Biomarker for predicting colorectal cancer chemotherapy sensitivity and application thereof

By using the autophagy-TIMP-2 signaling axis as a predictive marker, the problem of lack of unified markers in the prior art is solved, and the sensitivity to chemotherapy for colorectal cancer is achieved is achieved, and the chemotherapy response rate and patient survival rate are improved.

CN120405130AActive Publication Date: 2025-08-01THE SIXTH AFFILIATED HOSPITAL OF SUN YAT SEN UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202510886020.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-30
Publication Date
2025-08-01
Estimated Expiration
2045-06-30

AI Technical Summary

Technical Problem

The lack of unified recognized markers in the prior art is used to predict the sensitivity of chemotherapy for colorectal cancer, resulting in some patients' unsatisfactory response to chemotherapy. Drug-resistant recurrence is the main cause of death in patients with middle and advanced colorectal tumors.

Method used

The autophagy-TIMP-2 signaling axis was used as a molecular marker to predict chemotherapy sensitivity in colorectal tumors, including the markers related to autophagy levels, p-ATG16L and TIMP-2 proteins, to evaluate chemotherapy sensitivity through serological detection, and reverse chemotherapy resistance caused by overexpression of TIMP-2 or targeting MMP-2/9.

Benefits of technology

The autophagy-TIMP-2 signaling axis can enhance chemotherapy sensitivity by regulating anti-tumor immunity, help screen out potential benefit groups of chemotherapy, optimize treatment plans, improve patient survival, and restore chemotherapy sensitivity in patients with autophagy-deficient.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120405130A_ABST
    Figure CN120405130A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological medicine, in particular to a biomarker for predicting colorectal cancer chemotherapy sensitivity and application of the biomarker. From the perspective of microenvironment, the invention provides a molecular marker for predicting chemosensitivity of colorectal tumor based on an autophagy-TIMP-2 signal axis, and the molecular marker comprises a p-ATG16L / TIMP-2 molecular marker combination or an autophagy characteristic gene set / TIMP-2 molecular marker combination. Meanwhile, the invention also provides a potential optimized treatment scheme for autophagy deficient patients, namely a new treatment strategy of combining with a TIMP-2 up-regulating agent or a TIMP-2 downstream MMP2 / 9 inhibitor and chemotherapy.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and in particular to a biomarker for predicting the chemosensitivity of colorectal cancer and its application. Background Art

[0002] Colorectal cancer (CRC) is one of the common cancers. Chemotherapy regimens based on 5-FU, such as FOLFOX (5-FU + leucovorin + Oxaplatin), are one of the main means for treating patients with advanced metastatic (metastatic CRC, mCRC). However, a considerable number of patients do not respond well to the current first-line chemotherapy regimens. Drug resistance and recurrence are one of the main reasons for the death of patients with advanced colorectal tumors. Therefore, establishing highly efficient and specific predictive markers, screening out potential beneficiaries of chemotherapy, optimizing treatment regimens, and achieving precise diagnosis and treatment are the keys to improving the survival rate of patients.

[0003] Currently, there is a lack of uniformly recognized markers for predicting the efficacy of colorectal cancer chemotherapy in clinical practice. Exploring the key mechanisms determining chemosensitivity from the perspective of the microenvironment is a very popular research direction in the current field of life medicine. Finding suitable biomarkers for predicting the efficacy of chemotherapy can better help screen out potential beneficiaries of chemotherapy, optimize treatment regimens, and thus achieve precise diagnosis and treatment. Summary of the Invention

[0004] The purpose of the present invention is to overcome the deficiencies of the prior art and provide a molecular marker combination p-ATG16L / TIMP-2 or autophagy signature gene set / TIMP-2 for predicting the chemosensitivity of colorectal tumors based on the autophagy-TIMP-2 signaling axis.

[0005] To achieve the above purpose, the technical solution adopted by the present invention is as follows: In a first aspect, the present invention provides a biomarker for predicting the chemosensitivity of colorectal cancer, and the biomarker is the autophagy-TIMP-2 signaling axis; the biomarker includes a marker related to autophagy level and TIMP-2 protein.

[0006] In previous studies of the present invention, it was found that chemotherapy can induce autophagy in in vitro colorectal tumor cell models and in vivo mouse colorectal tumor models. The anti-tumor immunity induced by chemotherapy depends on the autophagy level of tumor cells. Inhibiting autophagy can significantly weaken chemosensitivity in an immunocompetent mouse colorectal tumor model. Further, CyTOF (mass cytometry) was used to analyze the changes in the tumor immune microenvironment under chemotherapy or not, and it was found that inhibiting autophagy can significantly inhibit the anti-tumor immunity induced by chemotherapy, including Ly6C with effector T cell characteristics + CD8 +The reduction of T abundance indicates that autophagy can enhance chemosensitivity by regulating the immune microenvironment.

[0007] Through cytokine array experiments, the present invention found that the secreted protein TIMP-2 upregulated by chemotherapy is the key "link" molecule mediating autophagy regulation of the tumor immune microenvironment. Chemotherapy promotes TIMP-2 expression in an autophagy-dependent manner. TIMP-2 is an endogenous metalloproteinase (MMP) inhibitor that mainly inhibits MMP-2 / -9, while MMP can create an immunosuppressive microenvironment by remodeling the extracellular matrix, inhibiting immune cell infiltration and activation. Further, the present invention analyzed clinical patient samples and found that in clinical samples, the autophagy level (using the average expression level of genes included in the autophagy signature gene set to establish an "autophagy score" as a measure, the higher the autophagy score, the higher the autophagy level) and TIMP-2 expression were also significantly positively correlated, and TIMP-2 was highly expressed in patient samples sensitive to chemotherapy. By multi-color immunofluorescence detecting the expression of the autophagy marker p-ATG16L and TIMP-2 in tumor samples of sensitive and drug-resistant patients, the results showed that the proportion of patients with high p-ATG16L / TIMP-2 expression in the sensitive population was significantly higher than that in the drug-resistant population. In addition, Kaplan-Meier survival analysis also showed that the higher the TIMP-2 expression, the higher the patient survival rate. The above results suggest that the autophagy-TIMP-2 signaling axis can be used as a potential biomarker for predicting chemosensitivity. As a secreted protein, TIMP-2 can be more easily detected by serological tests, which also enhances the accessibility of this signaling axis as a predictive biomarker.

[0008] Preferably, the markers related to the autophagy level include p-ATG16L and / or the autophagy signature gene set.

[0009] In a second aspect, the present invention provides the use of the biomarker for predicting colorectal cancer chemosensitivity in the preparation of a product for screening colorectal cancer patients sensitive to chemotherapy.

[0010] Preferably, the chemosensitivity refers to the sensitivity of colorectal cancer patients to chemotherapeutic drugs; the chemotherapeutic drugs include 5-FU and oxaliplatin.

[0011] In a third aspect, the present invention provides the use of the biomarker for predicting colorectal cancer chemosensitivity in the preparation of a product for predicting colorectal cancer chemosensitivity or prognosis.

[0012] Preferably, the chemosensitivity refers to the sensitivity of colorectal cancer patients to chemotherapeutic drugs; the chemotherapeutic drugs include 5-FU and oxaliplatin.

[0013] Preferably, chemotherapy sensitivity is distinguished according to the Mandard-TRG score: TRG <= 2 is regarded as sensitive, and TRG >= 3 is regarded as drug-resistant.

[0014] Preferably, the product predicts the chemotherapy sensitivity or prognosis of colorectal cancer by detecting the autophagy level and / or the expression level of TIMP-2; the autophagy level and / or the expression level of TIMP-2 are positively correlated with chemotherapy sensitivity / prognosis.

[0015] In a fourth aspect, the present invention provides a product for predicting the chemotherapy sensitivity of colorectal cancer, the product comprising a substance for detecting the autophagy level and / or a substance for detecting the expression level of TIMP-2 protein.

[0016] In a fifth aspect, the present invention provides the use of a substance for upregulating / overexpressing TIMP-2 and / or a substance for targeting and inhibiting MMP2 / 9 in the preparation of a drug for reversing chemotherapy resistance in patients with autophagy deficiency.

[0017] Previous studies have found that approximately 20% of colorectal cancer patients have ATG5 mutations, and abnormal autophagy has also been found to be one of the important causes of colorectal tumorigenesis. Experimental studies on the mouse model of the present invention have shown that knocking out TIMP-2 can simulate the effect of inhibiting autophagy, that is, significantly weakening chemotherapy sensitivity and chemotherapy-induced anti-tumor immunity. Overexpressing TIMP-2 in autophagy-deficient tumor cells can restore chemotherapy sensitivity and depends on chemotherapy-induced anti-tumor immunity. TIMP-2 is an endogenous metalloproteinase (MMP) inhibitor that mainly inhibits MMP-2 / -9, and MMP can create an immunosuppressive microenvironment by remodeling the extracellular matrix, inhibiting immune cell infiltration and activation. Therefore, chemotherapy resistance caused by autophagy deficiency can be reversed by overexpressing the key "messenger" molecule TIMP-2 or targeting downstream MMP-2 / 9.

[0018] Preferably, the substance for upregulating / overexpressing TIMP-2 comprises an overexpression vector, a nucleic acid molecule or a compound.

[0019] Preferably, the substance for targeting and inhibiting MMP2 / 9 comprises a nucleic acid molecule, a small molecule inhibitor or an interfering lentivirus.

[0020] The beneficial effects of the present invention are as follows: In the research of the present invention, it was found by analyzing preclinical mouse models and clinical patient samples that the autophagy-TIMP-2 signal is expected to become a potential biomarker for predicting the chemosensitivity of colorectal tumors. The autophagy-TIMP-2 signaling axis can enhance chemosensitivity by regulating anti-tumor immunity. Drug resistance recurrence is one of the main causes of death in patients with advanced colorectal tumors. As a molecular biomarker for predicting the chemotherapy efficacy of colorectal tumor patients, the autophagy-TIMP-2 signaling axis can help screen out potential beneficiaries of chemotherapy, optimize treatment plans, achieve precise diagnosis and treatment, and improve the survival rate of patients.

[0021] The present invention also provides an optimized treatment plan for patients with autophagy defects. The chemotherapy resistance caused by autophagy defects can be reversed by overexpressing the key "messenger" molecule TIMP-2 or targeting downstream MMP-2 / 9. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 The experimental results show that the 5-FU-based chemotherapy regimen (5-FU / Oxa) induces autophagy in colorectal tumor cells in both in vitro cell models and mouse tumor models; Figure A shows the detection results of the expression of autophagy-related markers p62 and LC3-I / II in autophagy-complete colorectal tumor cell lines (CT-26sgCtrl / RKOshCtrl) and autophagy-deficient colorectal tumor cell lines (CT-26 sgATG5#1,#2 / sgATG7#1,#2; RKO shATG5#1,#2 / sgATG7#1,#2) under 5-FU / Oxa treatment conditions detected by Western blot (WB); Figures B-C show the results of detecting the expression of autophagy markers p62 and p-ATG16L (Ser278) in autophagy-complete / deficient mouse colorectal tumor tissues with or without 5-FU / Oxa treatment by immunofluorescence (IF).

[0023] Figure 2 Figure showing the monitoring results of the changes in tumor volume (A), size (B), and weight (C) of autophagy-complete colorectal tumor cell line (CT-26sgCtrl) and autophagy-deficient colorectal tumor cell line (CT-26 sgATG5) subcutaneously inoculated in immunocompetent mice with or without 5-FU / Oxa treatment.

[0024] Figure 3 Figure showing the monitoring results of the changes in tumor volume (A), size (B), and weight (C) of autophagy-complete colorectal tumor cell line (CT-26sgCtrl) and autophagy-deficient colorectal tumor cell line (CT-26 sgATG7) subcutaneously inoculated in immunocompetent mice with or without 5-FU / Oxa treatment.

[0025] Figure 4 Results of CyTOF analysis of the changes in the immune microenvironment of colorectal tumors in autophagy-complete or -deficient mice with or without 5-FU / Oxa treatment; Panel A shows the results of t-SINE dimensionality reduction clustering analysis of the infiltration of different immune cells in tumor tissues; The treatment groups were autophagy-complete + solvent-treated control group (sgCtrl+Vehicle), autophagy-complete + 5-FU / Oxa treatment group (sgCtrl+5-FU / Oxa), autophagy-deficient + solvent-treated control group (sgATG5+Vehicle), and autophagy-deficient + 5-FU / Oxa treatment group (sgATG5+5-FU / Oxa), a total of four groups of samples; Panel B shows the statistical bar graph of the infiltration ratios of different immune cell subsets in the tumor tissues of the above four treatment groups.

[0026] Figure 5 Results of detecting the changes in the immune microenvironment of colorectal tumors in autophagy-complete or -deficient mice with or without 5-FU / Oxa treatment using flow cytometry and multi-color immunofluorescence techniques under different treatment conditions; Panel A shows the statistical graph of the proportion change of total infiltrating CD8 + T cells; Panels B-C show the statistical graphs of the proportion change of activated CD8 + T cells.

[0027] Figure 6 Results of cytokine chip analysis and ELISA detection; Panel A shows the result graph of cytokine array analysis; Panel B shows the result graph of the secretion change of TIMP-2 detected by enzyme-linked immunosorbent assay (ELISA) in human autophagy-normal (RKOshCtrl) / autophagy-deficient cell lines (RKO shATG5) after chemotherapy treatment; Panel C shows the result graph of the secretion change of TIMP-2 detected by enzyme-linked immunosorbent assay (ELISA) in mouse autophagy-normal (CT-26sgCtrl) / autophagy-deficient cell lines (CT-26sgAtg5) after chemotherapy treatment.

[0028] Figure 7 Results of the experiment on knocking out TIMP-2 to inhibit the sensitivity of mouse colorectal tumor models to chemotherapy; Panel A shows the result graph of WB detection of the TIMP-2 knockout effect; Panels B-D show the result graphs of monitoring the changes of mouse tumors by simulating a clinical 5-FU-based chemotherapy regimen using 5-FU combined with oxaliplatin (Oxa) to treat immunocompetent mouse colorectal tumor models (B - tumor volume change, C - tumor size change, D - tumor weight change); Panel E shows the result graph of FACS detection of CD8 + T cell abundance; Panel F shows the result graph of FACS detection of activated CD8 + T (Ly6C + CD8 +Result graph of T cell abundance.

[0029] Figure 8 It is the result graph showing that the autophagy-TIMP-2 signaling axis has a significant positive correlation with the chemosensitivity of clinical colorectal tumor patients; Figure A is the result graph showing a significant positive correlation between autophagy level and TIMP-2 expression clinically; Figures B-C are the analysis results of autophagy level and TIMP-2 expression in samples of chemosensitive and chemoresistant colorectal tumor patients; Figure D is the analysis result of the relationship between TIMP-2 level and patient survival.

[0030] Figure 9 It is the result graph of overexpressing normal TIMP-2 (TIMP-2WT, i.e., TIMP-2 Wildtype) and mutants TIMP-2 Ala+ mt and TIMP-2-C that lose the MMP-2 / 9 inhibitory function in autophagy-deficient mouse colorectal tumor cells CT-26 sgAtg5 cells, and detecting their overexpression levels by WB and qRT-PCR. EV represents Empty Vector, i.e., the empty vector control group.

[0031] Figure 10 It is the result graph of monitoring the changes in tumor volume (A), size (B), and weight (C) of five groups of mouse colorectal tumor models of autophagy-competent (sgCtrl), autophagy-deficient (sgATG5), and overexpressing wild-type TIMP-2 (sgATG5+TIMP-2 WT) and TIMP-2 mutants lacking MMP-2 / 9 inhibitory function (sgATG5+TIMP-2 Ala+ mt / TIMP-2-C) under 5-FU / Oxa treatment conditions.

[0032] Figure 11 It is for detecting the total CD8 [[ID=I7]] + T cells (A) and activated CD8 + T (B) ratio changes in the tumor tissues of five groups of mice by flow cytometry.

[0033] Figure 12 It is the result graph showing that the small molecule inhibitor SB-3CT targeting MMP-2 / 9 can significantly restore the chemosensitivity of autophagy-deficient mouse colorectal tumor models; Figures A-C are the result graphs of monitoring tumor changes in autophagy-competent and autophagy-deficient mouse models under 5-FU / Oxa or 5-FU / Oxa combined with SB-3CT treatment conditions (A - tumor volume change, B - tumor size change, C - tumor weight change); Figures D-E are for detecting the ratio changes of total CD8 + T cells and activated CD8 + T cells in the tumor tissues of three groups of mice by flow cytometry. Detailed implementation methods

[0034] To better illustrate the objectives, technical solutions, and advantages of the present invention, the present invention will be further described below in conjunction with specific embodiments.

[0035] Example 1: Chemotherapy-induced autophagy in colorectal cancer tumor cells 1. Simulate a clinical 5-FU-based chemotherapy regimen, and use 5-FU combined with oxaliplatin (Oxa) to treat mouse autophagy-normal cell lines (CT-26sgCtrl), human autophagy-normal cell lines (RKOshCtrl), mouse autophagy-deficient cell lines (CT-26 sgAtg5 / sgAtg7), and human autophagy-deficient cell lines (RKO shATG5 / sgATG7), respectively.

[0036] The autophagy-deficient cell lines were constructed by sgRNA / shRNA, and #1 represents two independent sgRNA / shRNAs; the specific sequence information is as follows: sgAtg5#1(mice): 5’-AGTGAAAAAGCACTTTCAGA-3’; sgAtg5#2(mice): 5’-AACGTCAAATAGCTGACTCT-3’; shATG5#1(human): 5’- CCTTTCATTCAGAAGCTGTTT-3’; shATG5#2(human): 5’- CCTGAACAGAATCATCCTTAA-3’; sgAtg7#1(mice): 5’-GAAACTTGTTGAGGAGCAT-3’; sgAtg7#2(mice): 5’-ACGTCCAGGGCACTATTAAA-3’; sgATG7#1(human): 5’-GCGGCAGCTACGGGGGATCC-3’; sgATG7#2(human): 5’-GCCAGCTCGCTTAACAT-3’.

[0037] RKO cells were treated with 100 µM 5-FU combined with 2.5 µM Oxa for 24 h, and CT-26 cells were treated with 10 µM 5-FU combined with 0.25 µM Oxa for 24 h. The changes in autophagy-related markers p62 and LC3-I / II were detected by Western blot (WB), and the results are as follows Figure 1As shown in A. Under the treatment conditions of 5-FU / Oxa, the decrease in p62 expression and the increase in the conversion of LC3-I to LC3-II indicate enhanced autophagy. Knockdown of the core autophagy regulatory proteins ATG5 / ATG7 can significantly inhibit chemotherapy-induced autophagy, suggesting the successful establishment of autophagy-deficient cell lines.

[0038] 2. A subcutaneous colorectal tumor model was established using 6-8-week-old female BALB / c mice (injected subcutaneously with 2×10 6 cells / mouse), and when the tumor size reached 100 mm 3 , a mouse colorectal tumor model was treated with 5-FU combined with Oxa to simulate a clinical 5-FU-based chemotherapy regimen (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal injection, three times a week). The changes in the autophagy marker p62 in the mouse tumor tissue were detected by immunofluorescence (IF), and the results are shown in Figure 1 B. The changes in the autophagy marker p-ATG16L1 (Ser278) in the mouse tumor tissue were detected by immunofluorescence (IF), and the results are shown in Figure 1 C. The decrease in p62 and the increase in the expression of p-ATG16L (Ser278) both indicate enhanced autophagy.

[0039] The above results indicate that chemotherapy can induce autophagy in colorectal tumor cells in in vitro and in vivo colorectal tumor models.

[0040] Example 2: Blocking autophagy inhibits the sensitivity of immunocompetent mouse colorectal tumor models to chemotherapy To explore the regulatory function of autophagy in tumor cells during chemotherapy, a subcutaneous colorectal tumor model was established using 6-8-week-old immunocompetent female BALB / c mice. According to 2×10 6 / mouse, colorectal tumor cells from autophagy-complete (CT-26 sgCtrl) or autophagy-deficient (CT-26 sgAtg5 / sgAtg7) mice were injected subcutaneously into mice, with 6 mice in each group, and the tumor volume was measured every 3 days. When the tumor volume reached approximately 100 mm 3 , a mouse colorectal tumor model was treated with 5-FU combined with Oxa to simulate a clinical 5-FU-based chemotherapy regimen (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal injection, three times a week), and the changes in the tumor volume and weight of the mice were monitored.

[0041] In the autophagy-complete or mouse colorectal tumor model with autophagy inhibited by knocking out Atg5, the changes in tumor volume, size, and weight under the treatment conditions of 5-FU combined with Oxa are shown in Figure 2As shown; in a mouse colorectal tumor model with complete autophagy or inhibited autophagy by knocking out Atg7, under the treatment condition of 5-FU combined with Oxa, the changes in tumor volume, size and weight were as Figure 3 shown.

[0042] The results showed that in immunocompetent mice, inhibiting autophagy significantly weakened chemosensitivity, suggesting that autophagy in tumor cells may affect chemosensitivity by regulating the immune microenvironment.

[0043] Example 3: Blocking autophagy inhibits anti-tumor immunity induced by chemotherapy Mass cytometry (CyTOF) and flow cytometry (FACS) were used to detect the changes in the tumor immune microenvironment under chemotherapy conditions and the regulatory function of autophagy in this process.

[0044] Six- to eight-week-old female BALB / c immunocompetent mice were used to establish subcutaneous colorectal tumor models by inoculating colorectal tumor cells with complete autophagy (CT-26sgCtrl) or autophagy-deficient (CT-26 sgAtg5) (subcutaneous injection of 2×10 6 cells / mouse). When the tumor size reached 100 mm 3 , a mouse colorectal tumor model was treated with 5-FU combined with Oxa to simulate a clinical 5-FU-based chemotherapy regimen (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal injection, three times a week). After two weeks of treatment, tumor samples were collected for CyTOF analysis and flow cytometry detection. The results were as Figure 4 、 5 shown.

[0045] The results showed that anti-tumor immunity induced by chemotherapy depended on autophagy in tumor cells. Chemotherapy could activate anti-tumor immunity, manifested as a significant increase in the total CD8 + T cells and activated CD8 + T cell ratios in tumor tissues; while inhibiting autophagy could significantly weaken anti-tumor immunity induced by chemotherapy and significantly reduce the total CD8 + T cells and activated CD8 + T (Ly6C + CD8 + T and GZMB + CD8 + T cell) ratios in tumor tissues.

[0046] Example 4: Blocking autophagy inhibits the secretion of the cytokine TIMP-2 upregulated by chemotherapy This example is a study on the key "link" molecules that regulate the immune microenvironment through autophagy in tumor cells. The changes in cytokines secreted by autophagy-normal and autophagy-deficient tumor cells under chemotherapy conditions were detected using a Cytokine array and ELISA.

[0047] Methods: The control group of human / mouse colorectal tumor cells RKO (shCtrl) / CT-26 sgCtrl and autophagy-deficient RKO (shATG5, knocking down the autophagy core regulatory protein ATG5 to inhibit autophagy) / CT-26 sgAtg5 were treated with chemotherapy for 48 h, and the cell culture supernatants were collected for cytokine array analysis and ELISA detection.

[0048] Experimental procedure: 1. Simulating the clinical 5-FU-based chemotherapy regimen, 5-FU combined with oxaliplatin (Oxa) was used to treat human autophagy-normal (RKO shCtrl) and autophagy-deficient cell lines (RKO shATG5). After treatment with 100 µM 5-FU combined with 2.5 µM Oxa for 48 h, the supernatants were collected for cytokine array analysis (Cytokine array). The results are shown in Figure 6 A as shown. Cytokine array analysis experiments showed that 5-FU / Oxa promoted the secretion of TIMP-2, and after knocking down ATG5 to inhibit autophagy, the secretion of TIMP-2 was significantly inhibited.

[0049] 2. Simulating the clinical 5-FU-based chemotherapy regimen, 5-FU combined with oxaliplatin (Oxa) was used to treat human and mouse autophagy-normal (RKO shCtrl / CT-26 sgCtrl) and autophagy-deficient cell lines (RKO shATG5 / CT-26 sgAtg5). RKO cells were treated with 100 µM 5-FU combined with 2.5 µM Oxa for 48 h, and CT-26 cells were treated with 10 µM 5-FU combined with 0.25 µM Oxa for 48 h. The cell culture supernatants were collected, and the changes in the secretion of TIMP-2 were detected by enzyme-linked immunosorbent assay (ELISA). The results are shown in Figure 6 B-C as shown.

[0050] The above results indicate that the upregulation of TIMP-2 induced by chemotherapy depends on tumor cell autophagy. Chemotherapy can promote the secretion of TIMP-2, and inhibiting autophagy significantly inhibits the secretion of TIMP-2.

[0051] Example 5: TIMP-2 is a key effector molecule that regulates chemotherapy sensitivity. Knocking out TIMP-2 inhibits the sensitivity of mouse colorectal tumor models to chemotherapy. To investigate the function of the secreted protein TIMP-2 in chemotherapy response and regulation of anti-tumor immunity. In this example, a murine colorectal tumor cell line with TIMP-2 knockout (CT-26-sgTimp-2) was established based on the CRISPR / Cas9 gene editing system. The sgRNA sequence targeting the TIMP-2 gene locus was sgTIMP-2: 5’-CGCCTGTTGCGGGTGCACCG-3’. The knockout effect was detected by WB, and the results are shown as Figure 7 shown in A of

[0052] A subcutaneous colorectal tumor model was established in immunocompetent mice using control cells CT-26-sgCtrl and CT-26-sgTIMP-2 (2×10 6 cells / mouse). When the tumor size reached 100 mm 3 , a murine colorectal tumor model was treated with 5-FU combined with Oxa to simulate the clinical 5-FU-based chemotherapy regimen (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal injection, three times a week) for two weeks. The changes in tumor volume and weight of the mice were monitored, and the results are shown as Figure 7 shown in B-D of + Meanwhile, the total CD8 + T cells and the abundance of activated CD8 + T (Ly6C + CD8 Figure 7 T) cells were detected by FACS, and the results are shown as

[0053] The results showed that knockout of TIMP-2 could significantly inhibit chemotherapy sensitivity and chemotherapy-induced anti-tumor immunity, including a significant decrease in the abundance of total CD8 + T cells and effector T cells in the tumor. The above results suggest that the secreted protein TIMP-2 is a key downstream "link" molecule for autophagy-mediated colorectal tumor chemotherapy sensitivity. Knockdown of TIMP-2 significantly inhibits the sensitivity of the murine colorectal tumor model to chemotherapy, and at the same time, the proportion of total CD8 + T cells and activated CD8 + T in the tumor tissue decreases significantly.

[0054] Example 6: The autophagy-TIMP-2 signaling axis is significantly positively correlated with the chemotherapy response of clinical colorectal cancer patients To evaluate the feasibility of the autophagy-TIMP-2 signaling axis as a potential biomarker for predicting the efficacy of chemotherapy in patients with colorectal tumors, this example analyzed the correlation between autophagy levels and TIMP-2 expression in a clinical sample database. Meanwhile, clinical samples were collected to further verify the correlation between the autophagy-TIMP-2 signaling axis and chemotherapy sensitivity.

[0055] 1. Analyze the correlation between autophagy levels and TIMP-2 expression in different clinical sample databases The autophagy level was evaluated using the autophagy score (the mean expression of genes included in the GOBP_POSITIVE_REGULATION_OF_AUTOPHAGY dataset was used as the autophagy score, reference: 2021.Cell, Colorectal Cancer Cells Enter a Diapause-like DTP State to Survive Chemotherapy). The higher the autophagy score, the higher the autophagy level. The external validation cohorts used were from TCGA_COADREAD (431 samples), GSE69657 (samples collected after FOLFOX treatment, including 17 drug-resistant and 13 sensitive cases, a total of 30 tumor tissue samples), and GSE45404 (samples collected before FOLFOX treatment, including 10 drug-resistant and 12 sensitive cases, a total of 22 tumor tissue samples). The results are as Figure 8 shown in A. There was a significant positive correlation between autophagy levels and TIMP-2 expression in clinical samples.

[0056] The comparison results of TIMP-2 expression levels in the chemotherapy-resistant (Resistant) and sensitive (Sensitive) groups are as Figure 8 shown in B. The results showed that there was a significant positive correlation between TIMP-2 expression and chemotherapy sensitivity, and TIMP-2 expression was high in samples from sensitive patients (published databases GSE12246, samples before FOLFOX treatment; GSE69657, samples after FOLFOX treatment).

[0057] 2. Verify the correlation between the autophagy-TIMP-2 signaling axis and chemotherapy sensitivity To verify the correlation between the autophagy-TIMP-2 signaling axis and chemotherapy sensitivity, in this example, samples after colorectal tumor treatment from the Sixth Affiliated Hospital of Sun Yat-sen University were collected as a validation set. (Among them, sensitive (Responder) and drug-resistant (Non-Responder) were divided according to the TRG score. TRG = 2 was the sensitive group, and TRG = 3 was the drug-resistant group. There were 20 drug-resistant cases and 20 sensitive cases, totaling 40 tumor tissue samples) for analysis. The treatment regimen was FOLFOX. The sensitivity evaluation criterion was the Mandard-TRG score: The TRG score could be divided into 0 - 4. The smaller the value, the more residual tumor cells, and the worse the sensitivity. According to the reported literature, TRG <= 2 could be defined as sensitive, and TRG >= 3 could be defined as drug-resistant. Due to sample accessibility limitations, in this example, samples with TRG = 2 and TRG = 3 were collected to represent sensitive and drug-resistant populations respectively; TRG = 2 was regarded as the sensitive population, and TRG = 3 was regarded as the drug-resistant population. The definitions of sensitive and drug-resistant in the cohort collected in this invention were evaluated according to the published literature: Ref: Pharmacological modulation of RB1 activity mitigates resistance to neoadjuvant chemotherapy in locally advanced rectal cancer. 2024, PNAS. The DFS of TRG3 was significantly shorter compared with TRG1 and 2. Therefore, TRG = 3 was defined as Non-Responder, and TRG = 2 was defined as Responder. The expression level of p-ATG16L1 (Ser278) was used as a marker to evaluate the autophagy level. The higher the expression level of p-ATG16L1, the higher the autophagy level. The autophagy marker (p-ATG16L, the higher its expression indicates the higher the autophagy level) and TIMP-2 expression in clinical samples were detected by immunofluorescence. The high and low expression levels of p-ATG16L1 and TIMP-2 were distinguished according to the average expression of all samples.

[0058] The results are as Figure 8 shown in C. The proportion of high expression of p-ATG6L1 / high expression of TIMP-2 in chemotherapy-sensitive patients was significantly higher than that in insensitive patients, further confirming that the autophagy-TIMP-2 signaling axis (p-ATG6L1 / TIMP-2) was significantly positively correlated with chemotherapy sensitivity.

[0059] 3. This example also used the data of the published clinical sample database to draw a Kaplan Meier curve and established the correlation between TIMP-2 and the survival prognosis of patients (where there were 91 samples in GSE143985 and 77 samples in GSE24550, a total of 168 samples in the two datasets, all detecting RNA expression, and the cut-off was selected as the optimal cut-off option provided by the Kaplan-Meier plotter website, with the specific value being 2.19483. According to this value, the number of samples with high TIMP-2 was 106, and the number of samples with low TIMP-2 was 62). The results are as Figure 8 shown in D of Figure 8 . The higher TIMP-2 is, the higher the five-year survival rate (DFS) of patients.

[0060] The above results indicate that the autophagy-TIMP-2 signaling axis shows significant clinical correlation. The autophagy level is significantly positively correlated with TIMP-2 expression. At the same time, autophagy / TIMP-2 is significantly positively correlated with chemosensitivity and also positively correlated with the patient survival rate.

[0061] Example 7: TIMP-2 restores the chemosensitivity of the colorectal tumor model of autophagy-deficient mice by inhibiting the activities of MMP-2 / 9 To evaluate whether TIMP-2 enhances the chemosensitivity of autophagy-deficient colorectal tumors by targeting MMP-2 / 9. In this example, mouse colorectal tumor cell lines overexpressing the full length of TIMP-2 and loss-of-function mutants (loss of MMP-2 / 9 inhibitory function) were established using an autophagy-deficient colorectal tumor cell line (CT-26 sgATG5), namely CT-26-sgATG5+TIMP-2 WT (overexpressing the full length of TIMP-2), CT-26-sgATG5+ TIMP-2Ala+mt (alanine mutant of TIMP-2, loss of MMP-2 / 9 inhibitory function), CT-26-sgATG5+ TIMP-2-C (deletion mutant of the first 1-126 amino acids at the N-terminus of TIMP-2, loss of MMP-2 / 9 inhibitory function) cell lines, and a control empty vector EV was set.

[0062] The specific experimental method is as follows: 1. The target fragments were amplified by PCR, and the primers used included: Forward primer for TIMP-2Ala+mt (alanine mutant of TIMP-2, loss of MMP-2 / 9 inhibitory function): 5’-GAAGCTTGCAGCTGCTCCCCGGTGC-3’; Forward primer for TIMP-2-C (a deletion mutant lacking amino acids 1-126 at the N-terminus of TIMP-2, with loss of MMP-2 / 9 inhibitory function): 5’- GAGTGCAAGATCACTCGCTGTC -3’; Reverse primer for TIMP-2Ala+mt and TIMP-2-C (shared by the two mutants): 5’-GGCGTCGGCCGGGCGCAGCAGCGTG-3’.

[0063] 2. After digestion and ligation, the target fragment was ligated into the overexpression viral vector Plenti-CRISPR-V2 to construct a vector overexpressing the corresponding target protein. After verification by sequencing, 2 μg of TIMP-2 OE plasmid, 2 μg of pREV, 2 μg of pGag / Pol, and 1 μg of pVSVG were transfected into HEK 293T cells using Lipofectamine2000 reagent. At 48 h post-transfection, the medium containing lentiviral particles was aspirated, centrifuged at 1000 g for 5 min to discard cell debris, and the viral solution was collected to infect the autophagy-deficient mouse cell line (CT-26sgAtg5). After 72 h, screening was performed using the product Blastidicin (10 mg / mL) encoded by the resistance gene carried by the vector. One week later, the cells were collected and the successful expression of the target protein was verified by WB and quantitative real-time PCR (qRT-PCR). The results are as Figure 9 shown.

[0064] A mouse subcutaneous colorectal tumor model was constructed using 6-8-week-old immunocompetent BALB / c mice. The mouse colorectal tumor cell lines overexpressing TIMP-2 and TIMP-2 functional mutants prepared above were subcutaneously inoculated into the mice (2×10 6 cells / mouse). When the tumor size reached 100 mm 3 , a 5-FU+Oxa chemotherapy regimen based on 5-FU in clinical practice was simulated (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, intraperitoneal injection, three times a week). After two weeks of administration, tumor growth, volume, and weight changes were monitored. The results are as Figure 10 shown. Flow cytometry (FACS) was used to detect changes in the immune microenvironment, including changes in the abundance of total CD8 + T cells and activated CD8 + T. The results are as Figure 11 shown.

[0065] The results showed that overexpression of wild-type full-length TIMP-2 could significantly restore the chemosensitivity of autophagy-deficient colorectal tumors, while overexpression of the TIMP-2 loss-of-function mutant (deficient in MMP-2 / 9 inhibitory function) could not restore chemosensitivity, suggesting that TIMP-2 enhances chemosensitivity by inhibiting MMP-2 / 9.

[0066] Example 8: The small molecule inhibitor SB-3CT targeting MMP-2 / 9 could significantly restore the chemosensitivity of autophagy-deficient colorectal tumors A mouse subcutaneous colorectal tumor model was established by inoculating autophagy-complete (CT-26sgCtrl) or autophagy-deficient (CT-26 sgAtg5) mouse colorectal tumor cells into 6-8-week-old immunocompetent BALB / c mice. When the tumor size reached 100 mm 3 , a clinical 5-FU-based chemotherapy regimen was simulated, and the mouse colorectal tumor model was treated with 5-FU + Oxa or 5-FU + Oxa combined with the MMP-2 / 9 inhibitor (SB-3CT) (dosage: 25 mg / kg 5-FU, 2.5 mg / kg Oxa, 20 mg / kg SB-3CT, intraperitoneal administration, three times a week). After two weeks of administration, tumor growth, volume and weight changes were monitored. The results are shown in Figure 12 A-C. Flow cytometry (FACS) was used to detect changes in the immune microenvironment of tumor tissues in the three groups of mice, including the total CD8 + T cells and the abundance changes of activated CD8 + T. The results are shown in Figure 12 D-E.

[0067] In this example, the small molecule inhibitor SB-3CT was used to target MMP-2 / 9. The results showed that targeting MMP-2 / 9 with the small molecule inhibitor SB-3CT could exert a function similar to that of TIMP-2 overexpression, that is, restore the chemosensitivity of autophagy-deficient colorectal tumors to chemotherapy.

[0068] Collectively, the above results indicate that overexpression of TIMP-2 or targeting its downstream MMP-2 / 9 can restore the chemosensitivity of autophagy-deficient mouse colorectal tumor models to chemotherapy and chemotherapy-induced anti-tumor immunity.

[0069] Finally, it should be noted that the above examples are only used to illustrate the technical solutions of the present invention and not to limit the protection scope of the present invention. Although the present invention has been described in detail with reference to the preferred embodiments, those of ordinary skill in the art should understand that the technical solutions of the present invention can be modified or equivalently replaced without departing from the essence and scope of the technical solutions of the present invention.

Claims

1. A biomarker for predicting the sensitivity of colorectal cancer to chemotherapy, characterized in that, The biomarker is the autophagy-TIMP-2 signaling axis; the biomarker includes a biomarker related to autophagy level and TIMP-2 protein.

2. The biomarker for predicting the chemosensitivity of colorectal cancer according to claim 1, wherein The biomarker related to autophagy level includes p-ATG16L and / or an autophagy signature gene set.

3. Use of the biomarker for predicting chemosensitivity of colorectal cancer according to any one of claims 1-2 in the preparation of a product for screening populations sensitive to chemotherapy for colorectal cancer.

4. The application according to claim 3, characterized in that The chemosensitivity refers to the sensitivity of colorectal cancer patients to chemotherapeutic drugs, and the chemotherapeutic drugs include 5-FU and oxaliplatin.

5. Use of the biomarker for predicting chemosensitivity of colorectal cancer according to any one of claims 1-2 in the preparation of a product for predicting chemosensitivity or prognosis of colorectal cancer chemotherapy.

6. The application according to claim 5, characterized in that, The chemosensitivity refers to the sensitivity of colorectal cancer patients to chemotherapeutic drugs, and the chemotherapeutic drugs include 5-FU and oxaliplatin.

7. A product for predicting the sensitivity of colorectal cancer to chemotherapy, characterized in that, The product includes a substance for detecting autophagy level and / or a substance for detecting the expression level of TIMP-2 protein.

8. Use of a substance for upregulating / overexpressing TIMP-2 and / or a substance for targeting and inhibiting MMP2 / 9 in the preparation of a drug for reversing chemoresistance in patients with autophagy deficiency.

9. The application according to claim 8, characterized in that, The substance for upregulating / overexpressing TIMP-2 includes an overexpression vector, a nucleic acid molecule or a compound.

10. The application according to claim 8, characterized in that, The substance for targeting and inhibiting MMP2 / 9 includes a nucleic acid molecule, a small molecule inhibitor or an interfering lentivirus.

Citation Information

Patent Citations

  • Technology for regulating and controlling Jak-Stat pathway to differentiate, dedifferentiate and rejuvenate cells, and application of technology

    CN110423719A