Plant immune-inducing protein EqBPIE1 and its application

Abstract

The present invention belongs to the field of molecular biology technology, and specifically relates to a plant immune-inducing protein EqBPIE1 and its application. The amino acid sequence of the protein EqBPIE1 is shown in SEQ ID No. 1. The protein EqBPIE1 provided by the present invention can enhance the plant's own immune system from the plant itself, thereby enabling the plant to cope with more diverse environmental changes and infection by multiple pathogens; it has an inhibitory effect on the infection of multiple pathogens on plants, covering multiple pathogens such as rubber tree powdery mildew, Siamese anthracnose, gray mold, Pseudomonas syringae, pepper phytophthora, and soybean phytophthora, and can significantly improve plant disease resistance. The antibacterial effect can be produced at a concentration of 0.1 to 1 μM.

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology, and in particular relates to a plant immune inducing protein EqBPIE1 and an application thereof. Background Art

[0002] Plants possess a complex immune system capable of identifying and resisting the invasion of pathogens. Immune-inducing proteins are key substances that can activate a plant's own immune response. By spraying immune-inducing proteins, plants can be induced to enter an immune response state prematurely, enhancing the strength and toughness of plant cell walls and causing them to produce a series of resistance-related substances, such as phytoalexins and protease inhibitors, thereby establishing a solid defense barrier before pathogens invade and effectively inhibiting the infection and proliferation of pathogens. This control strategy, based on the plant's own immune mechanism, is green, environmentally friendly, and sustainable. It does not rely on chemical pesticides, will not cause drug resistance, and will not damage the ecological environment. At the same time, it can be widely applied to a variety of plants and has an inhibitory effect on a variety of viruses. It provides a new, efficient, and environmentally friendly solution for the prevention and control of plant viral diseases. It is expected to play an important role in agricultural production, reduce losses caused by diseases, and ensure the healthy growth of plants and the stable and high yield of agricultural products. Summary of the Invention

[0003] The purpose of the present invention is to provide a plant immunity inducing protein, which can enhance the disease resistance of plants themselves and achieve resistance to infection by multiple pathogens on multiple plants.

[0004] The present invention provides a plant immunity-inducing protein EqBPIE1. The amino acid sequence of the protein EqBPIE1 is shown in SEQ ID No. 1, specifically: MGSSHHHHHHSSGLVPRGSHMASMTGGQQMGRGSYHTNISTKSKNSSTLEGFGPSPVTDRVIVSRSFETTKEDRVKIPTALDPGVPVAKIAEQFGFTKRQIYYVRSYGLESGRKSCGRKPAVLASTAAADYKDDDDKGDYKDDDDKIDYKDDDDK. To facilitate protein detection, the present invention incorporates a 6×His tag at the N-terminus and a 3×Flag tag at the C-terminus of the protein.

[0005] The present invention also provides a CDS sequence of the protein EqBPIE1 described in the above technical solution, and the CDS sequence is shown in SEQ ID No. 2, specifically: 5'-ATGGGCAGCAGCCATCATCATCATCATCACAGCAGCGGCCTGGTGCCGCGCGGCAGCCATATGGCTAGCATGACTGGTGGACAGCAAATGGGTCGCGGATCCTACCACACGAATATTTCTACCAAATCAAAAAATAGCTCCACCCTAGAAGGATTTGGGCCTTCTCCAGTCACTGATCGAGTAATAGTAAGTCGTAGTTTTGAAACTACGAAAGAGGACCGAGTAAA AATCCCAACTGCTTTGGATCCAGGAGTGCCGGTGGCAAAGATTGCGGAGCAGTTTGGATTCACTAAGCGACAAATTTATTATGTCCGAAGTTATGGTTTGGAGTCTGGGAGGAAGAGCTGCGGGAGAAAACCAGCAGTATTAGCCAGTACTGCGGCCGCAGATTACAAGGATGACGACGATAAGGGAGATTACAAGGATGACGACGATAAGATCGATTACAAGGATGACGACGATAAG-3'.

[0006] The present invention also provides a primer pair for amplifying the CDS sequence described in the above technical solution, the primer pair comprising EqBPIE1-For and EqBPIE1-Rev; the sequence of the EqBPIE1-For is shown in SEQ ID No. 3, specifically: 5'-GTGGACAGCAAATGGGTCGCGGATCCATGTACCACACGAATATTTCTACC-3'; the sequence of the EqBPIE1-Rev is shown in SEQ ID No. 4, specifically: 5'-TCGAGTGCGGCCGCAAGCTTGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCAGTACTGGCTAATACTGCTGGTTTTC-3'.

[0007] The present invention also provides the use of the protein EqBPIE1 described in the above technical solution in improving the resistance of plants to pathogens.

[0008] Preferably, the pathogens include powdery mildew of rubber tree, Colletotrichum siamese, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici and Phytophthora sojae.

[0009] Preferably, the plants include rubber tree, Arabidopsis thaliana, Nicotiana benthamiana and soybean.

[0010] The present invention also provides a method for preparing the protein EqBPIE1 described in the above technical solution, which comprises: using the primer pair described in the above technical solution to amplify the CDS sequence described in the above technical solution, then transforming the amplified CDS sequence into a recipient bacterium, inducing protein expression, collecting the bacteria, and purifying to obtain the protein EqBPIE1.

[0011] Preferably, the induction comprises: 600 =0.6~0.8, add IPTG to a final concentration of 0.2~0.5mM, and then culture the bacterial solution at 16℃ and 100rpm for 18~24h.

[0012] Preferably, the purification comprises the following steps: resuspending the bacteria in PBS protein buffer and adding PMSF to a final concentration of 100 μM; ultrasonically disrupting the bacteria and collecting the supernatant by centrifugation; passing the supernatant through a His-Tag purification resin and incubating on a shaker for 1 hour to allow it to fully bind to the tagged protein; then passing the entire system through a gravity column, washing three times with 3 times the column volume of PBS, and finally eluting the protein using a PBS buffer with an imidazole concentration of 200 mM.

[0013] The present invention also provides a method for improving plant resistance to pathogens, wherein the pathogens include rubber tree powdery mildew, Siamese anthracnose, gray mold, Pseudomonas syringae, capsici and soybean phytophthora; the method comprises: spraying a solution of the protein EqBPIE1 according to claim 1 onto plant leaves; the concentration of the protein EqBPIE1 solution is 0.1-1 μM.

[0014] Beneficial effects of the present invention:

[0015] The protein EqBPIE1 provided by the present invention has an inhibitory effect on a variety of pathogens, including rubber tree powdery mildew, Siamese anthracnose, gray mold, Pseudomonas syringae, pepper phytophthora and soybean phytophthora, and can significantly improve plant disease resistance. A concentration of 0.1-1 μM can produce an antibacterial effect; it is effective against a variety of plants, including rubber trees, Arabidopsis thaliana, Nicotiana benthamiana and soybeans.

[0016] The present invention is a protein product, which, compared with chemical pesticides, has no pollution to the environment and will not cause pathogens to develop drug resistance.

[0017] The protein EqBPIE1 provided by the present invention has the effect of enhancing the immune system of the plant itself, thereby enabling the plant to cope with more diverse environmental changes and infections by multiple pathogens.

[0018] The protein EqBPIE1 provided by the present invention has a simple preparation process, and the reagents and instruments used are common and easily available, allowing ordinary researchers to easily operate it. The required experimental strains and culture reagents are inexpensive, the protein extraction cost is low, and it is easy to obtain in large quantities. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0020] Figure 1 This is the SDS-PAGE identification result of EqBPIE1 protein;

[0021] Figure 2 The results of the resistance of EqBPIE1 to rubber tree powdery mildew after application to rubber trees;

[0022] Figure 3 The results of EqBPIE1's resistance to Colletotrichum siamensis after application to rubber trees are shown in Figure 2.

[0023] Figure 4 This is the resistance result of EqBPIE1 to Botrytis cinerea after application to Arabidopsis thaliana;

[0024] Figure 5 The results of the resistance of EqBPIE1 to Pseudomonas syringae after application to Nicotiana benthamiana;

[0025] Figure 6 The results of EqBPIE1 application to Nicotiana benthamiana against Phytophthora capsici resistance were shown.

[0026] Figure 7 The results show the resistance of EqBPIE1 to Phytophthora sojae after application to soybean. DETAILED DESCRIPTION

[0027] To further illustrate the present invention, a plant immunity inducing protein EqBPIE1 and its application provided by the present invention are described in detail below with reference to the accompanying drawings and examples, but they should not be construed as limiting the scope of protection of the present invention.

[0028] The plant and pathogen information used in the examples of the present invention are shown in Table 1 below:

[0029] Table 1 Information of tested plants and strains

[0030]

[0031] Example 1

[0032] (1) Design primers based on the target protein sequence. The specific sequences are as follows:

[0033] EqBPIE1-For: 5'-GTGGACAGCAAATGGGTCGCGGATCCATGTACCACACGAATATTTCTACC-3' (SEQ ID No. 3);

[0034] EqBPIE1-Rev: 5'-TCGAGTGCGGCCGCAAGCTTGAATTCTCACTTATCGTCGTCATCCTTGTAATCGATCTTATCGTCGTCATCCTTGTAATCTCCCTTATCGTCGTCATCCTTGTAATCAGTACTGGCTAATACTGCTGGTTTTC-3' (SEQ ID No. 4).

[0035] (2) Construction of prokaryotic expression vector: RNA of rubber tree powdery mildew strain HO-73 was extracted and used as a template for PCR amplification using primers EqBPIE1-For / EqBPIE1-Rev after reverse transcription to obtain a target fragment of 421 bp in length. BamH Ⅰ and EcoR I. Double enzyme digestion, ligation with the target fragment using homologous recombination, and transformation into E. coli BL21 competent cells. The recombinant vector was sequenced and the transformants with the correct sequence were saved.

[0036] (3) The BL21 transformants with correct sequencing were first cultured in 10 mL of LB liquid medium containing kanamycin antibiotics at 37°C and 150 rpm overnight, and then added to LB liquid medium containing kanamycin antibiotics at a ratio of 1:100 (v / v) and cultured at 37°C and 150 rpm. 600 =0.6-0.8, add IPTG to the system to a final concentration of 0.5 mM, and then culture the bacterial solution at 16°C and 100 rpm for 18-24 hours to induce protein expression.

[0037] (4) After induction, the cells were collected by centrifugation at 5000 rpm for 10 min. The cells were then resuspended in 4°C pre-cooled PBS protein buffer (2 mM KH2PO4, 8.0 mM Na2HPO4·12H2O, 136.0 mM NaCl, 2.6 mM KCl, pH = 7.4). PMSF (phenylmethylsulfonyl fluoride) was added to a final concentration of 100 µM to inhibit protein degradation. The E. coli cells were then disrupted using an ultrasonic disruptor until the cell suspension became clear. The suspension was then centrifuged at 12000 rpm for 15 min at 4°C and the supernatant was collected.

[0038] (5) Add His-Tag purification resin equilibrated with PBS to the supernatant and incubate on a shaker at 4°C for 1 hour to allow it to fully bind to the tagged protein. Then pass the entire system through a gravity column, wash three times with 3 column volumes of PBS, and finally elute the protein with PBS buffer with an imidazole concentration of 200mM.

[0039] (6) The eluted protein solution was placed in an ultrafiltration tube and centrifuged at 4000 rpm for 3 h at 4°C to remove the imidazole and PMSF in the solution. The protein concentration was measured and a relatively pure protein solution was obtained. The protein size was 17.14 kDa. Figure 1 shown.

[0040] Example 2

[0041] The EqBPIE1 protein solution with a concentration of 1 μM was sprayed onto the leaves of the bronze-stage rubber tree. The protein inoculation amount for each leaf was about 500 ng. GST-Flag protein was used as a control. After 4 hours, the leaf surface was dried and the spores of rubber tree powdery mildew (10 6 The spore inoculum per leaf was about 2 × 10 5 The disease situation on the leaves was observed every day, and photos were taken and the area of ​​lesions was counted after 10 days. Figure 2 As shown, Figure 2 A in the middle represents the leaf phenotype 10 days after the protein solution was sprayed onto the surface of rubber tree leaves and inoculated with zoospores of Erysiphe lepidophyllum; Figure 2 B in the middle represents the statistical graph of the lesion area, using t Test analysis of significant differences between the two groups, "**" indicates P <0.01, this experiment was repeated n=9 times.

[0042] Depend on Figure 2 It can be seen that compared with the control group, the powdery mildew spot area of ​​the leaves treated with EqBPIE1 was significantly reduced, and the antibacterial effect reached more than 40%; the EqBPIE1 protein provided by the present invention enhances the resistance of rubber trees to rubber tree powdery mildew.

[0043] Example 3

[0044] The EqBPIE1 protein solution with a concentration of 1 μM was sprayed onto the leaves of the bronze-stage rubber tree. The protein inoculation amount for each leaf was about 500 ng. GST-Flag protein was used as a control. After 4 hours, the leaf surface was dried and the zoospores of Siamese anthracnose fungus (10 6 Each leaf was inoculated with 10 μL of leukocytes / mL at 4 locations. The disease on the leaves was observed daily, and photos were taken and the area of ​​lesions was counted after 7 days. Figure 3 As shown, Figure 3 A in the middle represents the leaf phenotype 7 days after the protein solution was sprayed on the surface of rubber tree leaves and inoculated with zoospores of Siamese Anthracnose; Figure 3 B is the statistical chart of the lesion area, using t Test analysis of significant differences between the two groups, "**" indicates P <0.01, this experiment was repeated 31 times.

[0045] Depend on Figure 3 It can be seen that compared with the control group, the anthracnose lesion area of ​​the leaves treated with EqBPIE1 was significantly reduced, and the antibacterial effect reached 80%; the EqBPIE1 protein provided by the present invention enhances the resistance of rubber trees to Siamese anthracnose.

[0046] Example 4

[0047] The 1µM EqBPIE1 protein solution was sprayed onto Arabidopsis leaves. The protein inoculation amount for each leaf was about 100ng. GST-Flag protein was used as a control. After 4 hours, the leaf surface was dried and zoospores of Botrytis cinerea were inoculated onto the leaf surface (10 6 10µL of the solution was inoculated at the center of each leaf. The disease on the leaves was observed every day. After 3 days, photos were taken and the area of ​​the lesions was counted. The results are as follows: Figure 4 shown. Figure 4 A in the middle represents the leaf phenotype 3 days after the protein solution was sprayed on Arabidopsis and inoculated with zoospores of Botrytis cinerea; Figure 4 B is the statistical chart of the lesion area, using t Test analysis of significant differences between the two groups, "**" indicates P <0.01, this experiment was repeated n=18 times.

[0048] Depend on Figure 4 It can be seen that compared with the control group, the area of ​​gray mold lesions on leaves treated with EqBPIE1 was significantly reduced, and the antibacterial effect reached more than 80%; the EqBPIE1 protein provided by the present invention enhances the resistance of Arabidopsis thaliana to gray mold.

[0049] Example 5

[0050] The 1µM EqBPIE1 protein solution was sprayed onto Nicotiana benthamiana leaves. The protein inoculation amount per leaf was about 2µg. GST-Flag protein was used as a control. After 4 hours, the leaf surface was dried and zoospores of Pseudomonas syringae DC3000 were injected into the leaves with a syringe (OD was adjusted with 10mM MgCl2). 600 =0.002) 100µL, the leaves were observed for disease development every day for 2 days and photographed. To quantify the bacteria, each leaf was surface-sterilized with 75% ethanol and four leaf discs (8mm in diameter) were removed as a biological replicate. Three to four replicates were taken for each treatment. The leaf discs were ground and diluted in sterile water. The bacterial suspension was then inoculated onto KB agar plates and incubated at 30°C for 24 hours before colony counts were counted. The results are shown in Figure 1. Figure 5 As shown, Figure 5 Middle A shows the leaf phenotype 2 days after the protein solution was sprayed on the surface of Nicotiana benthamiana and injected with Pseudomonas syringae; Figure 5 B is the colony count statistics chart, using t Test analysis of significant differences between the two groups, "**" indicates P <0.01, this experiment was repeated 5 times.

[0051] Depend on Figure 5 It can be seen that compared with the control group, the number of bacteria in the leaves after EqBPIE1 treatment was significantly reduced, and the antibacterial effect reached more than 30%; the EqBPIE1 protein provided by the present invention enhanced the resistance of Nicotiana benthamiana to Pseudomonas syringae.

[0052] Example 6

[0053] The EqBPIE1 protein solution with a concentration of 1 μM was sprayed onto Nicotiana benthamiana leaves. The protein inoculation amount for each leaf was about 2 μg. GST-Flag protein was used as a control. After 4 hours, the leaf surface was dried and the zoospores of Phytophthora capsici were injected into the leaves (10 6 The disease condition on the leaves was observed every day, and photos were taken and the area of ​​the lesions was counted after 3 days. Figure 6 As shown, Figure 6 A represents the leaf phenotype 3 days after the protein solution was sprayed onto the surface of Nicotiana benthamiana leaves and injected with zoospores of Phytophthora capsici; B represents the disease grade; C is the statistical chart of the disease grade, using t Test analysis of significant differences between the two groups, "**" indicates P <0.01, this experiment was repeated 14 times.

[0054] Depend on Figure 6 It can be seen that compared with the control group, the severity of the disease on the leaves after EqBPIE1 treatment was significantly reduced; the EqBPIE1 protein provided by the present invention enhances the resistance of Nicotiana benthamiana to Phytophthora capsici.

[0055] Example 7

[0056] The 1µM EqBPIE1 protein solution was sprayed onto soybean leaves. The protein inoculation amount for each leaf was about 2µg. GST-Flag protein was used as a control. After 4 hours, the leaf surface was dried and the zoospores of Phytophthora sojae were inoculated onto the leaf surface (10 6 The disease condition on the leaves was observed every day, and photos were taken and the area of ​​lesions was counted after 7 days. Figure 7 As shown, Figure 7 A in the middle represents the leaf phenotype 7 days after the protein solution was sprayed on the soybean leaf surface and inoculated with zoospores of Phytophthora sojae; Figure 7 B is the statistical chart of the lesion area, using t Test analysis of significant differences between the two groups, "**" indicates P <0.01, and the experiment was repeated 15 times.

[0057] Depend on Figure 7 It can be seen that compared with the control group, the lesion area of ​​the leaves treated with EqBPIE1 was significantly reduced, and the antibacterial effect reached 70%; the EqBPIE1 protein provided by the present invention enhances the resistance of soybean to Phytophthora sojae.

[0058] It can be seen from the above examples that the EqBPIE1 protein provided by the present invention can effectively improve plant disease resistance and has certain effects on various pathogens.

[0059] Although the above embodiment provides a detailed description of the present invention, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the scope of protection of the present invention.

Claims

1. A plant immune inducing protein EqBPIE1, characterized in that The amino acid sequence of the protein EqBPIE1 is shown in SEQ ID No.

1.

2. The CDS sequence of the protein EqBPIE1 according to claim 1, characterized in that: The CDS sequence is shown as SEQ ID No.

2.

3. The protein EqBPIE1 according to claim 1, characterized in that The protein EqBPIE1 improves the resistance of plants to pathogens, including rubber tree powdery mildew, Siamese anthracnose, gray mold, Pseudomonas syringae, pepper phytophthora and soybean phytophthora.

4. The protein EqBPIE1 according to claim 1, characterized in that The plants include rubber tree, Arabidopsis thaliana, Nicotiana benthamiana and soybean.

5. A method for preparing the protein EqBPIE1 according to claim 1, characterized in that: The method comprises: using the primer pair EqBPIE1-For and EqBPIE1-Rev to amplify the CDS sequence according to claim 2, then transforming the amplified CDS sequence into a recipient bacterium, inducing protein expression, collecting the bacteria, and purifying to obtain the protein EqBPIE1; the sequence of the EqBPIE1-For is shown in SEQ ID No. 3; the sequence of the EqBPIE1-Rev is shown in SEQ ID No.

4.

6. The method according to claim 5, characterized in that The induction comprises: adding IPTG to a final concentration of 0.2-0.5 mM when the OD600 of the bacterial solution of the recipient bacteria is 0.6-0.8, and then culturing the bacterial solution at 16° C. and 100 rpm for 18-24 hours.

7. The method according to claim 5, characterized in that The purification process includes the following steps: resuspending the bacteria in PBS protein buffer and adding PMSF to a final concentration of 100 μM; disrupting the bacteria by ultrasound and collecting the supernatant by centrifugation; passing the supernatant through a His-Tag purification resin and incubating on a shaker for 1 hour to allow it to fully bind to the tagged protein; then passing the entire system through a gravity column, washing three times with 3 column volumes of PBS, and finally eluting the protein using a PBS buffer with an imidazole concentration of 200 mM.

8. A method for improving plant resistance to pathogens, characterized in that: The pathogens are powdery mildew of rubber tree, Colletotrichum siamese, Botrytis cinerea, Pseudomonas syringae, Phytophthora capsici and Phytophthora sojae; the method comprises: spraying a solution of the protein EqBPIE1 according to claim 1 onto plant leaves; the concentration of the protein EqBPIE1 solution is 0.1-1 μM.

Images