Application of taurine and derivatives thereof in preparation of medicine for improving vascular function of solid tumor

Abstract

The invention discloses application of taurine and derivatives thereof in preparation of drugs for improving vascular functions of solid tumors. According to the invention, based on the first discovery, taurine is used for enhancing ZO-1 mediated vascular endothelium tight connection and promoting solid tumor blood vessel normalization, so that the function of transplanted tumor blood vessels of mice with hepatocellular carcinoma is improved. The taurine and the derivatives thereof can be used for preparing medicines for improving vascular functions of solid tumors such as liver cancer and melanoma or researching the vascular functions of the solid tumors such as liver cancer and melanoma.

Description

Technical Field

[0001] The present invention relates to the field of drugs, and particularly relates to the application of taurine and its derivatives in the preparation of drugs for improving the vascular function of solid tumors. Background Art

[0002] Solid tumors such as liver cancer and melanoma have high incidence and mortality rates. Tumor vascular disorders and functional dysfunctions are the key reasons for anti-cancer drug delivery and infiltration of anti-cancer immune cells. However, currently available drugs targeting tumor vessels still cannot avoid toxic side effects, lack intellectual property rights in China, and have high drug prices, bringing more burdens to patients and society. Developing natural metabolites and their derivatives that improve the vascular function of solid tumors is beneficial to improving the efficacy of anti-tumor chemotherapy and immunotherapy, and bringing social and economic benefits.

[0003] Tumor angiogenesis and development are one of the key processes regulating the tumor microenvironment, involving complex cell interactions and signal transduction. Vascular endothelial growth factor and fibroblast growth factor are the main factors promoting angiogenesis. By binding to their corresponding receptors, they activate downstream signal pathways, driving the proliferation and migration of vascular endothelial cells. Abnormal expression of vascular endothelial growth factor and fibroblast growth factor in the tumor microenvironment leads to disorders in the angiogenesis process, forming a tumor vascular network with abnormal structure and function, exacerbating the hypoxic and acidotic states of the tumor microenvironment, forming immunosuppression, and promoting tumor progression.

[0004] Currently, drugs for regulating tumor vascular function clinically mainly include: 1) anti-angiogenic drugs, such as VEGF / VEGFR inhibitors (bevacizumab, ramucirumab, etc.), small molecule tyrosine kinase inhibitors (sunitinib, sorafenib, pazopanib), PDGF / PDGFR inhibitors (imatinib), FGF / FGFR inhibitors (erdafitinib); 2) vascular normalization drugs, such as VEGFR2-targeted drugs (ramucirumab), Angiopoietin-2 inhibitors (trebananib), endothelial cell stabilizers (statins); 3) drugs targeting tumor vascular metabolism, such as inhibiting endothelial cell metabolism (2-deoxyglucose), COX-2 inhibitors (celecoxib), etc. Summary of the Invention

[0005] The purpose of the present invention is to provide the application of taurine and its derivatives in the preparation of drugs for improving the vascular function of solid tumors such as liver cancer and melanoma. The main mechanism is that taurine monomers or taurine metabolized from taurine derivatives enhance ZO-1-mediated tight junctions of vascular endothelial cells, thereby improving tumor vascular function and promoting the normalization of solid tumor blood vessels.

[0006] To achieve the above purpose, the present invention adopts the following technical solutions: Use of taurine and / or taurine derivatives in the preparation of a medicament for improving the vascular function of solid tumors.

[0007] Preferably, the tumors include primary solid tumors and metastatic solid tumors.

[0008] Preferably, the medicament for improving the vascular function of solid tumors contains taurine and / or taurine derivatives and a pharmaceutical carrier.

[0009] Preferably, the taurine derivatives include: structurally modified derivatives such as homotaurine, taurochloramine, taurolidine, N-acyltaurine; peptide derivatives such as glutaurine, dipeptides containing taurine such as taurine-L-histidine; bile acid-binding derivatives such as taurocholic acid, tauroursodeoxycholic acid, tauro-beta-muricholic acid; antibacterial and antioxidant derivatives such as taurine bromamine, taurine-zinc complex, NAP taurine; drug conjugate derivatives such as retinyliden tauret. The structural formulas of taurine and its derivatives are shown in the following table (the structural formulas are queried based on the PubChem website https: / / pubchem.ncbi.nlm.nih.gov, or can be drawn by oneself): The advantages of the present invention are as follows: Currently in clinical practice, drugs for regulating tumor vascular function mainly include anti-angiogenic drugs, vascular normalization drugs, and drugs targeting tumor vascular metabolism. These drugs mainly rely on imports and are highly priced. When the inventor studied the mechanism of solid tumor angiogenesis and regulation, it was found that taurine or taurine derivatives that can metabolize to produce taurine can improve the vascular function of transplanted tumors in mice with hepatocellular carcinoma. Although taurine itself at different doses cannot inhibit tumor growth, taurine can promote tumor angiogenesis, promote tumor vascular maturation, improve the morphology and function of tumor blood vessels, increase blood oxygen, and improve the tumor microenvironment.

[0010] Currently, there is no application report on the improvement of the vascular function of solid tumors by taurine and its derivatives. Brief Description of the Drawings

[0011] Figure 1 : Taurine enhances ZO-1-mediated tight junctions in vascular endothelial cells. Among them: (A) Western Blot was used to detect the regulation of the protein expression level of ZO-1 in SVEC4-10 endothelial cells by different doses of taurine.

[0012] (B) Immunofluorescence experiments were used to verify the effect of taurine on the subcellular localization of ZO-1. Among them, green is the ZO-1 protein signal and blue is the nuclear signal.

[0013] (C) Image J software was used to statistically analyze the area ratio of the above ZO-1 signal distribution in the visual field area.

[0014] (D) Image J software was used to statistically analyze the average intensity of the above ZO-1 signal.

[0015] Figure 2 : The direct and indirect regulatory effects of taurine on the angiogenesis function of SVEC4-10 endothelial cells. Among them: (A) The supernatant of Hepa1-6 cell culture medium stimulated with 1 mM taurine for 48 hours was used as the conditioned medium, which was used to act on SVEC4-10 endothelial cells for tube formation experiments, and tube formation photos were taken.

[0016] (B) Image J software was used to statistically analyze the number of branch points in (A).

[0017] (C) Image J software was used to statistically analyze the number of tubular structures in (A).

[0018] (D) The direct stimulation method with 1 mM taurine was used to act on SVEC4-10 endothelial cells for tube formation experiments, and tube formation photos were taken.

[0019] (E) Image J software was used to statistically analyze the number of tubular structures in (D).

[0020] (F) Image J software was used to statistically analyze the branch point spacing in (D).

[0021] (G) Image J software was used to statistically analyze the number of branch points in (D).

[0022] Figure 3 : Taurine promotes the angiogenesis of microvessels in mouse liver cancer tissues, but does not significantly change the expression of classical angiogenesis-related genes. Among them: (A) Injection under the liver capsule with 1×10 6A liver orthotopic transplantation tumor was constructed by injecting Hepa1-6 cells. In the experimental group, taurine solutions at 0.2 mg / kg / day (TAU-low) and 2 mg / kg / day (TAU-high) were administered to mice via free drinking water, while the control group (CTR) drank ordinary water freely. After 19 days of intervention, the mice were euthanized. H&E staining was performed, and the newly formed microvessels were photographed, as indicated by the white dotted line pointed by the red arrow.

[0023] (B) The expression level of the Vegfa gene in the above-mentioned tumor tissues was detected by real-time quantitative PCR.

[0024] (C) The expression level of the Vegfb gene in the above-mentioned tumor tissues was detected by real-time quantitative PCR.

[0025] (D) The expression level of the Pdgfa gene in the above-mentioned tumor tissues was detected by real-time quantitative PCR.

[0026] (E) The expression level of the Angpt1 gene in the above-mentioned tumor tissues was detected by real-time quantitative PCR.

[0027] (F) The expression level of the Cxcl9 gene in the above-mentioned tumor tissues was detected by real-time quantitative PCR.

[0028] (G) The expression level of the Cxcl10 gene in the above-mentioned tumor tissues was detected by real-time quantitative PCR.

[0029] Figure 4 : Taurine promotes the vascular development and maturation of transplanted tumors in hepatocellular carcinoma mice. Among them: (A) A transplanted tumor model was constructed by subcutaneous injection of primary hepatocarcinoma cells into mice. After tumor formation, the mice were randomly divided into a control group (CTR, intraperitoneal injection of sterile double-distilled water) and a taurine intervention group (TAU, 1000 mg / kg taurine intraperitoneal injection). The mice were euthanized, tumor tissues were collected, tissue sections were prepared, and immunofluorescence staining was performed. Among them, green represents αSMA-positive pericytes, red represents CD31-positive endothelial cells, and blue represents DAPI nuclear staining.

[0030] (B) The area ratio of αSMA-positive pericytes distributed in the tumor area was calculated using Image J software.

[0031] (C) The area ratio of CD31-positive pericytes distributed in the tumor area was calculated using Image J software.

[0032] (D) The ratio of αSMA-positive pericytes to CD31-positive pericytes was calculated to reflect the degree of tumor vascular maturation.

[0033] Figure 5: Taurine improves the tumor hypoxic microenvironment. Among them: (A) A xenograft tumor model was constructed by subcutaneously injecting primary hepatocarcinoma cells into mice. After tumor formation, the mice were randomly divided into a control group (CTR, intraperitoneally injected with sterilized double-distilled water) and a taurine intervention group (TAU, intraperitoneally injected with 1000 mg / kg taurine). The mice were euthanized, and tumor tissues were collected, tissue sections were prepared, and immunofluorescence staining was performed. Among them, ice blue is the GLUT1 protein reflecting blood sample concentration, and blue is DAPI nuclear staining.

[0034] (B) Using the above tissue sections, immunofluorescence staining was performed, where magenta is CD8-positive cells, green is αSMA marking mature blood vessels, and blue is DAPI nuclear staining.

[0035] (C) Quantitative statistical analysis was performed on the area ratio of the GLUT1 expression region to the tumor region in the above immunofluorescence staining.

[0036] (D) Quantitative statistical analysis was performed on the area ratio of CD8-positive cells to the tumor region in the above immunofluorescence staining. Specific implementation mode

[0037] To make the features and advantages of the present invention more obvious and understandable, specific examples are given below for detailed description. Unless otherwise specified, the methods of the present invention are conventional methods in the art.

[0038] Example 1: Taurine enhances the tight junction of vascular endothelial cells mediated by ZO-1.

[0039] Direct treatment: SVEC4-10 endothelial cells were cultured in vitro, and the cell concentration was adjusted to 1×10 6 cells / ml. After overnight adherent culture, different final concentrations of taurine (TAU-low: 1 mM; TAU-high: 10 mM) were added, and the cells were placed in a 37°C constant temperature incubator for 48 hours. Whole cell lysates were collected, and Western Blot was used to detect the regulation of the protein expression level of ZO-1 in SVEC4-10 endothelial cells by different doses of taurine. The effect of taurine on the subcellular localization of ZO-1 was verified by immunofluorescence experiments. The secondary antibody labeled with 488 fluorescent dye was used to recognize and bind to the primary antibody of ZO-1 protein, and the cell nucleus was stained with DAPI. ImageJ software was used to statistically analyze the area ratio of the above ZO-1 signal distribution in the visual field area and the average intensity of the ZO-1 signal.

[0040] Indirect treatment: SVEC4-10 endothelial cells were cultured in vitro, and the cell concentration was adjusted to 1×10 6cells / ml. After culturing adherently overnight, the supernatant of the Hepa1-6 cell culture medium stimulated with 1 mM taurine at the final concentration for 48 hours was used as the conditioned medium. According to the ratio of adding 0.1 ml of the conditioned medium to every 1 ml of the SVEC4-10 endothelial cell culture medium, it was placed in a 37 °C constant temperature incubator and acted on SVEC4-10 endothelial cells for 48 hours. The whole cell lysate was collected, and the regulation of the protein expression level of ZO-1 in SVEC4-10 endothelial cells by different doses of taurine was detected by Western Blot.

[0041] The results showed that SVEC4-10 endothelial cells directly treated with different final concentrations of taurine (TAU-low: 1 mM; TAU-high: 10 mM) slightly up-regulated the expression of ZO-1, while indirect treatment did not up-regulate the expression of ZO-1 ( Figure 1 A). Therefore, taurine may directly act on vascular endothelial cells to promote the tight junction of vascular endothelial cells, rather than indirectly regulate intravascular somatic cells after acting on tumors. The immunofluorescence experiment further confirmed that direct treatment of SVEC4-10 endothelial cells with taurine increased the cell tight junction mediated by ZO-1 protein ( Figure 1 B- Figure 1 D). By comparing the results of Western Blot and immunofluorescence experiments, we found that the main mechanism by which taurine promotes endothelial cell tight junction is not to up-regulate the expression of ZO-1, but to promote the distribution of ZO-1 at cell junctions.

[0042] Example 2: Direct and indirect regulatory effects of taurine on the angiogenesis function of SVEC4-10 endothelial cells.

[0043] For the study of indirect regulatory effects. SVEC4-10 endothelial cells were cultured in vitro, and the cell concentration was adjusted to 1×10 6 cells / ml. After culturing adherently overnight, the supernatant of the Hepa1-6 cell culture medium stimulated with 1 mM taurine at the final concentration for 48 hours was used as the conditioned medium. According to the ratio of adding 0.1 ml of the conditioned medium to every 1 ml of the SVEC4-10 endothelial cell culture medium, it was placed in a 37 °C constant temperature incubator and used for the tube formation experiment on SVEC4-10 endothelial cells, and the tube formation photos were taken. The number of branch points and the number of tubular structures were counted using Image J software.

[0044] For the study of direct regulatory effects. SVEC4-10 endothelial cells were cultured in vitro, and the cell concentration was adjusted to 1×10 6cells / ml. After overnight adherent culture, the SVEC4-10 endothelial cells were treated with 1 mM taurine added directly at a final concentration and placed in a 37 °C constant temperature incubator for a tube formation assay, and tube formation photographs were taken. The number of branch points, the distance between branch points, and the number of tubular structures were counted using Image J software.

[0045] The results showed that: under the indirect treatment, the number of tubular connection points in the taurine group showed no significant change compared with the control group, and the total length of the small tubes decreased slightly, but there was no statistical significance ( Figure 2 A- Figure 2 C). When the SVEC4-10 endothelial cells were directly treated with taurine, the number of tubular connection points in the taurine group increased by 38% (p < 0.05), the number of small tubes increased by 64% (p < 0.05), and the branch length increased by 66% (p < 0.01) ( Figure 2 D- Figure 2 G). Therefore, taurine promotes tube formation of endothelial cells, and it also directly acts on endothelial cells, rather than indirectly regulating endothelial cells after acting on tumor cells.

[0046] Example 3: Taurine promotes the regulation of tumor microvascular angiogenesis and the expression of related protein-coding genes.

[0047] For the intrahepatic transplanted tumor model, C57BL6 / J male 7-8-week-old mice were purchased from Jicuiyaokang (the same below). The mice were anesthetized with chloral hydrate. An ophthalmic scissors was used to make a 5-mm-long window on the right side of the midline of the mouse abdomen near the xiphoid process to expose the left liver lobe of the mouse. An insulin syringe was used to inject 1×10 6 Hepa1-6 hepatoma cells, and then pressed with a cotton swab for 2-5 seconds to avoid the spillage of tumor cells from the liver. The surgical incision was sutured with medical suture.

[0048] Mice were intervened by intragastric administration of taurine solution at 0.2 mg / kg / day (TAU-low) and 2 mg / kg / day (TAU-high) respectively via free drinking, while the control group (CTR) drank ordinary water freely. After 19 days of intervention, the mice were euthanized. Newly formed microvessels were photographed by H&E staining, as shown by the white dotted line indicated by the red arrow. The expression levels of the genes encoding vascular endothelial growth factor A (Vegfa, NCBI gene ID: 22339), vascular endothelial growth factor B (Vegfb, NCBI gene ID: 22340), platelet-derived growth factor α (Pdgfa, NCBI gene ID: 18590), angiopoietin 1 (Angpt1, NCBI gene ID: 11600), C-X-C motif chemokine ligand 9 (Cxcl9, NCBI gene ID: 17329) and C-X-C motif chemokine ligand 10 (Cxcl10, NCBI gene ID: 15945) in the above tumor tissues were detected by real-time quantitative PCR. The primer sequences for real-time quantitative PCR were as follows: Vegfa-F: CTGCCGTCCGATTGAGACC Vegfa-R: CCCCTCCTTGTACCACTGTC Vegfb-F: GCGCCGACACGATCTACTG Vegfb-R: GGAGTGGGATGGATGATGTCAG Pdgfa-F: GACGGTCATTTACGAGATACCTC Pdgfa-R: CTACGCCTTCCTGTCTCCTC Angpt1-F: CACATAGGGTGCAGCAACCA Angpt1-R: CGTCGTGTTCTGGAAGAATGA Cxcl9-F: TCCTTTTGGGCATCATCTTCC Cxcl9-R: TTTGTAGTGGATCGTGCCTCG Cxcl10-F: CCAAGTGCTGCCGTCATTTTC Cxcl10-R: GGCTCGCAGGGATGATTTCAA Actb-F: GGCTGTATTCCCCTCCATCG Actb-R: CCAGTTGGTAACAATGCCATGTH&E staining results showed that low-dose (0.2 mg / kg / day, TAU-low) and high-dose (2 mg / kg / day, TAU-high) taurine significantly increased the neovascularization in the tumor area, such as the position of the white dotted line indicated by the red arrow ( Figure 3 A), however, the expression of angiogenesis-related factors in tumor tissues detected by real-time quantitative PCR did not show significant differences ( Figure 3 B- Figure 3 G), but the expression of Pdgfa, Cxcl9, and Cxcl10 genes showed an upward trend in the high-dose taurine treatment group ( Figure 3 D and Figure 3 F- Figure 3 G). We speculated that this was related to the extraction of mRNA from tissues. Not all cells in the tissues expressed these genes. In addition, it was also related to the sample size.

[0049] Example 4: Promoting effect of taurine on the vascular development and maturation of transplanted tumors in hepatocellular carcinoma mice.

[0050] For the subcutaneous inhibitory tumor model of hepatocytes, Hepa1-6 mouse hepatoma cells in the logarithmic growth phase were taken, and the cell suspension concentrations were adjusted to 1×10 8 cells / mL using serum-free DMEM medium. After anesthetizing C57BL / 6J mice with a small animal inhaled gas anesthetic machine and pet isoflurane, the skin on the side back of the mice was disinfected, and 0.1 mL of the cell suspension was subcutaneously injected into the subcutaneous area on the right back of the mice. The tumor formation was observed every 2 days, and the tumor formation was observed daily. The long diameter (L) and short diameter (W) of the tumor were measured with a vernier caliper, and the volume was calculated according to the formula V = 0.5×L×W2. After tumor formation, the mice were randomly divided into a control group (CTR, intraperitoneal injection of sterilized double-distilled water) and a taurine intervention group (TAU, 1000 mg / kg taurine intraperitoneal injection). When the tumor volume reached 1.5 cm 3 or the mice showed severe discomfort, the experiment was terminated, the mice were euthanized, and the body weight and subcutaneous tumor weight of the mice were recorded.

[0051] Tissue sections were prepared for immunofluorescence staining. Among them, green was αSMA-positive pericytes, red was CD31-positive endothelial cells, and blue was DAPI nuclear staining. Image J software was used to calculate the area ratio of αSMA-positive pericytes and CD31-positive pericytes distributed in the tumor area, as well as the ratio of αSMA-positive pericytes to CD31-positive endothelial cells, so as to reflect the maturity of tumor blood vessels.

[0052] The immunofluorescence staining results showed that in a single random field of view, the αSMA-positive pericytes (green fluorescence) in the transplanted tumors of the taurine treatment group were significantly increased (Figure 4 A- Figure 4 C), the ratio of αSMA-positive pericytes (green fluorescence) to CD31-positive endothelial cells (red fluorescence) was significantly increased ( Figure 4 D). This indicates that taurine promotes tumor vessel maturation.

[0053] Example 5: The effect of taurine on improving the tumor hypoxic microenvironment.

[0054] For the subcutaneous hepatocellular carcinoma inhibitory tumor model, Hepa1-6 mouse hepatocarcinoma cells in the logarithmic growth phase were taken, and the cell suspension concentrations were adjusted to 1×10 8 cells / mL using serum-free DMEM medium. After anesthetizing C57BL / 6J mice with a small animal inhalant gas anesthesia machine and isoflurane for pets, the skin on the side of the back of the mice was disinfected, and 0.1 mL of the cell suspension was subcutaneously injected into the subcutaneous tissue on the right side of the back of the mice. The tumor formation was observed every 2 days, and the tumor formation was observed daily. The long diameter (L) and short diameter (W) of the tumor were measured with a vernier caliper, and the volume was calculated according to the formula V = 0.5×L×W2. After tumor formation, the mice were randomly divided into a control group (CTR, intraperitoneal injection of sterile double-distilled water) and a taurine intervention group (TAU, 1000 mg / kg taurine intraperitoneal injection). When the tumor volume reached 1.5 cm 3 or the mice showed severe discomfort, the experiment was terminated, the mice were euthanized, the tumor tissues were collected, tissue sections were prepared, and immunofluorescence staining was performed. Among them, GLUT1 protein reflects the blood sample concentration, CD8 protein reflects the distribution of CD8-positive cells, αSMA reflects the situation of mature blood vessels, and DAPI is used for nuclear staining. The area ratio of GLUT1 expression and CD8-positive cells to the tumor area was statistically analyzed using Image J software.

[0055] The results of immunofluorescence detection found that the expression of GLUT1 in the tumors of the taurine treatment group was significantly decreased ( Figure 5 A and Figure 5 C), indicating that taurine improved the tumor hypoxic microenvironment. In addition, using the same samples for immunofluorescence experiments, it was also found that both αSMA-positive pericytes and CD8-positive cells increased in the tumors of the taurine treatment group ( Figure 5 B and Figure 5 D), which further indicates that the improved tumor blood oxygen supply by taurine is related to the increased vascular maturity.

Claims

1. Use of taurine and / or taurine derivatives in the preparation of a drug for improving the vascular function of solid tumors.

2. The application according to claim 1, wherein: The solid tumors mentioned include primary solid tumors and metastatic solid tumors.

3. The application according to claim 1, characterized in that: The solid tumors include, but are not limited to, liver cancer and melanoma.

4. The application according to claim 1, wherein: The taurine derivatives include, but are not limited to, structure-modified derivatives, peptide derivatives, bile acid-binding derivatives, antibacterial and antioxidant derivatives, drug conjugate derivatives; the structure-modified derivatives include, but are not limited to, homotaurine, taurochloramine, taurolidine, N-acyltaurine; the peptide derivatives include, but are not limited to, glutaurine, taurine-L-histidine; the bile acid-binding derivatives include, but are not limited to, taurocholic acid, tauroursodeoxycholic acid, tauro-beta-muricholic acid; the antibacterial and antioxidant derivatives include, but are not limited to, taurine bromamine, taurine-zinc complex, NAP taurine; the drug conjugate derivatives include, but are not limited to, retinyliden tauret.

5. The application according to claim 1, wherein: The drug for improving the vascular function of solid tumors contains taurine and / or taurine derivatives and a pharmaceutical carrier.

Images