrying TGA alleles are retained and backcrossed with the recurrent parent. After 3 to 5 generations of continuous backcrossing, backcross offspring with high genetic background recovery are obtained.
[0069] (4) Self-pollination purification: The heterozygous single plants of the final backcross generation were self-pollinated to obtain BCnF2 generation seeds. After planting, KASP marker genotyping was performed during the seedling stage to screen for TGA:TGA homozygous single plants. Combined with field agronomic trait identification and combining ability determination, long-eared maize inbred lines with significantly improved ear length and stable inheritance of comprehensive traits were cultivated.
[0070] Using the above-mentioned molecular marker-assisted breeding method, the target genotype can be accurately screened during the seedling stage of maize, without waiting for the maturity stage to conduct ear length phenotypic surveys. This significantly reduces the scale of field planting and the workload of selection, shortens the breeding cycle of long-eared maize inbred lines from 68 years in traditional breeding to 34 years, and significantly improves the efficiency of targeted improvement of maize long-eared traits, providing an efficient technical means for the breeding of high-yield maize varieties.
[0071] Figure 1 This is a distribution map of the ear length trait. a, b, and c represent the ear length phenotypic data of Acheng, Harbin in 2025, Wangkui, Harbin in 2025, and Zhaodong, Harbin in 2025, respectively. The horizontal axis represents ear length, and the vertical axis represents the number of samples.
[0072] Figure 2A chromosome distribution map of SNP markers was created. After quality assessment of the raw PE (Pair-end) sequencing data using FastQC, BWA was used for quality control. Sequencing reads were aligned to a reference genome (B73v5), and SNP detection was performed using GATK. Following quality control filtering at both the sample and variant levels, 6,945,041 high-quality SNP markers (minimum allele frequency >0.05, missing data <20%) were identified. The SNP chromosome distribution was relatively uniform, ensuring the accuracy and reliability of the analysis results.
[0073] Figure 3 Manhattan plot and QQ plot for genome-wide association analysis of maize ear length, among which Figure 3 Images a through b are Manhattan and QQ images of Acheng Suichang in 2025; Figure 3 .c~d are the Manhattan and QQ maps of Wangkui's harvest in 2025; Figure 3 .e~f represent the Manhattan and QQ maps of Zhaodong and Guangzhou in 2025. Figure 3 .g~h represents the Manhattan plot and QQ plot of the spike length BLUP value in 2025.
[0074] Figure 4 To conduct regional association analysis and LD heatmap of candidate gene Zm00001eb246010, SNPs and Indel markers within the Zm00001eb246010 region were extracted. Combined with phenotype, association analysis was performed. The markers between 184048567 and 184049828 formed a block containing the Indel site at 184049387.
[0075] Figure 5 Phenotypic differences in ear length among haplotypes were analyzed. AC: Acheng; WK: Wangkui; ZD: Zhaodong. By combining phenotypic data from the three locations, the phenotypic differences in ear length among different haplotypes were analyzed. It was found that the ear length of HAP3 was significantly higher than that of HAP1 and HAP2, and the differences among the three locations were very significant.
[0076] Figure 6This analysis focuses on the phenotypic effect of ear length at the Indel locus at resequencing data. The results are as follows: aa-AC: ear length of samples with the TGA:TGA genotype at the Indel locus at 184049387 in Acheng; Aa-AC: ear length of samples with the TGA:- genotype at the Indel locus at 184049387 in Acheng; AA-AC: ear length of samples with the -:- genotype at the Indel locus at 184049387 in Acheng; aa-WK: ear length of samples with the TGA:TGA genotype at the Indel locus at 184049387 in Wangkui. The ear length of the sample with genotype TGA:- at the Indel locus at a-WK:184049387 in Wangkui; the ear length of the sample with genotype -:- at the Indel locus at AA-WK:184049387 in Wangkui; the ear length of the sample with genotype TGA:TGA at the Indel locus at aa-ZD:184049387 in Zhaodong; the ear length of the sample with genotype TGA:- at the Indel locus at Aa-ZD:184049387 in Zhaodong; the ear length of the sample with genotype -:- at the Indel locus at AA-ZD:184049387 in Zhaodong. In Acheng, 307 samples were -:-, and 74 samples were TGA:TGA, with a mean ear length difference of 1.33 cm, which was extremely significant; in Wangkui, 313 samples were -:-, and 74 samples were TGA:TGA, with a mean ear length difference of 2.16 cm, which was extremely significant; in Zhaodong, 312 samples were -:-, and 74 samples were TGA:TGA, with a mean ear length difference of 1.88 cm, which was extremely significant. Figure 7 The results of KASP molecular marker genotyping for maize ear length are shown. Orange-red represents TGA:TGA; green represents TGA:-; blue represents -:-; gray represents NTC control; purple-red represents signal but unknown genotype; and pink represents no signal. KASP primers were designed based on the SNP at Chr5:184049387 in maize, and KASP molecular marker genotyping was performed on 465 maize accessions. The results showed that KASP markers can distinguish three genotypes at Chr5:184049387.
[0077] Figure 8Correlation analysis between KASP marker genotype and ear length phenotype; Note: AC-aa: Ear length of samples with KASP marker genotype TGA:TGA in Acheng; AC-Aa: Ear length of samples with KASP marker genotype TGA:- in Acheng; AC-AA: Ear length of samples with KASP marker genotype -:- in Acheng; WK-aa: Ear length of samples with KASP marker genotype TGA:TGA in Wangkui; WK-Aa: Ear length of samples with KASP marker genotype TGA:- in Wangkui; WK-AA: Ear length of samples with KASP marker genotype -:- in Wangkui; ZD-aa: KASP marker genotype The ear lengths of samples with the TGA:TGA genotype in Zhaodong; the ear lengths of samples with the ZD-Aa:KASP marker genotype TGA:- in Zhaodong; the ear lengths of samples with the ZD-AA:KASP marker genotype -:- in Zhaodong; in Acheng, 331 samples were -:- and 76 samples were TGA:TGA, with a mean ear length difference of 1.35 cm, which was highly significant; in Wangkui, 338 samples were -:- and 75 samples were TGA:TGA, with a mean ear length difference of 2.06 cm, which was highly significant; in Zhaodong, 337 samples were -:- and 76 samples were TGA:TGA, with a mean ear length difference of 1.8 cm, which was highly significant. The KASP marker EL-5-KASP-387, designed based on the Indel at chromosome 5 (184049387) of maize, can distinguish three genotypes. When the base is TGA:TGA or TGA:-, the maize ear length trait is long ear length; when the base is -:-, the maize ear length trait is short ear length. The phenotypic data of the three genotypes are all extremely significant.
[0078] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely preferred examples and are not intended to limit the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of the present invention is defined by the appended claims and their equivalents.
Claims
1. A Kasp marker EL-5-KASP-387 closely linked to maize ear length, characterized in that, This includes a specific Indel site and the corresponding KASP molecular marker primer set; the Indel site is located at position 184049387 on chromosome 5 of maize, and the polymorphism is - / TGA; The KASP is labeled EL-5-KASP-387, and the corresponding primer set includes forward primer 1, forward primer 2, and reverse primer; The sequence of forward primer 1 is GAAGGTGACCAAGTTCATGCTAAACGTCGAAGGACCATCAA; the sequence of forward primer 2 is GAAGGTCGGAGTCAACGGATTAAACGTCGAAGGACCATCAT; and the sequence of reverse primer is TCTTGTGCCATCTCACATGCT. The degree of linkage between the KASP marker and the major QTL for ear length in maize was calculated using the following formula, and the genetic effect of the ear length trait corresponding to the marker was quantified using the following formula: ; ; ; ; ; ; In the above formula, D' is the linkage disequilibrium coefficient between the marker and the major QTL for spike length, and D is the linkage disequilibrium degree between loci. This represents the frequency of the TGA allele in a natural population. This represents the frequency of the long spike phenotype in natural populations. The haplotype frequency of TGA alleles coexisting with the long spike phenotype. This represents the theoretical maximum value of the chain imbalance. The value ranges from 0 to 1. When the value is ≥0.9, it indicates a close linkage between the marker and the ear length trait; 'a' is the additive effect value of the ear length trait, and 'd' is the dominant effect value of the ear length trait. For dominance, The mean spike length phenotype of the TGA:TGA homozygous genotype population. The mean spike length phenotype of the -:- homozygous genotype population. The mean spike length phenotype of the TGA:- heterozygous population was used to determine the gene action mode of the dominant locus, providing a quantitative basis for the genetic effect of molecular marker-assisted selection.
2. The Kasp marker EL-5-KASP-387, which is closely linked to the length of the maize ear, as described in claim 1, is characterized in that... The concentrations of forward primer 1 and forward primer 2 are independently 4 to 10 μmol / L, and the concentration of the reverse primer is 4 to 10 μmol / L. The concentration range is suitable for PCR reaction systems of different sizes, such as 10 μL, 20 μL, and 50 μL. When the reaction system is expanded or reduced by a factor of 1, the primer concentration is adjusted proportionally to ensure that the molar ratio of primer to template DNA is maintained between 1:5 and 1:
10.
3. The Kasp marker EL-5-KASP-387, which is closely linked to the length of the maize ear, as described in claim 1, is characterized in that... The volume ratio of forward primer 1, forward primer 2, and reverse primer in the primer set is 2:2:
5. This volume ratio is determined based on the difference in primer Tm values and optimization of binding efficiency. The Tm values of forward primer 1 and forward primer 2 are both 60℃ to 62℃, and the Tm value of the reverse primer is 58℃ to 60℃. This volume ratio can ensure the balance of competitive binding of the three primers in the PCR reaction. When preparing the primer mix, take 6μL of forward primer 1, 6μL of forward primer 2, and 15μL of reverse primer according to the above volume ratio, add 23μL of ddH2O and mix well to form a 50μL primer mix for later use.
4. The Kasp marker EL-5-KASP-387, which is closely linked to the length of the maize ear, as described in claim 1, is characterized in that... The genetic contribution of the KASP marker to the spike length trait was verified by the phenotypic variation explanation rate formula after correction by a multi-environment mixed linear model, as follows: ; ; In the above formula, PVE is the marker-explained phenotypic variation rate of the ear length trait, Vp is the total phenotypic variance of the ear length trait, Vg is the genetic variance corresponding to the marker, Vs is the variance component caused by population structure, Vk is the variance component caused by inter-material kinship, Ve is the environmental error variance, and Vg+e is the sum of residual variances not including marker effects. This formula corrects for the interference of population structure and kinship on phenotypic variation, accurately quantifies the true genetic contribution of markers to the ear length trait, and the PVE is not less than 10%.
5. The Kasp marker EL-5-KASP-387, which is closely linked to the length of the maize ear, as described in claim 1, is characterized in that... The forward primer 1 and forward primer 2 have a single base difference at the 3' end, which specifically matches the two allelic variations of the Indel site. The GC content of the 15 consecutive bases from the 3' end to the 5' end of the primer is 40% to 60%, and there are no primer dimers or hairpin structures, which ensures the specificity of PCR amplification and the accuracy of genotyping.
6. A method for screening long-eared maize using the Kasp marker EL-5-KASP-387 as described in any one of claims 1 to 5, characterized in that, Includes the following steps: Step 1: Extract genomic DNA from maize samples; Step 2: Using the genomic DNA as a template, perform PCR amplification using the primer set to obtain the amplification product; Step 3: Perform KASP genotyping on the amplified products, calculate the corrected fluorescence signal-to-noise ratio using the following formula, and perform clustering based on the signal-to-noise ratio to determine the genotype; Step 4: Identify the ear length trait of maize based on genotype and screen for maize with the target long ear length; The fluorescence signal-to-noise ratio correction formula is as follows: ; ; The multi-environment weighted genotype-phenotype matching verification formula is as follows: ; ; In the above formula, This represents the signal-to-noise ratio after FAM channel correction. for Signal-to-noise ratio after channel correction. , This represents the measured fluorescence value of the corresponding channel in the sample well. , This represents the average background fluorescence value of the corresponding channel in the blank control well. The measured fluorescence value of the reference dye ROX in the sample well. The mean background fluorescence value of ROX in the blank control wells; the genotype determination rule is as follows: / When the value is ≥10, it is determined to be a TGA:TGA homozygous type. / A value ≥10 indicates a homozygous type, and 0.1 < / <10 indicates a TGA:- heterozygous type; the ear length trait identification rule is that TGA:TGA homozygous and TGA:- heterozygous types correspond to long ear length traits, while -:- homozygous types correspond to short ear length traits; WMC is the multi-environment weighted matching degree, and m is the total number of experimental environments. Let be the weight coefficient for the j-th environment. Let be the number of samples in the j-th environment whose genotype and phenotype match. Let J be the total number of samples detected in the j-th environment. For the broadly heritable power of the spike length trait in the j-th environment, the WMC is not less than 99%.
7. The application method of screening long-eared maize using the Kasp marker EL-5-KASP-387 according to claim 6, characterized in that, The PCR amplification reaction system in step 2, in 10 μL increments, includes 2 μL of maize genomic DNA, 0.14 μL of primer set, 5 μL of 2xProbeMixA solution, and the remainder ddH2O. The concentration of the maize genomic DNA is 50 to 100 ng / μL, and the DNA purity must meet the requirements of an OD260 / OD280 ratio between 1.8 and 2.0, and an OD260 / OD230 ratio not less than 1.
5. The 2xProbeMixA solution contains hot-start Taq enzyme, dNTPs, and Mg2+. 2+ FAM fluorescently labeled probe, HEX fluorescently labeled probe and PCR buffer, wherein Mg 2+ The concentration of the active ingredient was 2.0 to 2.5 mmol / L, and the concentration of dNTPs was 0.2 to 0.3 mmol / L; the balance ddH2O was enzyme-free sterile water, which was filtered through a 0.22 μm filter membrane to avoid nuclease contamination.
8. The application method of screening long-eared maize using the Kasp marker EL-5-KASP-387 according to claim 6, characterized in that, The PCR amplification reaction procedure described in step 2 is as follows: The first stage involves pre-denaturation at 95℃ for 10 min, used to activate the hot-start Taq enzyme and completely unwind the maize genomic DNA; the second stage involves denaturation at 95℃ for 20 s followed by annealing at 61℃ for 40 s, for a total of 10 cycles, with the annealing temperature gradually decreasing to 56℃ in 0.5℃ increments per cycle; the third stage involves denaturation at 95℃ for 20 s followed by annealing at 55℃ for 40 s, for a total of 31 cycles, with the annealing temperature matching the Tm range of the primer set to ensure specific primer binding; the fourth stage involves holding at 25℃ for 10 min to terminate the reaction and stabilize the product; after the reaction, the amplified product can be stored at 4℃ for a short period, not exceeding 72 hours.
9. The application method of screening long-eared maize using the Kasp marker EL-5-KASP-387 according to claim 6, characterized in that, The genomic DNA extraction in step 1 was performed using the CTAB method. The specific steps were as follows: 1.0 g of fresh corn leaves were weighed, chopped, and ground into powder using liquid nitrogen. Then, 3 mL of 1.5×CTAB was added and the mixture was ground into a homogenate. The homogenate was transferred to a 15 mL centrifuge tube, and the mortar was rinsed with 1 mL of 1.5×CTAB and transferred to the same centrifuge tube. The mixture was incubated in a 65°C water bath for 30 minutes, with occasional gentle shaking. After cooling to room temperature, an equal volume of chloroform-isoamyl alcohol mixture was added. The volume ratio of chloroform to isoamyl alcohol in the chloroform-isoamyl alcohol mixture was 24:
1. The mixture was then gently inverted. Mix the centrifuge tube until the lower layer turns dark green; centrifuge at 4200 rpm for 10 min, transfer the upper aqueous phase to a new 15 mL centrifuge tube, add 2 volumes of pre-cooled anhydrous ethanol, mix gently and let stand for 5 min, then place in a -20℃ freezer for 30 min to precipitate DNA; centrifuge at 4200 rpm for 10 min, discard the supernatant, add 1 mL of 75% ethanol to wash the precipitate once, invert the centrifuge tube to air dry the DNA at room temperature, add 50 μL of TE buffer to dissolve the DNA, the pH of the TE buffer is 8.
0.
10. The application method of screening long-eared maize using the Kasp marker EL-5-KASP-387 according to claim 6, characterized in that, After screening and obtaining the target long-eared maize in step 4, the following breeding steps are also included: select the TGA:TGA homozygous long-eared maize obtained from the screening as the parent, perform artificial pollination according to conventional hybridization techniques, obtain F1 generation seeds and plant them. Genomic DNA was extracted from leaves during the F1 generation seedling stage. Steps 1 to 4 were repeated for detection and screening, and individuals with the TGA:- heterozygous genotype were retained. The F1 generation heterozygous individuals were used as female parents and backcrossed with the target long spike and long parent to obtain BC1F1 generation seeds. Genotyping was performed on BC1F1 generation seeds after planting. Individuals carrying the TGA allele were retained. After 3 to 5 generations of backcrossing and self-pollination purification, a stable genetic long-eared maize inbred line was bred. The maize samples include one or more of maize inbred lines, maize hybrids, and maize DH lines. Maize inbred line samples are suitable for screening homozygous genotypes and purifying breeding materials; maize hybrid samples are suitable for predicting F1 ear length and detecting seed purity; and maize DH line samples are suitable for verifying genetic stability and analyzing marker effects. The samples are taken from fresh leaves from the seedling stage to maturity, with a sample size of not less than 0.5g. After sampling, the samples should be frozen at -80℃ or DNA extracted immediately to avoid nucleic acid degradation. The applications cover maize samples from different planting seasons, such as spring sowing, summer sowing, and autumn sowing.