Application of peptides, conjugates, reagents and kits in the detection of glial fibrillary acidic protein

By designing peptides c1b-5 and c2b-7 that specifically bind to GFAP and combining them with chemiluminescence technology and enzyme-linked immunosorbent assay technology, the problem of poor antibody stability in existing GFAP detection methods was solved, and highly sensitive and stable GFAP quantitative detection was achieved, which is suitable for the diagnosis of brain injury-related diseases.

CN120329392BActive Publication Date: 2025-09-16BOPU (CHANGCHUN) BIOTECHNOLOGY CO LTD
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510823440.5
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-06-19
Publication Date
2025-09-16
Estimated Expiration
2045-06-19

AI Technical Summary

Technical Problem

Existing GFAP detection methods have problems such as large antibody batch differences, poor stability, and difficulty in storage and transportation, resulting in low detection sensitivity.

Method used

A peptide that specifically binds to the coiled-coil region of GFAP was designed. By optimizing the combination of the peptide and the coupling medium, chemiluminescence technology and enzyme-linked immunosorbent assay were used for quantitative detection of GFAP. The combination of peptides c1b-5 and c2b-7 was used as a probe, combined with the G-quadruplex structure to achieve high-sensitivity detection of GFAP.

Benefits of technology

It achieves high-sensitivity quantitative detection of GFAP, reduces the detection background value, and improves the accuracy and stability of detection, making it suitable for the clinical diagnosis of brain injury-related diseases.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120329392B_ABST
    Figure CN120329392B_ABST
Patent Text Reader

Abstract

The present invention relates to the field of biomedicine, and in particular to the use of polypeptides, conjugates, reagents, and kits for detecting glial fibrillary acidic protein. The present invention provides polypeptides C1b-5 and C2b-7 that specifically bind to the coiled-coil region of glial fibrillary acidic protein. These polypeptides not only specifically bind to GFAP protein, but also exhibit weak nonspecific interactions between the two polypeptides, resulting in a low detection background. Using these two polypeptides as probes, combined with chemiluminescence and enzyme-linked immunosorbent assays, quantitative detection of GFAP protein levels in blood or cerebrospinal fluid can be performed. This provides assistance for the clinical diagnosis of brain injury-related diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedicine technology, and in particular to the application of polypeptides, conjugates, reagents and kits in detecting glial fibrillary acidic protein. Background Art

[0002] Glial fibrillary acidic protein (GFAP) is an intermediate filament protein primarily found in astrocytes. It plays a key role in maintaining central nervous system homeostasis, injury repair, and neuroinflammatory responses. Abnormal changes in GFAP levels are associated with a variety of neurological diseases, including Alzheimer's disease (AD), traumatic brain injury (TBI), gliomas, and neurodegenerative disorders. Therefore, quantitative detection of GFAP is of great significance in clinical diagnosis, disease monitoring, and scientific research.

[0003] Current methods for detecting GFAP content include enzyme-linked immunosorbent assay (ELISA), chemiluminescent immunoassay (CLI), lateral flow immunoassay (LFIA), and mass spectrometry. ELISA is characterized by its ease of operation and low cost. The chemiluminescent immunoassay (CLIA) is similar in principle to ELISA in that it uses magnetic beads coupled to specific antibodies, and paired antibodies coupled to chemiluminescent molecules to form a magnetic bead-antibody-antigen-antibody-luminescent molecule composite structure. The chemiluminescent light signal reports the molecules to be tested in the sample, thus having higher sensitivity. Lateral flow immunoassay is easy to operate and can quickly obtain results, but its disadvantage is that it is not as sensitive as the first two methods. All of the above methods are based on antigen-antibody specific binding to achieve detection, and have problems such as large differences between antibody batches, difficulty in storage and transportation, and poor stability.

[0004] Therefore, it is particularly necessary to develop new methods to detect GFAP content. Summary of the Invention

[0005] In view of this, the technical problem to be solved by the present invention is to provide the use of polypeptides, conjugates, reagents and kits in detecting glial fibrillary acidic protein.

[0006] The present invention provides a polypeptide that specifically binds to a coiled-coil segment of glial fibrillary acidic protein; the coiled-coil segment of glial fibrillary acidic protein has an amino acid sequence as shown in SEQ ID NO: 1 and / or SEQ ID NO: 2.

[0007] Furthermore, in the present invention, the polypeptide has the following amino acid sequence:

[0008] (Z1-Z2-Z3-Z4-Z5-Z6-Z7)n;

[0009] Wherein, n=5~7, and in a specific embodiment of the present invention, n is 6;

[0010] Z1 is selected from L, I or V;

[0011] Z2 is selected from N, E, A, R, T, Q, S, K, H or D;

[0012] Z3 is selected from Q, R, N, S, H, D, S, T or E;

[0013] Z4 is selected from M, L or A;

[0014] Z5 is selected from D, E, T, K, R or Q;

[0015] Z6 is selected from T, H, E, N, S, R, Q, C, G, D or K;

[0016] Z7 is selected from D, E, S, K, R, or H.

[0017] Furthermore, the polypeptide comprises at least one of the amino acid sequences shown as SEQ ID NO: 4 (c1b-2), SEQ ID NO: 6 (c1b-4), SEQ ID NO: 7 (c1b-5), SEQ ID NO: 14 (c2b-4) and / or SEQ ID NO: 17 (c2b-7).

[0018] The present invention targets the coiled-coil region of glial fibrillary acidic protein with amino acid sequences shown in SEQ ID NO: 1 and SEQ ID NO: 2, and designs polypeptides that specifically bind to the region. Through length and sequence optimization, polypeptides c1b-2, c1b-4, c1b-5, c2b-4, and c2b-7 with high affinity for GFAP were further screened from 16 polypeptides. Subsequently, the above polypeptides were combined in pairs to form six pairs of combinations to investigate whether there was competitive inhibition between the polypeptides in an ELISA assay for GFAP. Experimental results showed that the polypeptide combination of c1b-5 and c2b-7 had no significant competitive inhibition and had a strong affinity for GFAP.

[0019] Compared with the polypeptide of the present invention and the GFAP antibody, there are relatively few antibodies that are effective in detecting GFAP, and the detection effect of the antibodies is not as good as that of the polypeptide of the present invention.

[0020] The present invention provides a conjugate comprising the polypeptide of the present invention and a coupling medium.

[0021] In the present invention, the coupling medium can be directly coupled with the polypeptide of the present invention, or can be coupled with the polypeptide of the present invention via an intermediate mediator, which is not limited in the present invention.

[0022] Furthermore, the coupling medium includes at least one of nucleic acid fragments, magnetic beads, biotin, acridinium ester, streptavidin, horseradish peroxidase, alkaline phosphatase and / or hemin;

[0023] The nucleic acid fragment includes a flexible fragment composed of T bases and a G-rich fragment. The G-rich fragment is a part of a sequence that can form a G quadruplex.

[0024] Specifically, the nucleic acid fragment has a nucleotide sequence as shown in SEQ ID NO: 19 and / or SEQ ID NO: 20.

[0025] Furthermore, the 5' end of the nucleic acid fragment is modified with an amino group and / or a dibenzocyclooctyne group;

[0026] In the present invention, the coupling medium and the polypeptide can be separated or coupled, and the present invention is not limited to this. In the present invention, due to different experimental methods or purposes, a suitable coupling medium can be selected to couple with the polypeptide of the present invention to achieve GFAP detection.

[0027] In some specific embodiments of the present invention, in the screening of 16 polypeptides, each polypeptide is modified with biotin, and then incubated with streptavidin-labeled HRP and developed with TMB, and the polypeptide with higher affinity to GFAP is screened by the signal value;

[0028] In other specific embodiments of the present invention, polypeptides c1b-2, c1b-4, c1b-5, c2b-4 and c2b-7 with high affinity for GFAP are divided into two groups; polypeptides c1b-2, c1b-4 and c1b-5 are group A; polypeptides c2b-4 and c2b-7 are group B; the polypeptides in group A are modified with biotin and then coated with streptavidin on a microplate; the polypeptides in group B are labeled with HRP, and the sandwich method is used to verify whether there is competitive inhibition between the two groups of polypeptides and GFAP, and whether there is non-specific interaction between the two probes.

[0029] In other specific embodiments of the present invention, polypeptide c1b-5 is modified with biotin and then immobilized on a streptavidin-modified magnetic sphere. C2b-7 is coupled with acridinium ester (ME-DMAE-NHS). Peptide c1b-5, GFAP, and polypeptide c2b-7 form a complex that emits chemiluminescence under the excitation of alkaline hydrogen peroxide, thereby establishing a standard curve for detection.

[0030] In other specific embodiments of the present invention, polypeptide c1b-5 and nucleic acid sequence DNA-1 constitute probe 1, and polypeptide c2b-7 and nucleic acid sequence DNA-2 constitute probe 2; when GFAP binds to polypeptide c1b-5 and polypeptide c2b-7, the distance between the two nucleic acid chains DAN-1 and DNA-2 is shortened, causing the two nucleic acid chains to self-assemble into a complete G-quadruplex structure. The G-quadruplex binds to hemin and has HRP activity. The chemiluminescent substrate emits light under the catalytic action of HRP activity, and the light signal is collected to establish a standard curve for quantitative detection of GFAP.

[0031] In the present invention, DNA-1 and DNA-2 are also optimized; specifically, after screening and obtaining a G-quadruplex sequence - sequence 2 with high HRP activity, sequence 2 is further split, and from the optimal combination obtained through splitting and combination, the basic G-quadruplex segmentation sequences of DNA-1 and DNA-2, which have weak individual activity but strong activity when combined, are screened out, and then flexible nucleotides T are added to the basic G-quadruplex segmentation sequences to form DNA-1 and DNA-2 with nucleotide sequences shown in SEQ ID NO: 19 and / or SEQ ID NO: 20.

[0032] At the same time, the present invention optimizes the concentrations of probes 1 and 2 composed of DNA-1 and DNA-2 with the optimal G-quadruplex basic segmentation sequence, as well as hemin. Experimental results show that the optimal concentrations of probes 1 and 2 containing DNA-1 and DNA-2, as well as hemin, are 1 nM, 1 nM, and 10 nM, respectively.

[0033] The present invention provides a reagent for detecting glial fibrillary acidic protein, comprising:

[0034] At least one of a stabilizer, a preservative, a surfactant and / or a solubilizing agent and the polypeptide of the present invention; and / or

[0035] At least one of a stabilizer, a preservative, a surfactant and / or a solubilizing agent and the conjugate of the present invention.

[0036] The present invention provides a kit comprising:

[0037] At least one of a buffer, an activation reagent, a reaction termination solution and / or a chemiluminescent substrate and the polypeptide of the present invention; and / or

[0038] At least one of a buffer, an activation reagent, a reaction termination solution and / or a chemiluminescent substrate and the conjugate of the present invention; and / or

[0039] At least one of a buffer, an activation reagent, a reaction termination solution and / or a chemiluminescent substrate and the reagent of the present invention.

[0040] The present invention provides the use of at least one of the following I) to IV) in the detection of glial fibrillary acidic protein:

[0041] 1), the polypeptide of the present invention;

[0042] II), the conjugate of the present invention;

[0043] III), the reagent of the present invention;

[0044] IV), the kit of the present invention.

[0045] The present invention provides a method for detecting glial fibrillary acidic protein, characterized in that it comprises detecting glial fibrillary acidic protein using at least one of the following i) to iv):

[0046] i), the polypeptide of the present invention;

[0047] ii), the conjugate of the present invention;

[0048] iii), the reagent of the present invention;

[0049] iv), the kit of the present invention.

[0050] The present invention provides peptides C1b-5 and C2b-7 that specifically bind to the coiled-coil region of glial fibrillary acidic protein (GFAP). These peptides not only specifically bind to GFAP but also exhibit weak nonspecific interactions between the two peptides, resulting in low detection background. Using these two peptides as probes, combined with chemiluminescence and enzyme-linked immunosorbent assays, quantitative detection of GFAP protein levels in blood or cerebrospinal fluid can be performed, aiding the clinical diagnosis of brain injury-related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 The predicted coiled-coil structure of GFAP is shown, where abcdefg is a seven-chain repeat sequence with ordered side chains, ad is a hydrophobic amino acid, eg is a hydrophilic amino acid, and bcf is an interfacial amino acid. The four coiled-coil segments are coiled-coil 1a (yellow): positions 73-104; coiled-coil 1b (green): positions 116-214; coiled-coil 2a (blue): positions 231-252; coiled-coil 2b (red): positions 257-432;

[0052] Figure 2 AlphaFold3 predicts that peptides c1b-5 and c2b-7 bind to GFAP; gray represents GFAP, while c1b-5 and c2b-7 are red and green, respectively;

[0053] Figure 3shows the binding and dissociation curves of c1b-5 and GFAP;

[0054] Figure 4 shows the binding and dissociation curves of c2b-7 and GFAP;

[0055] Figure 5 Shows the correlation between relative photon number and GFAP concentration;

[0056] Figure 6 Detection pattern diagram of Example 3 is shown. DETAILED DESCRIPTION

[0057] The present invention provides the use of polypeptides, conjugates, reagents, and kits for detecting glial fibrillary acidic protein. Those skilled in the art can refer to the content of this article and appropriately improve the process parameters to achieve the desired results. It should be noted that all similar substitutions and modifications are obvious to those skilled in the art and are considered to be included in the present invention. The methods and applications of the present invention have been described through preferred embodiments, and relevant personnel can obviously modify or appropriately change and combine the methods and applications herein without departing from the content, spirit, and scope of the present invention to implement and apply the technology of the present invention.

[0058] The test materials used in the present invention are all common commercial products and can be purchased on the market. The present invention is further described below with reference to the following examples:

[0059] Example 1 Design and screening of GFAP coiled-coil complementary sequences

[0060] 1. Design of GFAP coiled-coil complementary sequence

[0061] The amino acid sequence of GFAP (P14136·GFAP_HMMAN) was obtained from Uniprot and used with a protein structure prediction tool (https: / / waggawagga.motorprotein.de / ) to identify sequences characteristic of the GFAP protein's coiled-coil structure. Since coiled-coils are formed by two or more intertwined α-helices to form a left-handed helix, the number of amino acid residues per turn in a single α-helix is ​​reduced from 3.6 to 3.5. Consequently, the amino acids that make up the coiled-coil structure rotate twice, forming a repeating sequence composed of multiple heptad units. The seven amino acid residues in each repeating unit are represented in sequence by abcdefg. Its primary structure is characterized by the presence of non-polar, hydrophobic amino acids at positions a and d, such as leucine, isoleucine, and valine, while polar, charged amino acids at positions e and g, such as lysine and glutamic acid, are predominantly present. Specific binding sequences can be designed based on the charge and bond orientation of the amino acid residues at positions e and g.

[0062] Combining protein tertiary structure and coiled-coil prediction tools, it is predicted that GFAP can form coiled-coil segments and coiled-coil heptad repeats such as Figure 1 As shown in Figure 1, GFAP contains four characteristic coiled-coil structural sequences, namely coiled-coil 1a at positions 73 to 104; coiled-coil 1b at positions 116 to 214; coiled-coil 2a at positions 231 to 252; and coiled-coil 2b at positions 257 to 377. Based on the three-dimensional structural characteristics of GFAP and the characteristics of coiled-coil interactions, the present invention uses coiled-coil 1b and coiled-coil 2b as targets. Figure 2 As shown, polypeptides C1b and C2b were designed, respectively, wherein polypeptide C1b forms a complementary relationship with coiled coil 1b, and C2b forms a complementary relationship with coiled coil 2b. The sequences of polypeptides C1b and C2b are as follows:

[0063] C1b: LRELDRELEDLQRDLAELKRKLDNLKHTLETLDRELDELSKQLDDLDRKLEDLKQDLEDLTRSLTDLDRHLESLHKRLTDLTKDLDDLRRT (SEQ ID NO: 1);

[0064] C2b: LASLTEELARLRQRLQSLRDDLARLRETLQDLSDTLLALRNKLATLTDD (SEQ ID NO: 2);

[0065] Further software simulations revealed that peptide C1b, due to its excessive length, did not specifically bind to the coiled-coil 1b of GFAP. Therefore, eight peptides of 42 amino acids each were designed for each site. ELISA was used to screen these 16 peptides, selecting those with strong interactions with GFAP for further experiments. The sequences of the 16 peptides are as follows:

[0066] c1b-1:LNQMDTELTSMDTKLQTMETELQSMEQRLESMDGDLESMRRE (SEQ ID NO:3);

[0067] c1b-2:LERLEHDLEHLKSRLQTLKTKLKNLKQRLQNLDTELNQLDNE (SEQ ID NO:4);

[0068] c1b-3:IERLEHDIEHLKSRIQTLKTKIKNLKQRIQNLDTEINQLDNE (SEQ ID NO:5);

[0069] c1b-4:VARLTESVRQLEHRVNDLEREVQSLECRVESLDGDVESLRRE(SEQ ID NO:6);

[0070] c1b-5:LARLTESLRQAEHRLNDLERELQSLECRLESLDGDLESLRRE(SEQ ID NO:7);

[0071] c1b-6:VERMEHDVEHMKSRVQTMKTKVKNMKQRVQNMDTEVNQMDNE(SEQ ID NO:8);

[0072] c1b-7:LRNLTESLNDLERELRQAEHRLESLRRELQSLESRLNQLDNE(SEQ ID NO:9);

[0073] c1b-8:LNQLENDLQSLTSELSTLRTRLTSLRQRLNTLKNKLQTLEQE(SEQ ID NO:10);

[0074] c2b-1:VSDLRDDVTSLEERVDELQTSVSDLRREVDSLRDRVKDLEKS(SEQ ID NO:11);

[0075] c2b-2:ISDLRDDITSLEERIEDLQTSISDLRREIDSLRDRIKDLEKS(SEQ ID NO:12);

[0076] c2b-3:LHQLRNDLTTLRQELDELQTSLSDLRRELDSLRDRLKDLEKS(SEQ ID NO:13);

[0077] c2b-4:LERLKHHLEHLESDLQTLETELKNLDQELQNLRTRLNQLKNH(SEQ ID NO:14);

[0078] c2b-5:VHQLRNDVTTLRQEVDELQTSVSDLDQEVQNLRTRVNQLKNH(SEQ ID NO:15);

[0079] c2b-6:LSDMRDDLTSMEERLEDMQTSLSDMRRELDSMRDRLKDMEKS(SEQ ID NO:16);

[0080] c2b-7:LSDLRDDLTSLEERLDELQTSLSDLRRELDSLRDRLKDLEKS (SEQ ID NO: 17);

[0081] c2b-8:VSDMRDDVTSMEERVEDMQTSVSDMRREVDSMRDRVKDMEKS (SEQ ID NO: 18).

[0082] 2. ELISA screening of peptides

[0083] The binding ability of 16 peptides to GFAP was evaluated using the saturation concentration method. Low concentrations of GFAP were coated on ELISA plates. The 16 peptides were biotin-modified during chemical synthesis and serially diluted. The peptides were then incubated with streptavidin-labeled HRP and developed with TMB. Signal values ​​were recorded using a microplate reader. A curve plotting peptide concentration versus signal value was constructed. The curve with upper and lower plateau values ​​was used to calculate the EC50 (EC50) value. Ideally, the EC50 value is equal to the KD value.

[0084] The specific steps are as follows:

[0085] (1) GFAP was diluted to 0.5 μg / mL and coated on a blank ELISA plate with 100 μL per well. The coating solution without GFAP was used as the blank group and incubated at 4°C overnight.

[0086] (2) Wash three times with PBST and block with 1% BSA at room temperature for 1 hour;

[0087] (3) Wash three times with PBST, prepare biotinylated peptides starting from 100,000 ng / mL, and dilute 3-fold into 16 gradients (in Table 1, column 1, the concentrations of biotinylated peptides from A to H are 100,000 ng / mL, 33333.33 ng / mL, 11111.11 ng / mL, 3703.70 ng / mL, 1234.57 ng / mL, 411.52 ng / mL, 137.17 ng / mL, and 45.72 ng / mL; column 2, the concentrations of biotinylated peptides from A to H are 15.24 ng / mL, 5.08 ng / mL, 1.69 ng / mL, 0.56 ng / mL, 0.19 ng / mL, 0.06 ng / mL, 0.02 ng / mL, and 0.00 ng / mL), 100 μL per well, and incubate at 37°C for 1 hour;

[0088] (4) Wash three times with PBST, add streptavidin-labeled HRP, 100 μL per well, and incubate at 37°C for 1 hour.

[0089] (5) Wash three times with PBST, add TMB colorimetric solution using a syringe, 100 μL per well, and terminate the color development with dilute sulfuric acid after 12 minutes.

[0090] (6) Place the ELISA plate in a microplate reader, test OD450, and record the results.

[0091] (7) Draw a graph with OD450 as the vertical axis and the dilution gradient as the horizontal axis to calculate the EC50 value.

[0092] The ELISA data are shown in Table 1 (OD450 values ​​of the tests).

[0093] Table 1. ELISA screening of peptides

[0094]

[0095]

[0096] Finally, five peptides, c1b-2, c1b-4, c1b-5, c2b-4 and c2b-7, were screened out with high affinity to GFAP, as shown in Table 2.

[0097] Table 2. Affinity of five peptides for GFAP

[0098]

[0099] 3. Interactions between peptides and GFAP binding sites and between peptides

[0100] If there is a non-specific interaction between the two detection probes during the detection process, it will lead to a high background value of the detection result or a false positive result. If there is competitive inhibition between the binding of the two probes to the target molecule, it will lead to a false negative result. Therefore, the present invention divides the polypeptides obtained by screening into two groups according to the binding sites, Group A includes c2b-4 and c2b-7, and Group B includes c1b-2, c1b-4 and c1b-5. The polypeptides of Group A are biotinylated and solidified onto a streptavidin-coated microplate, and the polypeptides of Group B are HRP-labeled. The sandwich method is used to verify whether there is competitive inhibition in the interaction between the two groups of polypeptides and GFAP, and whether there is a non-specific interaction between the two probes.

[0101] The specific steps are as follows:

[0102] (1) Dilute the peptides in group A to 0.5 μg / mL and immobilize them on streptavidin-coated microplates (100 μL per well). The coating solution without peptides was used as the blank control group. Incubate at 4°C overnight.

[0103] (2) Wash three times with PBST and block with 1% BSA at room temperature for 1 hour;

[0104] (3) Wash three times with PBST, prepare GFAP starting at 100 ng / mL, dilute GFAP 3-fold in 7 steps, 100 μL per well, and use 0 ng / mL GFAP as the negative control. Incubate at 37°C for 1 hour.

[0105] (4) Wash three times with PBST, dilute the peptide of group B to 1.0 μg / mL, add 100 μL per well, and incubate at 37°C for 1 hour;

[0106] (5) Wash three times with PBST, add TMB colorimetric solution using a syringe, 100 μL per well, and terminate the color development with dilute sulfuric acid after 12 minutes;

[0107] (6) Place the streptavidin-coated microplate in a microplate reader, measure OD450, and record the results.

[0108] The ELISA results are shown in Table 3. The results showed that, with the exception of the peptides C2b-7 and C1b-5 groups, the negative control OD values ​​of all other groups were significantly higher than those of the blank control. Therefore, it was determined that, with the exception of peptides C2b-7 and C1b-5, significant non-specific interactions occurred between the peptides in the other groups. The OD values ​​of the peptides C2b-7 and C1b-5 groups were linearly correlated with GFAP concentration, and there was no significant competitive inhibition between peptides C2b-7 and C1b-5. Therefore, C1b-5 and C2b-7 were selected as probes for GFAP detection.

[0109] Table 3. ELISA sandwich assay for peptide binding sites and non-specific interactions

[0110]

[0111] 4. Kinetic determination of affinity constants between GFAP and peptides c1b-5 and c2b-7

[0112] The binding and dissociation of peptides c1b-5 and c2b-7 with different concentrations of GFAP were performed using a biomolecular interaction analyzer (OCTET RED 96) using SA sensors, and the KD values ​​were calculated.

[0113] The specific steps are as follows:

[0114] (1) Buffer preparation: 10 mM PBS + 0.1% BSA + 0.02% Tween 20.

[0115] (2) Preparation of solutions for the assay: Dilute the biotinylated peptides c1b-5 and c2b-7 to 25 μg / mL with buffer. Dilute GFAP to 10,000 nM, 1,000 nM, 100 nM, and 10 nM with buffer.

[0116] (3) Sample loading before loading: prepare two blackboard 96-well plates and SA sensors. Use one blackboard as a pre-wet plate and add 200 μL of buffer to each of the eight wells in the first column. Use the other blackboard as a sample plate and add 200 μL of buffer to each of the eight wells in the first column. Add 200 μL of the corresponding biotin-labeled peptide c1b-5 or c2b-7 to each of the eight wells in the second column. Add 200 μL of buffer to each of the eight wells in the third column. Add GFAP solutions of 10,000 nM, 1,000 nM, 100 nM, 10 nM, and 0 nM to the fourth column from top to bottom.

[0117] (4) Sample testing on the machine: The sensor and sample plate are placed in the designated positions of the machine in turn, and the interaction between peptide c1b-5 and GFAP and the interaction between peptide c2b-7 and GFAP are tested in turn.

[0118] The binding and dissociation curves of peptide c1b-5 and GFAP are shown in Figure 2. Figure 3 As shown, the binding and dissociation curves of peptide c2b-7 and GFAP are shown in Figure 4 The vertical axis is Binding (nm), which represents the offset distance of the interference spectrum curve in nm; the affinity constant of peptide c1b-5 and GFAP is K D(c1b-5 / GFAP) =2.3e-8 M, the affinity constant of peptide c2b-7 and GFAP is K D(c2b-7 / GFAP) =7.9e-9 M.

[0119] Example 2 Quantitative Detection of GFAP by Combining Peptides c1b-5 and c2b-7 with Magnetic Beads and Chemiluminescent Molecules

[0120] Peptides c1b-5 and c2b-7 were combined with magnetic beads and chemiluminescent molecules to quantitatively detect GFAP. The principle is that biotin-labeled peptide c1b-5 interacts with SA-labeled magnetic beads, immobilizing peptide c1b-5 on the surface. Peptide c2b-7 is coupled to an acridinium ester (ME-DMAE-NHS) via the reaction of NHS ester with primary amines. When GFAP is present in the solution, peptides c1b-5, GFAP, and c2b-7 form a complex that emits chemiluminescence upon excitation with alkaline hydrogen peroxide. The luminescence signal is recorded using a chemiluminescence analyzer, and a standard curve is established using standards to quantify GFAP. In the absence of GFAP, the acridinium ester is not attached to the magnetic beads and is removed during subsequent washing, resulting in no chemiluminescence upon excitation. To validate the specificity of this method, detection of the CC2D1A protein (which has a coiled-coil structure) was also performed.

[0121] The specific steps are as follows:

[0122] (1) Preparation of luminescent probe: coupling of ME-DMAE-NHS with peptide c2b-7

[0123] a. Prepare ME-DMAE-NHS into a 2.5 mg / mL acridinium ester stock solution with DMSO and store in the dark.

[0124] b. Dissolve peptide c2b-7 in 0.2 M sodium bicarbonate (pH = 9) to a final concentration of 0.16 mg / mL;

[0125] c. Dilute the acridinium ester stock solution tenfold with DMSO to prepare a working solution. Add the acridinium ester working solution to the above peptide c2b-7 solution at a rate of 1 μL per 300 μL of peptide c2b-7 solution. Incubate in the dark at room temperature for 1 hour.

[0126] d. Add 100 μL of 0.2 M sodium bicarbonate (pH = 9) stop solution containing 10% lysine and react at room temperature for 30 minutes;

[0127] e. Dialyze the labeled acridinium ester-peptide c2b-7 conjugate into 0.1 M phosphate buffer (pH = 6.5) for later use.

[0128] (2) Detection of GFAP samples with different concentrations and CC2D1A samples with different concentrations

[0129] a. Vortex the magnetic spheres for 20 seconds to fully resuspend them. Pipette 100 μL of the magnetic sphere suspension into a centrifuge tube and mix thoroughly with 1 mL of buffer I (20 mM PBS + 0.05% tween 20 + 0.1% BSA, pH = 7.4).

[0130] b. Magnetic separation and discarding the supernatant, the magnetic balls were washed 3 times with buffer I;

[0131] c. Dilute peptide c1b-5 to 0.3 mg / mL in buffer I. Add 1 mL of peptide c1b-5 to the magnetic spheres. Vortex the tube thoroughly to resuspend the magnetic spheres. Place the tube on a rotary mixer and mix at room temperature for 1 hour.

[0132] d. Magnetic separation: wash the magnetic balls five times with buffer 1 and resuspend them with buffer 1;

[0133] e. Dilute GFAP and CC2D1A to 100 ng / mL with PBS and perform 5-fold serial dilutions. Pipette 50 μL of magnetic beads, mix with 50 μL of diluted GFAP or CC2D1A, and incubate at 37°C for 10 min.

[0134] f. Magnetic separation, wash with PBST three times, take 50 μL of luminescent probe and mix with magnetic beads, incubate at 37°C for 10 minutes;

[0135] g. Magnetic separation, wash three times with PBST, place the reaction tube in a chemiluminescence detector, inject 200 μL of excitation solution (0.05 M NaOH + 0.05% H₂O₂), and record the relative photon count. Use PBS buffer as a blank control.

[0136] The test results are shown in the table below. The test results show that the relative photon number is linearly related to the GFAP concentration. 2 =0.99( Figure 5 (Table 4). The linear equation is: Y = 2600691.79x + 228952.07. This method achieves a signal-to-noise ratio of 2.5 when detecting GFAP at a concentration of 6.4 pg / mL. Testing of unrelated proteins showed no correlation between relative photon count and CC2D1A concentration (Table 5).

[0137] Table 4. Correlation between relative photon number and GFAP concentration in the present invention

[0138]

[0139] Table 5. Relative photon number when the method of the present invention detects the irrelevant protein CC2D1A

[0140] Correlation with CC2D1A concentration

[0141]

[0142] Example 3: Chemiluminescent Detection of GFAP Content in Solution Using G-quadruplexes Combined with Hemin

[0143] The molecular "switch" is realized by the adjacent self-assembly of G-quadruplexes, and the HRP activity of G-quadruplex combined with hemin is used to catalyze the luminescence of chemiluminescent substrates. The chemiluminescent signal is collected to establish a standard curve to realize the chemiluminescent detection of GFAP content in the solution. Figure 6As shown, the specific principle is as follows: 5'-amino-modified nucleic acid DNA-1 is coupled to peptide c1b-5 via carbodiimide-activated carboxyl groups. 5'-dibenzocyclooctyne (DBCO)-modified nucleic acid DNA-2 is coupled to peptide c2b-7 via azide-cycloalkyne addition (SPAAC) reaction. These two detection probes, Probe 1 and Probe 2, are constructed. Probe 1 consists of peptide c1b-5 and the nucleic acid sequence DNA-1 (5'-TTTTTTTTTTTTTTTTTGTGGG-3', SEQ ID NO: 19). Probe 2 consists of peptide c2b-7 and the nucleic acid sequence DNA-2 (5'-TTTTTTTTTTTTTTTTAGGGCGGGTTGG-3', SEQ ID NO: 20). Both nucleic acid sequences contain a flexible stretch of 15 Ts and a G-rich stretch. In the absence of GFAP in the solution, the two strands are separated from each other, unable to form a complete G-quadruplex structure, lacking HRP activity and producing no chemiluminescence in the solution. When GFAP is present in the solution, it binds to peptides c1b-5 and c2b-7, shortening the distance between the two nucleic acid chains and allowing them to self-assemble into a complete G-quadruplex structure. The G-quadruplex binds to hemin and exhibits HRP activity. At this point, a chemiluminescent substrate is added, which emits light under the catalysis of HRP activity. The light signal is collected and used to establish a standard curve for quantitative detection of GFAP.

[0144] The specific implementation steps are as follows:

[0145] (1) Preparation of probe 1: The carboxyl group of peptide c1b-5 was activated by EDC and NHS. The activated carboxyl group reacted with the 5' amino group of DNA-1 to form an amide bond, thereby achieving coupling.

[0146] a. Peptide c1b-5 and 5' amino-modified DNA-1 were obtained by chemical synthesis;

[0147] b. Dissolve peptide c1b-5 in 50 mM MES, 500 mM NaCl, pH 6.0 buffer to prepare a 1 mg / mL solution. Add high-concentration EDC solution and NHS solution to the above solution to final concentrations of 2 mM and 5 mM, respectively. Stir at room temperature for 15 minutes.

[0148] c. Dissolve DNA-1 in PBS buffer (pH 7.5) to a 0.2 mM solution. Mix the two solutions at a 1:1 ratio and continue the reaction at room temperature for 2 hours.

[0149] d. Add 100 μL of 0.2 M sodium bicarbonate (pH = 9) stop solution containing 10% lysine and react at room temperature for 30 minutes;

[0150] e. The final product, probe 1, was obtained by dialysis.

[0151] (2) Preparation of probe 2: Azide-modified c2b-7 was coupled to 5'DBCO-modified DNA-2 via SPAAC reaction.

[0152] a. The N-terminal azide-modified peptide c2b-7 and 5'DBCO-modified DNA-2 were obtained by chemical synthesis;

[0153] b. Dissolve peptides c2b-7 and DNA-2 in PBS solution (pH 7.4) to final concentrations of 1 mg / mL and 0.3 mM, respectively, and react at room temperature for 4 h.

[0154] c. The final product, probe 2, is obtained by dialysis.

[0155] (3) Prepare the detection solution: dilute probe 1, probe 2, and hemin with PBS to make their final concentrations 1 nM, 1 nM, and 10 nM, respectively.

[0156] (4) Detection of GFAP samples with different concentrations:

[0157] a. Dilute GFAP with PBS to 100 ng / mL, 40 ng / mL, 12.5 ng / mL, 10 ng / mL, 1.56 ng / mL, 0.5 ng / mL, 0.2 ng / mL, and 0.02 ng / mL. Mix 50 μL of the diluted solutions containing different GFAP concentrations with 200 μL of the test solution and incubate at 37°C for 10 min.

[0158] b. Add 200 μL of 20 μM 3-[3-[[(methylthio)[10-(phenylmethyl)-9(10H)-acridinyl]methyl]thio]propoxy]-1-propanesulfonic acid sodium salt to the incubated mixed solution, and record the relative photon number using a chemiluminescence detector.

[0159] The test results show (Table 6) that the relative photon number is linearly related to the GFAP concentration, R 2 =0.99, the linear equation is: Y=26815.95x-6757.47.

[0160] Table 6. Correlation between relative photon number and GFAP concentration measured in this example

[0161]

[0162] Example 4 Screening of DNA-1 and DNA-2

[0163] 1. Screening and Optimization of DNA-1 and DNA-2

[0164] 1. Reference was made to the G-quadruplex sequences with high HRP activity mentioned in the literature:

[0165] Sequence 1: 5'-gtggggcattgtgggtgggtgtgg-3', SEQ ID NO: 21;

[0166] Sequence 2: 5'-gtgggtagggcgggttgg-3', SEQ ID NO: 22;

[0167] Sequence 3: 5'-gggttagggttagggttaggg-3', SEQ ID NO: 23;

[0168] Sequence 4: 5'-ggtggtggtggttgtggtggtggtgg-3', SEQ ID NO: 24;

[0169] Prepare solutions of each of the four nucleic acid fragments with hemin in PBS to a final concentration of 1 nM for the nucleic acid and 10 nM for the hemin. Aspirate 200 μL of each solution and incubate at 37°C for 10 minutes. Then, add 200 μL of 20 μM 3-[3-[[(methylthio)[10-(phenylmethyl)-9(10H)-acridinyl]methyl]thio]propoxy]-1-propanesulfonic acid sodium salt to the incubated solution. The relative photon counts are recorded using a chemiluminescence detector.

[0170] The results are shown in the table below. Each sequence has different luminescence intensities, among which sequence 2 has a large relative number of photons and the strongest luminescence.

[0171] Table 7. Luminescence of sequences 1 to 4

[0172]

[0173] 2. Dissociation of G-quadruplexes

[0174] A pair of fully complementary sequences consisting of 30 bases were designed to simulate the situation in which the peptide binds to GFAP and splits the G-quadruplex during the detection process. The selected sequence 2 was split as follows;

[0175] The first group 1:11 split:

[0176] 2-1:5'- ctaataacgacgaaaggcttcaaatccgat ttttttG-3′, SEQ ID NO: 25;

[0177] 2-11:5'-TGGGTAGGGCGGGTTGGtttttt atcggatttgaagcctttcgtcgttattag -3', SEQ ID NO: 26;

[0178] Second group 2:10 split:

[0179] 2-2:5'- ctaataacgacgaaaggcttcaaatccgat ttttttGTG-3', SEQ ID NO: 27;

[0180] 2-10:5'-GGTAGGGCGGGTTGGtttttt atcggatttgaagcctttcgtcgttattag -3', SEQ ID NO: 28;

[0181] The third group 3:9 split:

[0182] 2-3:5'- ctaataacgacgaaaggcttcaaatccgat ttttttGTGG-3', SEQ ID NO: 29;

[0183] 2-9:5'-GTAGGGCGGGTTGGtttttt atcggatttgaagcctttcgtcgttattag -3', SEQ ID NO:30;

[0184] The fourth group 4:8 split

[0185] 2-4:5'- ctaataacgacgaaaggcttcaaatccgat ttttttGTGGG-3', SEQ ID NO: 31;

[0186] 2-8:5'-TAGGGCGGGTTGGtttttt atcggatttgaagcctttcgtcgttattag -3', SEQ ID NO: 32;

[0187] The fifth group 5:7 split:

[0188] 2-5:5'- ctaataacgacgaaaggcttcaaatccgat ttttttGTGGGTAG-3', SEQ ID NO: 33;

[0189] 2-7:5'-GGCGGGTTGGtttttt atcggatttgaagcctttcgtcgttattag -3', SEQ ID NO:34;

[0190] The sixth group 6:6 split:

[0191] 2-6U:5'- ctaataacgacgaaaggcttcaaatccgat ttttttGTGGGTAGG-3', SEQ ID NO: 35;

[0192] 2-6D:5'-GCGGGTTGGtttttt atcggatttgaagcctttcgtcgttattag -3', SEQ ID NO:36

[0193] In each pair, the single-underlined portion of the two sequences is a completely reverse-complementary sequence, consisting of 30 nt. In each pair, the capitalized portion of the two sequences represents a sequence separated by different positions in sequence 2, and each pair can form a complete sequence 2 (5'-gtgggtagggcgggttgg-3', SEQ ID NO: 22). In each pair, the single-underlined portion and the six Ts between the capitalized portion form a flexible chain. Incubating the single-underlined portion in solution achieves complementary pairing. The single-underlined portion simulates the effect of polypeptides c1b-5 and c2b-7 forming a sandwich structure with GFAP in Example 3, bringing DNA1 and DNA2 closer together, thus bringing the two segments of the capitalized portion closer together.

[0194] For the assay, Solution A, containing one nucleic acid from each group and hemin, and Solution B, containing the other nucleic acid from each group and hemin, were prepared in PBS. Solutions A and B were mixed to achieve concentrations of 1 nM, 1 nM, and 10 nM, respectively. A 200 μL aliquot was incubated at 37°C for 10 minutes. Then, 200 μL of 20 μM 3-[3-[[(methylthio)[10-(phenylmethyl)-9(10H)-acridinyl]methyl]thio]propoxy]-1-propanesulfonic acid sodium salt was added to the incubated solution, and the relative photon count was recorded using a chemiluminescence detector.

[0195] The results are shown in the table below. The combined luminescence value of sequences 2-4 and 2-8 is high, while the luminescence values ​​of sequences 2-4 and 2-8 alone are low. Therefore, a 4:8 splitting method was selected to split the G-quadruplex.

[0196] Table 8. Sequence 2-1 to 2-11 individual luminescence values

[0197]

[0198] Table 9. Luminescence values ​​of sequences 2-1 to 2-11

[0199]

[0200] Specifically, the sequence 2 (5'-gtgggtagggcgggttgg-3', SEQ ID NO: 22) and the sequence splitting form 4:8 split were determined, and finally DNA-1 (5'-TTTTTTTTTTTTTTTTTGTGGG-3', SEQ ID NO: 19) and DNA-2 (5'-TTTTTTTTTTTTTTTTAGGGCGGGTTGG-3', SEQ ID NO: 20) were formed; the number of Ts did not affect the detection results.

[0201] 2. Optimization of Probe 1, Probe 2, and Hemin Concentrations:

[0202] Probe 1 (composed of polypeptide c1b-5 and nucleic acid sequence DNA-1 (5'-TTTTTTTTTTTTTTTTTGTGGG-3', SEQ ID NO:19)) and probe 2 (composed of polypeptide c2b-7 and nucleic acid sequence DNA-2 (5'-TTTTTTTTTTTTTTTTAGGGCGGGTTGG-3', SEQ ID NO:20)) were tested at 0.5 nM, 1 nM, and 5 nM, respectively. Hemin was tested at 5 nM, 10 nM, and 50 nM, respectively. Different concentration combinations were tested with 40 ng / mL GFAP and a blank control, and the signal-to-noise ratio was calculated.

[0203] The results are shown in the table below, which show that the best signal-to-noise ratio is achieved when the concentrations of probes 1 and 2 are 1 nM and the hemin concentration is 10 nM.

[0204] Table 10. Optimization of Probe 1, Probe 2, and Hemin Concentrations

[0205]

[0206] The above are only preferred embodiments of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principles of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. A polypeptide, characterized in that The amino acid sequence of the polypeptide is shown in SEQ ID NO: 7 and / or SEQ ID NO:

17.

2. A conjugate, characterized in that comprising the polypeptide according to claim 1 and a coupling medium; The coupling medium is selected from nucleic acid fragments, magnetic beads, biotin, acridinium ester and / or streptavidin; The nucleic acid fragment has the nucleotide sequence shown in SEQ ID NO: 19 and / or SEQ ID NO:

20.

3. The conjugate according to claim 2, characterized in that The 5' end of the nucleic acid fragment is modified with an amino group and / or a dibenzocyclooctyne group.

4. A reagent for detecting glial fibrillary acidic protein, characterized in that: include: At least one of a stabilizer, a preservative, a surfactant and / or a solubilizing agent and the polypeptide according to claim 1; and / or At least one of a stabilizer, a preservative, a surfactant and / or a solubilizing agent and the conjugate according to claim 2 or 3.

5. A kit, characterized in that include: At least one of a buffer, an activation reagent, a reaction termination solution and / or a chemiluminescent substrate and the polypeptide according to claim 1; and / or At least one of a buffer, an activation reagent, a reaction termination solution and / or a chemiluminescent substrate and the conjugate according to claim 2 or 3; and / or At least one of a buffer, an activation reagent, a reaction termination solution and / or a chemiluminescent substrate and the reagent according to claim 4.

6. Use of at least one of the following I) to IV) in the detection of glial fibrillary acidic protein for non-diagnostic purposes: 1), the polypeptide according to claim 1; II), the conjugate according to claim 2 or 3; III), the reagent according to claim 4; IV) The kit according to claim 5.

Citation Information

Patent Citations

  • GFAP specific antibody and application thereof in GFAP detection kit

    CN117820471A

  • Glial fibrillary acidic protein targeting immuno- and aptamer-based-therapy for neuroinjury, neurodegeneration, neuro-disease, and neuro-repair

    US20220054607A1