Glucoside hydrolase with anti-biofilm activity and application thereof
By using PgaBAb1 and PgaBKp proteins as glycoside hydrolase, the biofilm is destroyed and inhibited, and the bacterial resistance problem is solved, thereby improving the sensitivity to antibiotics and effective treatment of biofilms is achieved.
Patent Information
- Application Number
- CN202510545870.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-04-28
- Publication Date
- 2025-08-08
AI Technical Summary
The prior art is difficult to effectively destroy and inhibit the formation of biofilms, resulting in increased resistance to antibiotics by bacteria and causing refractory infection.
PgaBAb1 and PgaBKp proteins are used as glycoside hydrolase to improve bacterial sensitivity to antibiotics by destroying biofilms and inhibiting their formation.
PgaBAb1 and PgaBKp proteins can significantly destroy mature Staphylococcus epidermis biofilms, inhibit their formation, and increase their sensitivity to methicillin, providing an effective means of treating bacterial infections associated with biofilm.
Smart Images

Figure HDA0005380726850000011 
Figure HDA0005380726850000021 
Figure HDA0005380726850000031
Abstract
Description
Technical Field
[0001] The invention belongs to the field of medical biotechnology, and particularly relates to glycoside hydrolase with anti-biofilm activity and application thereof. Background Art
[0002] Pathogenic bacteria have a variety of drug resistance mechanisms, among which the formation of biofilms can enable bacterial cells to resist the invasion of conventional antibiotics, thereby leading to stubborn infections (Ramage G., Kean R., Rautemaa-Richardson R., Williams C., Lopez-Ribot JL. Fungal biofilms in human health and disease. Nat Rev Microbiol 2025. Doi: 10.1038 / s41579-025-01147-0. Flemming HC., van Hullebusch ED., Little BJ., Neu TR., Nielsen PH., Seviour T., et al. Microbial extracellular polymeric substances in the environment, technology and medicine. Nat Rev Microbiol 2025; 23(2): 87–105. Doi: 10.1038 / s41579-024-01098-y.). Biofilms are composed of bacterial cells and extracellular polymeric substances (EPS) wrapped around the cells, which are composed of eDNA, proteins and exopolysaccharides (Flemming HC., van Hullebusch ED., Neu TR., Nielsen PH., Seviour T., Stoodley P., et al. The biofilm matrix: multitasking in a shared space. Nat Rev Microbiol 2023; 21(2):70–86. Doi:10.1038 / s41579-022-00791-0. Sauer K., Stoodley P., Goeres DM., Hall-Stoodley L., M., Stewart PS., et al. The biofilm life cycle: expanding the conceptual model of biofilm formation. Nat Rev Microbiol 2022; 20(10): 608–20. Doi: 10.1038 / s41579-022-00767-0.). The complex structure of biofilms can form an insurmountable barrier, thereby reducing the permeability of antibiotics. Compared with planktonic bacteria, the resistance of bacteria in biofilms is increased by 1000 times (Hall CW., Mah TF. Molecular mechanisms of biofilm-based antibiotic resistance and tolerance inpathogenic bacteria. FEMS Microbiol Rev 2017; 41(3): 276–301. Doi: 10.1093 / femsre / fux010.). Biofilm-induced drug resistance and related chronic infections have caused serious medical and health problems, and effective anti-biofilm therapies are urgently needed.
[0003] A variety of effective biofilm dispersion methods have been developed, including antimicrobial peptides, bacteriophages, photodynamic therapy, and enzymes (Lin Y., Zhou X., Li Y. Strategies for Streptococcus mutans biofilm dispersal through extracellular polymeric substances disruption. Mol Oral Microbiol 2022; 37(1): 1–8. Doi: 10.1111 / omi.12355.). Due to the great advantages of enzymes in substrate specificity and safety, enzymatic biofilm dispersion has become a novel and promising biofilm therapy (Akbarian M., Chen SH., Kianpour M., Farjadian F., Tayebi L., Uversky VN. A review on biofilms and the currently available antibiofilm approaches: Matrix-destabilizing hydrolases and anti-bacterial peptides as promising candidates for the food industries. Int J Biol Macromol 2022; 219(September): 1163–79. Doi: 10.1016 / j.ijbiomac.2022.08.192. Mnif S., Jardak M., Yaich A., Aifa S. Enzyme-based strategy to eradicate monospecies Macrococcus caseolyticus biofilm contamination in dairy industries. Int Dairy J Currently, anti-biofilm research primarily involves three enzyme types: nucleases, proteases, and glycoside hydrolases. These enzymes can target different EPS components. For example, nucleases can effectively degrade eDNA in biofilms, proteases have been shown to disperse biofilms by degrading proteins, and glycoside hydrolases are also active against exopolysaccharides in biofilms or peptidoglycans in bacteria. Summary of the Invention
[0004] The purpose of the present invention is to provide proteins that resist biofilm and / or increase the sensitivity of bacteria, especially drug-resistant pathogenic bacteria, to antibiotics, so as to treat diseases caused by biofilm-producing bacteria and / or drug-resistant bacteria (such as Staphylococcus epidermidis).
[0005] The present invention first protects the PgaB protein, which can be PgaB Ab1 PgaB Kp protein.
[0006] The PgaB Ab1 The protein may be a1) or a2) or a3) or a4) or a5) as follows:
[0007] a1) the amino acid sequence of the protein represented by SEQ ID NO: 5 from positions 21 to 658 from the N-terminus;
[0008] a2) the amino acid sequence is the protein shown in SEQ ID NO: 5;
[0009] a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in a1) or a2);
[0010] a4) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein of a1) or a2) or a3) and having anti-biofilm activity and / or increasing the sensitivity of bacteria to antibiotics;
[0011] a5) A protein having 80% or more homology with the amino acid sequence defined in a1) or a2) or a3) and having anti-biofilm activity and / or capable of increasing the sensitivity of bacteria to antibiotics.
[0012] The PgaB Kp The protein may be b1) or b2) or b3) or b4) or b5) as follows:
[0013] b1) the amino acid sequence of the protein represented by SEQ ID NO: 6 from positions 21 to 668 from the N-terminus;
[0014] b2) the amino acid sequence is the protein shown in SEQ ID NO: 6;
[0015] b3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in b1) or b2);
[0016] b4) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in b1) or b2) or b3) and having anti-biofilm activity and / or increasing the sensitivity of bacteria to antibiotics;
[0017] b5) A protein having 80% or more homology with the amino acid sequence defined in b1) or b2) or b3) and having anti-biofilm activity and / or capable of increasing the sensitivity of bacteria to antibiotics.
[0018] In the above-mentioned PgaB protein, the antibiotic may be methicillin.
[0019] In the above-mentioned PgaB protein, the anti-biofilm activity is manifested as destroying bacterial biofilm and / or inhibiting bacterial biofilm formation.
[0020] Any of the above-mentioned bacteria may be drug-resistant pathogenic bacteria.
[0021] To facilitate purification of the PgaB protein, a tag as shown in Table 1 can be attached to the amino terminus or carboxyl terminus of the protein shown in SEQ ID NO: 5 or SEQ ID NO: 6.
[0022] Table 1. Sequences of tags
[0023] Label residue sequence Poly-Arg 5-6 (usually 5) RRRRR FLAG 8 DYKDDDDK Strep-tag II 8 WSHPQFEK c-myc 10 EQKLISEEDL
[0024] The substitution and / or deletion and / or addition of one or several amino acid residues is a substitution and / or deletion and / or addition of no more than 10 amino acid residues.
[0025] The PgaB protein can be artificially synthesized, or its encoding gene can be synthesized first and then biologically expressed.
[0026] The gene encoding the PgaB protein can be obtained by deleting one or several codons for amino acid residues from the DNA sequence shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3 or SEQ ID NO: 4, and / or performing missense mutations of one or several base pairs, and / or attaching the coding sequence of the tag shown in Table 1 to its 5′ end and / or 3′ end.
[0027] The present invention also protects the nucleic acid molecule encoding any of the above-mentioned PgaB proteins.
[0028] Any of the above-mentioned encoding PgaB Ab1 The nucleic acid molecule of the protein may be a DNA molecule as shown in A1), A2), A3), A4), or A5):
[0029] A1) The coding region is a DNA molecule represented by SEQ ID NO: 1;
[0030] A2) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 1;
[0031] A3) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 3;
[0032] A4) has 75% or more homology with the nucleotide sequence defined in A1) or A2) or A3) and encodes any of the above-mentioned PgaB Ab1 DNA molecules of proteins;
[0033] A5) hybridizes with the nucleotide sequence defined in A1) or A2) or A3) under stringent conditions and encodes any of the above-mentioned PgaB Ab1 Protein DNA molecules.
[0034] Any of the above-mentioned encoding PgaB Kp The nucleic acid molecule of the protein may be a DNA molecule as shown in B1) or B2) or B3) or B4) or B5):
[0035] B1) The coding region is a DNA molecule represented by SEQ ID NO: 2;
[0036] B2) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 2;
[0037] B3) a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 4;
[0038] B4) has 75% or more homology with the nucleotide sequence defined in B1) or B2) or B3) and encodes any of the above-mentioned PgaB Kp DNA molecules of proteins;
[0039] B5) hybridizes under stringent conditions with the nucleotide sequence defined in B1) or B2) or B3) and encodes any of the above-mentioned PgaB Kp Protein DNA molecules.
[0040] The nucleic acid molecule may be DNA, such as cDNA, genomic DNA or recombinant DNA; the nucleic acid molecule may also be RNA, such as mRNA or hnRNA.
[0041] Those skilled in the art can readily mutate the nucleotide sequence encoding the PgaB protein of the present invention using known methods, such as directed evolution and point mutagenesis. Artificially modified nucleotide sequences that share 75% or greater identity with the nucleotide sequence of the isolated PgaB protein of the present invention are derived from and are equivalent to the nucleotide sequence of the present invention, as long as they encode the PgaB protein.
[0042] As used herein, the term "identity" refers to sequence similarity to a naturally occurring nucleic acid sequence. "Identity" includes nucleotide sequences that are 75% or greater, or 80% or greater, or 85% or greater, or 90% or greater, or 95% or greater identical to a nucleotide sequence encoding a PgaB protein of the present invention consisting of the amino acid sequence set forth in SEQ ID NO:5 or SEQ ID NO:6. Identity can be assessed visually or using computer software. Using computer software, the identity between two or more sequences can be expressed as a percentage (%), which can be used to assess identity between related sequences.
[0043] The present invention also protects an expression cassette, a recombinant vector or a recombinant microorganism containing any of the above-mentioned nucleic acid molecules.
[0044] The use of any of the aforementioned PgaB proteins or any of the aforementioned nucleic acid molecules in anti-biofilm also falls within the scope of protection of the present invention.
[0045] In the above applications, the anti-biofilm effect may be manifested as destroying bacterial biofilms and / or inhibiting the formation of bacterial biofilms. The bacteria may be drug-resistant pathogenic bacteria.
[0046] The use of any of the aforementioned PgaB proteins or any of the aforementioned nucleic acid molecules in improving the sensitivity of bacteria to antibiotics also falls within the scope of protection of the present invention.
[0047] In the above application, the antibiotic may be methicillin.
[0048] In the above application, the bacteria may be drug-resistant pathogenic bacteria.
[0049] The use of any of the aforementioned PgaB proteins or any of the aforementioned nucleic acid molecules as glycoside hydrolases or in the preparation of glycoside hydrolases also falls within the scope of protection of the present invention.
[0050] The present invention also protects a drug, which may contain any of the aforementioned PgaB proteins. The active ingredient of the drug may be any of the aforementioned PgaB proteins.
[0051] The use of the drug in treating diseases caused by biofilm-producing bacteria and / or drug-resistant bacteria also falls within the scope of protection of the present invention. The drug-resistant bacteria may be drug-resistant pathogenic bacteria.
[0052] Any of the above-mentioned bacteria or drug-resistant pathogenic bacteria can specifically be Staphylococcus epidermidis.
[0053] Any of the above-mentioned Staphylococcus epidermidis can specifically be Staphylococcus epidermidis ATCC 35984.
[0054] Experiments have shown that PgaB Ab1 PgaB KpThe protein has significant anti-Staphylococcus epidermidis biofilm activity, which can destroy mature Staphylococcus epidermidis biofilm and inhibit the formation of Staphylococcus epidermidis biofilm, and at the same time can increase the sensitivity of Staphylococcus epidermidis to methicillin. Ab1 PgaB Kp The proteins can be used as active ingredients of drugs to treat diseases caused by bacteria that produce biofilms and / or drug-resistant bacteria (such as Staphylococcus epidermidis). The present invention has important application value. BRIEF DESCRIPTION OF THE DRAWINGS
[0055] Figure 1 The SDS-PAGE expression purification diagram of protein expression and purification; M is Blue plus V (full gold) protein marker, lane 1 is the whole cell disruption solution, lane 2 is the supernatant after disruption, lane 3 is the filtrate after binding, lane 4 is the miscellaneous protein eluate, and lane 5 is the target protein eluate; a is PgaB Kp Protein, b is PgaB Ab1 protein.
[0056] Figure 2 PgaB Ab1 PgaB Kp The results of the anti-biofilm activity test of the protein are shown in Figure 1; a is the result of the activity of destroying mature biofilms, and b is the result of the activity of inhibiting biofilm formation.
[0057] Figure 3 PgaB Ab1 PgaB Kp The results of protein increasing the sensitivity of Staphylococcus epidermidis to methicillin; a is PgaB Ab1 Sensitization activity of protein, b is PgaB Kp Sensitizing activity of proteins. DETAILED DESCRIPTION
[0058] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.
[0059] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.
[0060] The quantitative tests in the following examples were all repeated three times, and the results were averaged.
[0061] In the following examples, Escherichia coli BL21 (DE3) was purchased from Beijing Quanshijin Biotechnology Co., Ltd.; affinity chromatography columns, kanamycin, and IPTG were all purchased from Beijing Solebow Technology Co., Ltd.; a genome extraction kit was purchased from Beijing Quanshijin Biotechnology Co., Ltd., with product catalog number EE101-11; casein extract was purchased from BD Biosciences; and seamless cloning enzyme In-Fusion Snap Assembly Master Mix was purchased from Bio-Rad Biotechnology (Beijing) Co., Ltd., with product catalog number 638947.
[0062] Acinetobacter baumannii ATCC 19606, Klebsiella pneumoniae ATCC 700721, and Staphylococcus epidermidis ATCC 35984 are all ATCC products. Hereinafter, Acinetobacter baumannii ATCC 19606 is referred to as Acinetobacter baumannii, Klebsiella pneumoniae ATCC 700721 is referred to as Klebsiella pneumoniae, and Staphylococcus epidermidis ATCC 35984 is referred to as Staphylococcus epidermidis.
[0063] The pET 28a(+) plasmid was kindly provided by Dr. He Weiqing of the Institute of Medicinal Biotechnology, Chinese Academy of Medical Sciences, and is described in the following reference: Lu Zhili. "Study on the Regulation of Bitetspiramycin Biosynthesis." Master's degree, Peking Union Medical College, 2017.
[0064] The solutes and their concentrations of the LB liquid medium were 10 g / L tryptone, 10 g / L sodium chloride, and 5 g / L yeast extract, the solvent was deionized water, and the pH was natural.
[0065] The solutes and their concentrations of the LB solid medium were 10 g / L tryptone, 10 g / L sodium chloride, 5 g / L yeast extract, and 20 g / L agar, the solvent was deionized water, and the pH was natural.
[0066] The solutes and their concentrations of M63+ medium were 3 g / L KH2PO4, 7 g / L K2HPO4, 2 g / L (NH4)2SO4, 0.12 g / LMgSO4, 2 g / L glucose and 5 g / L casein extract, the solvent was deionized water, and the pH was natural.
[0067] The solutes and concentrations of the binding buffer are 50 mM Tris-HCl, 300 mM NaCl, 2% (v / v) glycerol, and 20 mM imidazole. The solvent is ultrapure water with a pH of 7.5.
[0068] The solutes and concentrations of the washing buffer were 50 mM Tris-HCl, 300 mM NaCl, 2% (v / v) glycerol, and 500 mM imidazole. The solvent was ultrapure water with a pH of 7.5.
[0069] Example 1, PgaB Ab1 PgaB Kp Protein expression and purification
[0070] 1. Obtaining genomic DNA of Acinetobacter baumannii and Klebsiella pneumoniae
[0071] Use genome extraction kits to extract Acinetobacter baumannii genomic DNA and Klebsiella pneumoniae genomic DNA. The specific steps are as follows:
[0072] (1) Take 3 mL of bacterial (Acinetobacter baumannii or Klebsiella pneumoniae) culture medium, centrifuge at 12000g for 1 min, and collect the bacterial pellet (discard the supernatant as much as possible).
[0073] (2) Add 100 μL LB2 and 20 μL Proteinase K, pipette to thoroughly suspend the cells, and incubate at 55°C for 15 minutes.
[0074] (3) After adding 500 μL of BB2 solution, the mixture was immediately vortexed for 5 seconds and then incubated at room temperature for 10 minutes.
[0075] (4) Pipette all the solution into the centrifuge column, centrifuge at 12000 rpm for 60 seconds, and collect the precipitate (discard the solution in the collection tube).
[0076] (5) Add 500 μL of CB2 solution supplemented with anhydrous ethanol, centrifuge at 12000 rpm for 60 s, and collect the precipitate (discard the solution in the centrifuge tube).
[0077] (6) Add 500 μL of WB2 solution supplemented with anhydrous ethanol, centrifuge at 12,000 rpm for 60 seconds, collect the precipitate (discard the solution in the centrifuge tube), and repeat the above operation once.
[0078] (7) Without adding any solution, centrifuge at 12000 rpm for 2 min. Then, open the lid and place the centrifuge column at room temperature for 10 min to completely remove the anhydrous ethanol in the centrifuge column.
[0079] (8) Place the centrifuge column in a new clean centrifuge tube, add 50 μL of EB solution preheated at 65°C to the center of the centrifuge column, and centrifuge at 12,000 rpm for 1 minute. The solution in the centrifuge tube is the genomic DNA solution.
[0080] LB2, Proteinase K, BB2 solution, CB2 solution, WB2 solution and EB solution are all components of the genome extraction kit.
[0081] 2. Construction of recombinant expression vector
[0082] 1. Construction of pET28a-Ab1 plasmid
[0083] (1) Using the genomic DNA of Acinetobacter baumannii as a template, pgab Ab1 Upstream primer: CCGCGCGGCAGC CATAT G AACCCACCTAAAATAGATGCTTCA (underlined is the recognition site of restriction endonuclease NdeI) and pgab Ab1 Downstream primer:
[0084] GGTGGTGGTG CTCGAG PCR amplification was performed using a primer pair consisting of TTATGGCACAAGACGAGATGA (the underline indicates the recognition site of the restriction endonuclease XhoI), and a PCR amplification product 1 of approximately 1947 bp was recovered.
[0085] The PCR amplification product 1 contains the nucleotide sequence pgaB shown in SEQ ID No: 1 Ab1 Gene.
[0086] (2) The pET 28a(+) plasmid was digested with restriction endonucleases NdeI and XhoI to recover the vector backbone. The PCR amplification product 1 and the vector backbone were ligated using the seamless cloning enzyme In-Fusion Snap Assembly Master Mix to obtain the recombinant expression vector pET28a-Ab1, i.e., the pET28a-Ab1 plasmid.
[0087] The recombinant expression vector pET28a-Ab1 was sequenced. The sequencing results showed that the recombinant expression vector pET28a-Ab1 was a pET 28a (+) plasmid with the DNA fragment between the restriction endonucleases NdeI and XhoI replaced with pgaB Ab1 gene, keeping other sequences of pET 28a(+) plasmid unchanged to obtain the recombinant plasmid.
[0088] The pET28a-Ab1 plasmid contains PgaB shown in SEQ ID No: 3 Ab1 Fusion gene expressing the amino acid sequence of PgaB as shown in SEQ ID No: 5 Ab1 Fusion protein, PgaB Ab1 The fusion protein is PgaB with a His tag Ab1 protein.
[0089] 2. Construction of pET28a-Kp plasmid
[0090] (1) Using Klebsiella pneumoniae genomic DNA as a template, pgab KpUpstream primer:
[0091] CGCGCGGCAGC CATATG GAGGAAGTCCCCTTCCTCGC (underlined is the recognition site of restriction endonuclease NdeI) and pgab Kp Downstream primer:
[0092] GGTGGTGGTG CTCGAG PCR amplification was performed using a primer pair consisting of TTAGTCATGGTCAGGGTACCACC (the underline indicates the recognition site of the restriction endonuclease XhoI), and a PCR amplification product 2 of approximately 1977 bp was recovered.
[0093] The PCR amplification product 2 contains the nucleotide sequence pgaB shown in SEQ ID No: 2 Kp Gene.
[0094] (2) The pET 28a(+) plasmid was digested with restriction endonucleases NdeI and XhoI to recover the vector backbone. PCR amplification product 2 and the vector backbone were ligated using the seamless cloning enzyme In-Fusion Snap Assembly Master Mix to obtain the recombinant expression vector pET28a-Kp, i.e., the pET28a-Kp plasmid.
[0095] The recombinant expression vector pET28a-Kp was sequenced. The sequencing results showed that the recombinant expression vector pET28a-Kp was constructed by replacing the DNA fragment between the restriction endonucleases NdeI and XhoI of the pET 28a(+) plasmid with pgaB Kp gene, keeping other sequences of pET 28a(+) plasmid unchanged to obtain the recombinant plasmid.
[0096] The pET28a-Kp plasmid contains PgaB shown in SEQ ID No: 4 Kp Fusion gene expressing the amino acid sequence of PgaB as shown in SEQ ID No: 6 Kp Fusion protein, PgaB Kp The fusion protein is PgaB with a His tag Kp protein.
[0097] 3. Protein Expression and Purification
[0098] 1. PgaB Ab1 Protein expression and purification
[0099] (1) The pET28a-Ab1 plasmid was transformed into Escherichia coli BL21 (DE3) to obtain recombinant E. coli. The recombinant E. coli was then three-strike-ed onto LB solid medium containing kanamycin. After overnight culture at 37°C, a single colony was picked and transferred to 5 mL of LB liquid medium containing kanamycin. The culture was then cultured at 37°C for 12 h to obtain a culture solution.
[0100] (2) Inoculate the culture solution into 200 mL of LB liquid medium containing kanamycin at a 2% inoculum volume and culture at 37°C until the OD 600nm After the pH value reaches 0.6-0.8, add IPTG solution with a final concentration of 0.5 mM and culture at 16°C for 16-20 h to obtain a fermentation solution.
[0101] (3) Take the fermentation broth and centrifuge it at 4°C, 4500 rpm for 10 min in a low-temperature centrifuge. Discard the supernatant and resuspend the cells in 1 mL of Binding buffer per 100 mL of culture medium. Add the resuspended solution to a lysis tube and use a homogenizer to disrupt the cells, thus obtaining a whole-cell disruption solution. Centrifuge it at 4°C, 14000 rpm for 30 min in a low-temperature centrifuge. Collect the supernatant, which is the post-disruption supernatant or crude protein solution.
[0102] (4) Assemble an empty affinity chromatography column. Add 1.5 mL of NI-NTA Superflow resin to the empty column. First, add 30 mL of ultrapure water to the affinity chromatography column to remove the ethanol in the column. Then, add 5 column volumes of Binding Buffer to equilibrate the column. After equilibration, add the crude protein solution, seal the column, and bind on a rotary mixer at 10°C for 1-2 hours. After binding is complete, open the column and collect the effluent, which is the filtrate after binding.
[0103] (5) After completing step (4), add 5-10 column volumes of Binding Buffer to the affinity chromatography column to elute the contaminants. The effluent is the contaminant protein elution solution. Subsequently, add 5 column volumes of Washing Buffer to the affinity chromatography column to elute the target protein. The effluent is the target protein elution solution.
[0104] SDS-PAGE was used to detect the protein content in the whole cell disruption solution, the supernatant after disruption, the filtrate after binding, the impurity protein eluate and the target protein eluate.
[0105] (6) After completing step (5), collect the target protein eluate and add it to an ultrafiltration tube. Centrifuge at 4°C and 3800 r / min for 30 min. After centrifugation, add sterile PBS solution to the collection tube and centrifuge again. Repeat the process of adding PBS and centrifuging 2-3 times. The solution in the collection tube is pure PgaB Ab1 The protein solution was stored at 4°C for subsequent studies.
[0106] 2. PgaB Kp Protein expression and purification
[0107] According to the above step 1, the pET28a-Ab1 plasmid was replaced with the pET28a-Kp plasmid, and the other steps remained unchanged to obtain the whole cell disruption solution, the supernatant after disruption, the filtrate after binding, the impurity protein eluate, the target protein eluate, and the pure PgaB Kp Protein solution.
[0108] After the above bacteria were broken by homogenizer, the crude protein solution was purified by affinity chromatography based on Ni-NTA resin and the purification results were detected by SDS-PAGE. The detection results are shown in Figure 1 The results showed that PgaB Ab1 PgaB Kp The protein band is located at around 70 kDa, which is completely consistent with the actual size. Ab1 The protein is 75.336 kDa, PgaB Kp The protein is 76.165kDa.
[0109] Example 2, PgaB Ab1 PgaB Kp Anti-biofilm activity assay of proteins
[0110] 1. Biofilm disruption activity assay
[0111] 1. Streak three zones of Staphylococcus epidermidis on LB solid medium, culture overnight at 37℃, pick a single colony and transfer it to LB liquid medium, culture at 37℃, and obtain OD 600nm The culture solution was diluted to 1% with M63+ medium to obtain a diluted culture solution.
[0112] 2. After completing step 1, add 100 μL of diluted culture medium to a sterile 96-well plate and incubate at 37°C for 24 hours to induce biofilm formation.
[0113] 3. After completing step 2, pour the culture medium into a waste liquid bucket containing bleach, wash the 96-well plate twice with deionized water to completely remove planktonic bacteria and culture medium, and tap to remove residual deionized water.
[0114] 4. After completing step 3, add 150 μL of different concentrations of protein (PgaB Ab1 PgaB Kp Protein) solution (solvent is PBS solution) or PBS solution (as negative control) was reacted at 37°C for 1 h.
[0115] 5. After completing step 4, discard the solution, then add 200 μL of 0.1% (w / v) crystal violet solution to the wells and incubate for 15 minutes to promote biofilm coloration.
[0116] 6. After completing step 5, wash the 96-well plate twice again with deionized water to completely remove the residual crystal violet solution, and tap to remove the residual deionized water.
[0117] 7. After completing step 6, add 150 μL of 33% (v / v) glacial acetic acid solution to the 96-well plate and incubate for 15 minutes to dissolve the crystal violet in the biofilm.
[0118] 8. After completing step 7, use a microplate reader to detect the OD 600nm The absorbance value at 37° was used to calculate the biofilm disruption activity of the protein.
[0119] Test results such as Figure 2 As shown in a. The results showed that PgaB Ab1 PgaB Kp The protein could destroy >80% and about 70% of biofilms at 1000 nM, respectively, and the half effective concentration (EC 50 ) were 2.83±0.65nM and 27.80±8.21nM respectively. Ab1 PgaB Kp All proteins showed destructive activity against Staphylococcus epidermidis biofilm.
[0120] 2. Biofilm Inhibitory Activity Assay
[0121] 1. Streak three zones of Staphylococcus epidermidis on LB solid medium, culture overnight at 37℃, pick a single colony and transfer it to LB liquid medium, culture at 37℃, and obtain OD 600nm The culture solution was diluted to 1% with M63+ medium to obtain a diluted culture solution.
[0122] 2. After completing step 1, add 90 μL of diluted culture medium to the 96-well plate, and then add 10 μL of different concentrations of protein (PgaB Ab1 PgaB Kp Protein) solution (solvent is PBS solution) or PBS solution (as negative control), mixed, and incubated at 37°C for 24 hours.
[0123] 3. After completing step 2, discard the solution, then add 200 μL of 0.1% (w / v) crystal violet solution to the wells and incubate for 15 minutes to promote biofilm coloration.
[0124] 4. After completing step 3, wash the 96-well plate twice with deionized water to completely remove the residual crystal violet solution, and tap to remove the residual deionized water.
[0125] 5. After completing step 4, add 150 μL of 33% (v / v) glacial acetic acid solution to the 96-well plate and incubate for 15 minutes to dissolve the crystal violet in the biofilm.
[0126] 6. After completing step 5, use a microplate reader to detect the OD value of the 96-well plate. 600nm The absorbance value at 37° was used to calculate the biofilm inhibitory activity of the protein.
[0127] Test results such as Figure 2 As shown in middle b. The results showed that PgaB Ab1 PgaB Kp The protein could inhibit biofilm formation by >99% and >95% at 1000 nM, respectively, with the half-maximal effect concentration (EC 50 ) were 4.53±1.19nM and 12.19±0.48nM respectively. Ab1 PgaB Kp The proteins all showed inhibitory activity against Staphylococcus epidermidis biofilm.
[0128] 3. Antibiotic sensitization activity assay
[0129] PgaB was assessed using 96-well plates Ab1 PgaB Kp Synergistic effect between proteins and antibiotics.
[0130] The antibiotic used in this embodiment is methicillin. The specific steps are as follows:
[0131] 1. Mix different concentrations of methicillin solution and different concentrations of protein (PgaB Ab1 PgaB Kp protein) solution to obtain a mixed solution.
[0132] 2. Streak three lines of Staphylococcus epidermidis on LB solid medium, culture at 37℃ overnight, pick a single colony and transfer it to LB liquid medium, culture at 37℃, and obtain OD 600nm The culture solution was diluted to 1% with M63+ medium to obtain a diluted culture solution.
[0133] 3. After completing steps 1 and 2, mix 20 μL of the mixed solution and 180 μL of the diluted culture medium again, add them to a 96-well plate and incubate at 37°C for 12 hours. Measure OD 600nmThe absorbance value reflects the growth of bacteria, and the inhibitory concentration index (FICI) is calculated using the standard formula. The antibiotic sensitization activity is determined by observing the changes in MIC and calculating the graded inhibitory concentration value (FICI).
[0134] PgB Ab1 PgaB Kp The results of protein increasing methicillin sensitivity to Staphylococcus epidermidis are as follows Figure 3 16 nM PgaB Kp The protein can reduce the minimum inhibitory concentration (MIC) of methicillin against Staphylococcus epidermidis from 64 μg / mL to 16 μg / mL, with an FICI of 0.3125. Ab1 The protein could reduce the minimum inhibitory concentration (MIC) of methicillin against Staphylococcus epidermidis from 64 μg / mL to 8 μg / mL, with an FICI of 0.1875.
[0135] The above results show that PgaB Ab1 PgaB Kp The protein has significant anti-Staphylococcus epidermidis biofilm activity, which can destroy mature Staphylococcus epidermidis biofilm and inhibit the formation of Staphylococcus epidermidis biofilm, namely PgaB Ab1 PgaB Kp The protein is a glycoside hydrolase with anti-biofilm activity; it can also increase the sensitivity of Staphylococcus epidermidis to methicillin. Ab1 PgaB Kp Protein has great application and transformation value.
[0136] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.
Claims
1. PgaB protein, PgaB Ab1 PgaB Kp protein; The PgaB Ab1 The protein is a1) or a2) or a3) or a4) or a5) as follows: a1) the amino acid sequence of the protein represented by SEQ ID NO: 5 from positions 21 to 658 from the N-terminus; a2) the amino acid sequence is the protein shown in SEQ ID NO: 5; a3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in a1) or a2); a4) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein of a1) or a2) or a3) and having anti-biofilm activity and / or increasing the sensitivity of bacteria to antibiotics; a5) a protein that has 80% or more homology with the amino acid sequence defined in a1) or a2) or a3) and has anti-biofilm activity and / or can increase the sensitivity of bacteria to antibiotics; The PgaB Kp The protein is b1) or b2) or b3) or b4) or b5) as follows: b1) the amino acid sequence of the protein represented by SEQ ID NO: 6 from positions 21 to 668 from the N-terminus; b2) the amino acid sequence is the protein shown in SEQ ID NO: 6; b3) A fusion protein obtained by connecting a tag to the N-terminus and / or C-terminus of the protein shown in b1) or b2); b4) a protein obtained by substituting and / or deleting and / or adding one or more amino acid residues of the protein shown in b1) or b2) or b3) and having anti-biofilm activity and / or increasing the sensitivity of bacteria to antibiotics; b5) A protein having 80% or more homology with the amino acid sequence defined in b1) or b2) or b3) and having anti-biofilm activity and / or capable of increasing the sensitivity of bacteria to antibiotics.
2. The PgaB protein according to claim 1, characterized in that: The antibiotic is methicillin.
3. The PgaB protein according to claim 1, wherein: The anti-biofilm activity is manifested in the destruction of bacterial biofilms and / or the inhibition of bacterial biofilm formation.
4. A nucleic acid molecule encoding the PgaB protein according to any one of claims 1 to 3.
5. The nucleic acid molecule according to claim 4, characterized in that: Encoding the PgaB Ab1 The nucleic acid molecule of the protein is a DNA molecule shown in A1) or A2) or A3) or A4) or A5): A1) The coding region is a DNA molecule represented by SEQ ID NO: 1; A2) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 1; A3) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 3; A4) has 75% or more homology with the nucleotide sequence defined in A1) or A2) or A3) and encodes the PgaB described in any one of claims 1 to 3 Ab1 DNA molecules of proteins; A5) hybridizes with the nucleotide sequence defined in A1) or A2) or A3) under stringent conditions and encodes the PgaB sequence described in any one of claims 1 to 3 Ab1 DNA molecules of proteins; Encoding the PgaB Kp The nucleic acid molecule of the protein is a DNA molecule shown in B1) or B2) or B3) or B4) or B5): B1) The coding region is a DNA molecule represented by SEQ ID NO: 2; B2) a DNA molecule whose nucleotide sequence is shown in SEQ ID NO: 2; B3) a DNA molecule having a nucleotide sequence as shown in SEQ ID NO: 4; B4) has 75% or more homology with the nucleotide sequence defined in B1) or B2) or B3), and encodes the PgaB according to any one of claims 1 to 3. Kp DNA molecules of proteins; B5) hybridizes with the nucleotide sequence defined by B1) or B2) or B3) under stringent conditions and encodes the PgaB sequence according to any one of claims 1 to 3 Kp Protein DNA molecules.
6. An expression cassette, recombinant vector or recombinant microorganism containing the nucleic acid molecule according to claim 4 or 5.
7. Use of the PgaB protein according to any one of claims 1 to 3 or the nucleic acid molecule according to claim 4 or 5, wherein: C1) Anti-biofilm; C2) Increase bacterial sensitivity to antibiotics; C3) as a glycoside hydrolase; C4) preparing glycoside hydrolases.
8. The use according to claim 7, characterized in that: The anti-biofilm performance is to destroy bacterial biofilm and / or inhibit bacterial biofilm formation; The antibiotic is methicillin.
9. A medicine comprising the PgaB protein according to any one of claims 1 to 3.
10. Use of the drug according to claim 9 in treating diseases caused by biofilm-forming bacteria and / or drug-resistant bacteria.
Citation Information
Cited By
Treatment method for secondary sedimentation tank float sludge initiated by DCM control agent in sulfate process pulping
CN121948713A