A halohydrin dehalogenase mutant and its application in preparing (R)-4-phenyl-2-oxazolidinone

Abstract

The invention discloses a halohydrin dehalogenase mutant and its application in preparing (R)-4-phenyl-2-oxazolidinone, belongs to the field of enzyme engineering and chemical engineering technology, the amino acid residues of wild-type halohydrin dehalogenase are mutated, and halohydrin dehalogenase mutants with high enzyme activity and high stereoselectivity are screened out. The halohydrin dehalogenase mutant provided by the present invention has high enzyme activity and high stereoselectivity in the application of catalyzing (S)-2-phenyloxirane to convert (R)-4-phenyl-2-oxazolidinone, and the catalytic efficiency of mutant T126L / F170M can reach 1.7 times that of wild-type halohydrin dehalogenase, with extremely high industrial application value.

Description

Technical Field

[0001] The invention relates to a halohydrin dehalogenase mutant and application thereof in preparing (R)-4-phenyl-2-oxazolidinone, belonging to the technical fields of enzyme engineering and chemical engineering. Background Art

[0002] As a key chiral heterocyclic compound, (R)-4-phenyl-2-oxazolidinone occupies an important position in the fields of medicine and fine chemicals. It is not only a core chiral intermediate for a variety of anti-tumor and antiviral drugs, but also serves as a highly efficient chiral inducer in asymmetric catalytic reactions, promoting the precise synthesis of high-value-added fine chemicals. The global market demand for this type of chiral compound has been increasing year by year, but its traditional chemical synthesis route has significant limitations: for example, the phosgene-mediated cyclization method relies on highly toxic reagents, has low process safety and high environmental costs; and although transition metal-catalyzed asymmetric synthesis can construct chiral centers, the use of precious metal catalysts leads to a surge in costs, and it is difficult to completely avoid the impact of metal residues on product purity. In addition, chemical methods generally face the problem of insufficient stereoselectivity, and the products often require multiple purification steps to meet pharmaceutical standards, resulting in a significant reduction in overall yield and atom economy.

[0003] In contrast, biotransformation technology catalyzed by halohydrin dehalogenase (HheG) exhibits unique advantages. Through a one-step enzymatic reaction in an aqueous system under mild conditions, (S)-2-phenyloxirane can be efficiently converted to high-optical-purity (R)-4-phenyl-2-oxazolidinone, without the need for toxic reagents and with near-ideal theoretical atomic utilization. However, existing biocatalytic systems still suffer from drawbacks such as low enzyme activity, poor substrate tolerance, and insufficient operational stability. For example, the catalytic efficiency of wild-type enzymes for aromatic substrates is relatively low, and the introduction of trace amounts of organic solvents in the reaction system can easily lead to fluctuations in stereoselectivity, severely limiting their potential for industrial application. Patent of invention CN117821417A discloses a kind of halohydrin dehalogenase mutant, encoding gene, plasmid, genetic engineering bacteria and application thereof, the leucine of the 103rd of original halohydrin dehalogenase amino acid sequence is mutated to histidine, the asparagine of the 196th is mutated to tryptophan by this halohydrin dehalogenase mutant, so that amino acid and its related nucleotide sequence produce directed structure and functionalization change, greatly improve the catalytic activity and stereoselectivity of halohydrin dehalogenase mutant.But the invention does not disclose the preparation effect of described halohydrin dehalogenase mutant for (R)-4-phenyl-2-oxazolidinone.Therefore, it is urgent to utilize genetic engineering and enzyme engineering technology to obtain the halohydrin dehalogenase mutant with high enzyme activity, high stereoselectivity, improve the application value of halohydrin dehalogenase in the preparation of (R)-4-phenyl-2-oxazolidinone. Summary of the Invention

[0004] Purpose of the invention: The purpose of the present invention is to provide a halohydrin dehalogenase mutant with high enzymatic activity and high stereoselectivity, and to provide a nucleic acid encoding the mutant, a recombinant vector, a recombinant cell and a product comprising the mutant, as well as the use of the mutant in catalyzing the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone.

[0005] Technical solution: The halohydrin dehalogenase mutant of the present invention is obtained by amino acid mutation of the sequence shown in SEQ ID NO.1, wherein the mutation is at least one of T126Y, T126L, F170M, and N216G.

[0006] Among them, T126Y, T126L, F170M, and N216G all use the standard substitution notation of the standard single-letter amino acid code. For example, T126Y indicates that the threonine (T) at position 126 of the N-terminus of SEQ ID NO. 1 is replaced by tyrosine (Y); T126Y / F170M indicates that the threonine (T) at position 126 of the N-terminus of SEQ ID NO. 1 is replaced by tyrosine (Y), and the phenylalanine (F) at position 170 is replaced by methionine (M).

[0007] The invention mechanism of the present invention is to amplify the halohydrin dehalogenase gene and use rational design to carry out directed evolution modification thereof to obtain a halohydrin dehalogenase mutant with significantly improved catalytic efficiency and stereoselectivity, thereby realizing the efficient preparation of (R)-4-phenyl-2-oxazolidinone.

[0008] Specifically, the present invention utilizes the sequence and structural information of publicly reported halohydrin dehalogenases, performs non-redundant searches in databases such as NCBI, and screens out some potential enzyme genes for saturation or semi-saturation mutations based on the principles of protein structure similarity, conserved site analysis, and host source diversity, thereby constructing a mutant library for effective screening. These genes are functionally expressed in an E. coli expression system and then purified to obtain pure enzymes. The preferred halohydrin dehalogenase (PDB: 5O30) is derived from Ilumatobacter coccineus YM16-304 Its amino acid sequence is shown in SEQ ID NO.1, and its gene sequence is shown in SEQ ID NO.2. It has certain catalytic activity and can catalyze the production of (R)-4-phenyl-2-oxazolidinone.

[0009] Preferably, the mutant is T126Y, F170M, N216G, T126Y / F170M, F170M / N216G or T126L / F170M.

[0010] The present invention also provides a nucleic acid encoding the halohydrin dehalogenase mutant.

[0011] The present invention also provides a recombinant vector comprising the nucleic acid. Further, the recombinant vector is a recombinant plasmid.

[0012] Preferably, the recombinant vector is a PET series expression vector.

[0013] The present invention also provides a recombinant cell comprising the recombinant vector. Further, the recombinant cell is Escherichia coli.

[0014] The construction method of the recombinant cell is as follows:

[0015] (1) Construction of recombinant plasmid pET22b-HheG: The halohydrin dehalogenase gene was ligated with the enzyme-digested plasmid pET22b to obtain the recombinant expression vector pET22b-HheG;

[0016] (2) Construction of recombinant bacteria E. coli BL21(DE3) / pET22b-HheG: The constructed recombinant expression vector pET22b-HheG was heat-transformed into Escherichia coli BL21(DE3) competent cells, and the recombinant E. coli BL21(DE3) / pET22b-HheG.

[0017] The present invention also provides a product for preparing (R)-4-phenyl-2-oxazolidinone, wherein the product comprises the halohydrin dehalogenase mutant, or the nucleic acid, or the recombinant vector, or the recombinant cell.

[0018] Preferably, the product comprises immobilized enzymes or immobilized cells produced using immobilization technology.

[0019] The present invention also provides the use of the product in catalyzing the conversion of (S)-2-phenyloxirane into (R)-4-phenyl-2-oxazolidinone.

[0020] Preferably, the catalytic reaction temperature is 20-50°C, and the pH is 5.5-7.5. Further, the reaction temperature is 20-40°C.

[0021] Beneficial effects: Compared with the prior art, the present invention has the following significant advantages: the halohydrin dehalogenase mutant provided by the present invention has high enzyme activity and high stereoselectivity in the application of catalyzing the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone. The catalytic efficiency of the mutant T126L / F170M can reach 1.7 times that of the wild-type halohydrin dehalogenase, and has extremely high industrial application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1This is a reaction diagram for the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone catalyzed by halohydrin dehalogenase;

[0023] Figure 2 A graph comparing the yield and chirality of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone catalyzed by the wild-type halohydrin dehalogenase and the halohydrin dehalogenase mutant;

[0024] Figure 3 The figure shows the comparison of the yield of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone catalyzed by the halohydrin dehalogenase mutant (F170M / N216G) at different temperatures;

[0025] Figure 4 Comparison of the yields of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone catalyzed by halohydrin dehalogenase (F170M / N216G) at different pH values. DETAILED DESCRIPTION

[0026] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0027] Example Ilumatobacter coccineus YM16-304 The halohydrin dehalogenase (PDB: 5O30) is the original enzyme (wild type), and its amino acid sequence is shown in SEQ ID NO.1, and its gene sequence is shown in SEQ ID NO.2. This enzyme can convert (S)-2-phenyloxirane into (R)-4-phenyl-2-oxazolidinone. The reaction process is shown in Figure 1 .

[0028] Example 1 Halohydrin dehalogenase mutant T126Y and its preparation method

[0029] This embodiment provides a halohydrin dehalogenase mutant T126Y, the preparation method of which is as follows:

[0030] Step 1: Construction of halohydrin dehalogenase mutant plasmid

[0031] (1) Obtaining pET22b-HheG

[0032] The wild-type gene of halohydrin dehalogenase was synthesized by GENEWIZ (Suzhou) Co., Ltd. and constructed on the pET22b vector (the pET22b vector was provided by GENEWIZ), and the vector was transformed into E. coli DH5α strain (purchased from Sangon Biotech (Shanghai) Co., Ltd.), the recombinant bacteria E. coliDH5α / pET22b-HheG was inoculated into a 5 mL test tube and cultured at 37°C and 220 rpm for 12 h. After the culture, the cells were centrifuged at 12,000 rpm for 1 min and the cells were collected. The cells were purified using a high-purity plasmid extraction kit. E. coli The plasmid extracted from DH5α / pET22b-HheG was used as a template for iterative mutagenesis to construct the plasmid pET22b-HheG mutant.

[0033] (2) Recombinant Escherichia coli E. coli Construction of BL21(DE3) / pET22b-HheG mutant

[0034] The gene mutation was carried out by whole plasmid PCR method, mutant T126Y primers were designed and single-point iterative mutagenesis was performed to obtain the target mutant gene.

[0035] T126Y upstream primer (SEQ ID NO. 3): CGGCCTGATTGTGTACGGCAAATTTCTGG

[0036] T126Y downstream primer (SEQ ID NO. 4): CCAGAAATTTGCCGTACACAATCAGGCCG

[0037] The PCR system is shown in Table 1.

[0038] Table 1 PCR reaction system

[0039] Ingredients volume 10×Buffer for KOD-Plus- 2.5 μL 2 mM Dntp 2.5 μL <![CDATA[25 mM MgSO4]]> 1.5 μL DMSO 1 μL 10 pmol / μL Forward Primer 0.75 μL 10 pmol / μL Reverse Primer 0.75 μL DNA template <100 of KOD-Plus- 1 μL <![CDATA[ddH2O]]> up to 25 μL

[0040] PCR reaction conditions are shown in Table 2.

[0041] Table 2 PCR reaction conditions

[0042] Reaction temperature time 95 ℃ 3 min 95 ℃ 20 s 57℃ 10 s 70 ℃ 4 min 12 ℃ 10 min

[0043] The cycle of "95℃ 20s--57℃ 10s" was repeated 32 times.

[0044] After PCR amplification, the amplified product was detected by 0.9% agarose gel electrophoresis, and the results showed that the amplified product was a single band with a size of about 6000 bp. The amplified product was purified and recovered using a DNA recovery and purification kit.

[0045] The purified gene fragment was digested with DpnI to remove the template and then recombined with recombinase. E. coliDH5a competent cells were plated on LB solid medium containing 100 mg / mL ampicillin and incubated at 37°C for 12 hours. Single colonies were picked and transferred to LB liquid culture. Successful transformants were identified by PCR, and the correctness of the mutation site was verified by sequencing. After verification, a portion of the cells was added with sterile glycerol to a final concentration of 25%, numbered, and stored at -80°C until further use. A portion of the cells was used to extract the plasmid using a plasmid extraction kit, and the recombinant plasmids were stored at -20°C.

[0046] The recombinant expression plasmid pET22b that was successfully sequenced was transferred into E. coli BL21 (DE3) (Escherichia coli, purchased from Sangon Biotech (Shanghai) Co., Ltd.) was used as the expression host to construct the recombinant mutant expression strain. E. coli BL21(DE3) / pET22b-HheG.

[0047] Step 2: Cultivate the expression strain, express the halohydrin dehalogenase mutant and prepare the whole cell culture

[0048] The successful recombinant mutant expression strain E. coli BL21(DE3) / pET22b-HheG was plated onto a plate containing ampicillin at a final concentration of 100 mg / mL. A single colony was picked and inoculated into 5 mL of LB medium containing resistance and cultured overnight at 37°C at 200 rpm / min. 1% of the inoculum was transferred to 500 mL of LB medium containing resistance and cultured at an OD of 0. 600 When the concentration reaches about 0.6, add IPTG with a final concentration of 0.5 mM and induce at 18°C ​​for about 14 h.

[0049] After obtaining the bacterial cells by centrifugation, they were resuspended in a buffer to obtain the whole-cell bacterial solution used in the reaction.

[0050] Example 2 Yield and Stereoselectivity of (R)-4-phenyl-2-oxazolidinone Synthesis by Wild-Type Halohydrin Dehalogenase and Halohydrin Dehalogenase Mutants

[0051] The halohydrin dehalogenase mutants F170M, N216G, T126Y / F170M, F170M / N216G, and T126L / F170M were prepared using the preparation method of Example 1. PCR primers are shown in Table 3.

[0052] Table 3 Primers for constructing mutants

[0053] Primers Sequence number Primer sequences T126Y upstream primer SEQ ID NO.3 CGGCCTGATTGTGTACGGCAAATTTCTGG T126Y downstream primer SEQ ID NO.4 CCAGAAATTTGCCGTACACAATCAGGCCG F170M upstream primer SEQ ID NO.5 GTGCGTGGTTATGACGAGTGCGACCG F170M downstream primer SEQ ID NO.6 CGGTCGCACTCGTCATAACCACGCAC N216G upstream primer SEQ ID NO.7 CGATTGGCACCGGCTATATGGATTTTCCGGGC N216G downstream primer SEQ ID NO.8 GCCCGGAAAATCCATATAGCCGGTGCCAATCG T126Y / F170M upstream primer SEQ ID NO.9 GTGCGTGGTTATGACGAGTGCGACCG T126Y / F170M downstream primer SEQ ID NO.10 CGGTCGCACTCGTCATAACCACGCAC F170M / N216G upstream primer SEQ ID NO.11 CGATTGGCACCGGCTATATGGATTTTCCGGGC F170M / N216G downstream primer SEQ ID NO.12 GCCCGGAAAATCCATATAGCCGGTGCCAATCG T126L / F170M upstream primer SEQ ID NO.13 CGGCCTGATTGTGCTCGGCAAATTTCTGG T126L / F170M downstream primer SEQ ID NO.14 CCAGAAATTTGCCGAGCACAATCAGGCCG

[0054] The whole-cell bacterial liquid containing the wild-type halohydrin dehalogenase or the halohydrin dehalogenase mutant is used as a catalyst.

[0055] The reaction system is: OD 600 =40 whole-cell bacterial suspension, 40mM (S)-2-phenyloxirane, 120mM NaOCN, and 100mM potassium phosphate buffer (pH=7.5) were used as the reaction buffer. The reaction temperature was controlled at 30°C in a water bath with magnetic stirring for 12h. The yield and stereoselectivity of the halohydrin dehalogenase and its mutants in synthesizing (R)-4-phenyl-2-oxazolidinone were determined by liquid chromatography and supercritical fluid chromatography, respectively.

[0056] The test results are shown in Table 4 and Figure 2 The catalytic conversion rates of all mutants were higher than that of the wild-type halohydrin dehalogenase, among which the catalytic efficiency of the mutant T126L / F170M was 1.7 times that of the wild-type halohydrin dehalogenase.

[0057] Table 4: Production of (R)-4-phenyl-2-oxazolidinone catalyzed by halohydrin dehalogenase

[0058] strain Cell concentration Yield ee WT <![CDATA[OD 600 =40]]> 58% 88% T126Y <![CDATA[OD 600 =40]]> 62% 84% N216G <![CDATA[OD 600 =40]]> 64% 95% F170M <![CDATA[OD 600 =40]]> 91% 96% T126Y / F170M <![CDATA[OD 600 =40]]> 89% 98% F170M / N216G <![CDATA[OD 600 =40]]> 97% 99% T126L / F170M <![CDATA[OD 600 =40]]> 100% 98%

[0059] Example 3 Optimal Temperature for the Conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone Catalyzed by the Halohydrin Dehalogenase Mutant F170M / N216G

[0060] This example takes the halohydrin dehalogenase mutant F170M / N216G as an example to study the optimal temperature for the halohydrin dehalogenase mutant to catalyze the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone.

[0061] The whole cell culture of the halohydrin dehalogenase mutant F170M / N216G was used as the catalyst.

[0062] The reaction system is: OD 600 = 40 whole cell culture, 40mM (S)-2-phenyloxirane, 120mM NaOCN, and a reaction buffer solution of 100mM potassium phosphate buffer (pH=7.5). The reaction temperature was controlled at 20°C, 30°C, 35°C, 40°C, and 45°C in a water bath with magnetic stirring. The reaction was carried out for 12 hours, and the yield of (R)-4-phenyl-2-oxazolidinone synthesized by the halohydrin dehalogenase and its mutants was detected by liquid chromatography.

[0063] Test results see Figure 3 The best catalytic effect was observed at 35°C, and the enzyme activity was good in the range of 20-50°C, with the enzyme activity being higher at 20-50°C.

[0064] Example 4 Optimal pH for the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone catalyzed by the halohydrin dehalogenase mutant F170M / N216G

[0065] This example takes the halohydrin dehalogenase mutant F170M / N216G as an example to study the optimal pH for the halohydrin dehalogenase mutant to catalyze the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone.

[0066] The whole cell culture of the halohydrin dehalogenase mutant F170M / N216G was used as the catalyst.

[0067] The reaction system is: OD 600 =40 whole-cell bacterial suspension, 40 mM (S)-2-phenyloxirane, and 120 mM NaOCN. 50 mM citric acid-phosphate buffer (pH 5.5), 50 mM sodium phosphate buffer (pH 6.5), 50 mM dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer (pH 7.5), 50 mM dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer (pH 8), 50 mM dipotassium hydrogen phosphate-potassium dihydrogen phosphate buffer (pH 8.5), 50 mM Tris-HCl buffer (pH 9.5), 50 mM Gly-NaOH buffer (pH 10.28), and 50 mM Gly-NaOH buffer (pH 11.5). The reaction temperature was controlled at 30°C in a water bath with magnetic stirring for 12 h. The yield of (R)-4-phenyl-2-oxazolidinone synthesized by the halohydrin dehalogenase and its mutants was determined by liquid chromatography.

[0068] Test results see Figure 4 Different pH values ​​significantly affected the catalytic activity of halohydrin dehalogenase. The best catalytic effect was observed at pH 6.5. Within the pH range of 5.5-7.5, the catalytic activity of the halohydrin dehalogenase mutant F170M / N216G was relatively high.

[0069] Example 5 Kinetic Parameters for the Conversion of (S)-2-Phenyloxirane to (R)-4-Phenyl-2-Oxazolidinone Catalyzed by the Halohydrin Dehalogenase Mutant F170M / N216G

[0070] In this example, the halohydrin dehalogenase mutant F170M / N216G was used as an example to study the kinetic parameters of the halohydrin dehalogenase mutant catalyzing the conversion of (S)-2-phenyloxirane to (R)-4-phenyl-2-oxazolidinone.

[0071] The kinetic parameters of halohydrin dehalogenase and its mutants were determined using different concentrations of hydrogen peroxide as substrate. The experiment was carried out at pH = 7.5, NaOCN concentration of 100 mM, enzyme concentration of 0.01 mM, reaction time of 10 min, first-order reaction velocity as the ordinate, and substrate concentration as the abscissa. Nonlinear fitting was used to obtain the parameter values ​​of Vmax and Km, and then Kcat was calculated. The results are shown in Table 5.

[0072] Table 5 Kinetic parameters of halohydrin dehalogenase mutants

[0073] Halohydrin dehalogenase mutants Km(mM) <![CDATA[Kcat(min -1 )]]> <![CDATA[Kcat / Km(mM -1 ·min -1 )]]> F170M / N216G 16.35 47 2.87 .

Claims

1. A halohydrin dehalogenase mutant obtained by amino acid mutation of the sequence shown in SEQ ID NO.1, characterized in that: The mutation is at least one of T126Y, T126L, F170M, and N216G; the mutant is T126Y, F170M, N216G, T126Y / F170M, F170M / N216G, or T126L / F170M.

2. A nucleic acid, characterized in that Encoding the halohydrin dehalogenase mutant according to claim 1.

3. A recombinant vector, characterized in that Comprising the nucleic acid according to claim 2.

4. The recombinant vector according to claim 3, characterized in that The recombinant vector is a PET series expression vector.

5. A recombinant cell, characterized in that Comprising the recombinant vector according to claim 3.

6. A product for preparing (R)-4-phenyl-2-oxazolidinone, characterized in that The product comprises the halohydrin dehalogenase mutant according to claim 1, or the nucleic acid according to claim 2, or the recombinant vector according to claim 3, or the recombinant cell according to claim 5.

7. The product according to claim 6, characterized in that The products include immobilized enzymes or immobilized cells produced by using immobilization technology.

8. Use of the product according to claim 6 or claim 7 in catalyzing the conversion of (S)-2-phenyloxirane into (R)-4-phenyl-2-oxazolidinone.

9. The use according to claim 8, characterized in that The catalytic reaction temperature is 20-50° C., and the pH is 5.5-7.5.

Images