Asian migratory locust mrpl13 gene and application thereof
By using RNA interference technology on the MRPL13 gene of the Asian migratory locust, and utilizing dsRNA to interfere with the MRPL13 gene of the Asian migratory locust, the environmental pollution and pesticide resistance problems of chemical pesticide control methods are solved, achieving a highly efficient green pest control effect.
Patent Information
- Application Number
- CN202510984512.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-17
- Publication Date
- 2026-01-23
- Estimated Expiration
- 2045-07-17
AI Technical Summary
In existing technologies, chemical pesticides are used to control Asian migratory locusts, which cause serious environmental pollution and pests are prone to developing resistance. There is a lack of efficient and environmentally friendly control methods.
RNA interference technology was used to interfere with the MRPL13 gene of the Asian migratory locust, causing it to die.
This approach has enabled green control of Asian migratory locusts, increased pest mortality rates, and avoided environmental pollution and pesticide resistance issues.
Smart Images

Figure CN120485199B_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the technical field of biotechnology, and particularly relates to a Locusta migratoria MRPL13 gene and application thereof. BACKGROUND
[0002] Locusta migratoria is one of the important agricultural pests in China, which has the characteristics of strong migration and high outbreak. The large-scale migration and aggregation behavior of the pest cause serious harm to crops, especially under the background of ecological environment change and climate anomaly, the migration and disaster risk of Locusta migratoria are increasing. Traditional methods of Locusta migratoria control mainly rely on chemical pesticides, but long-term use not only pollutes the environment, but also may lead to pesticide resistance of Locusta migratoria and negative effects on non-target organisms and ecosystems.
[0003] In recent years, with the development of molecular biological technology, RNA interference (RNAi) as a gene silencing technology has been increasingly applied in pest control research. RNAi is mediated by double-stranded RNA (dsRNA) to specifically degrade target mRNA in insect cells, thereby inhibiting the expression of target genes. This technology has the advantages of high efficiency, strong specificity and environmental friendliness, and is a very potential green control method.
[0004] Therefore, there is an urgent need in the prior art for a Locusta migratoria control method based on double-stranded RNA interference technology, which specifically interferes with the expression of related genes of Locusta migratoria by using double-stranded RNA, so as to improve the mortality of Locusta migratoria and achieve green control of Locusta migratoria. SUMMARY
[0005] The purpose of the present application is to overcome the shortcomings of the prior art, and to provide a Locusta migratoria MRPL13 gene, a RNA interference fragment of the Locusta migratoria MRPL13 gene, a dsRNA synthesized by the RNA interference fragment of the Locusta migratoria MRPL13 gene, and application of the dsRNA in Locusta migratoria control.
[0006] The purpose of the present application is achieved by the following technical solutions:
[0007] The present application provides a Locusta migratoria MRPL13 gene, and the nucleotide sequence is shown in SEQ ID NO: 1.
[0008] The RNA interference fragment of the Locusta migratoria MRPL13 gene has the following characteristics: the nucleotide sequence is shown in SEQ ID NO: 2. The nucleotide sequence of the primer used for synthesizing the RNA interference fragment is as follows:
[0009] 7 MRPL13 T7+F: taatacgactcactatagggGCTACATGGCAGAACCCATT (SEQ ID NO: 3);
[0010] 7 MRPL13 T7+R: taatacgactcactatagggTTGGAACTGGCCTTATCTGC (SEQ ID NO: 4).
[0011] The application also provides dsRNA synthesized by the RNA interference fragment of the locust MRPL13 gene.
[0012] The application of the dsRNA in the prevention and treatment of the locusts causes the death of the locust larvae through RNA interference.
[0013] The application has the beneficial effects that the application relates to the locust MRPL13 gene and its RNA interference fragment, and provides the application of the dsRNA synthesized by the RNA interference fragment in the prevention and treatment of the locusts. Through RNA interference, the death of the locust larvae is caused, so that the green prevention and control of the locusts is realized. BRIEF DESCRIPTION OF DRAWINGS
[0014] Figure 1 is a RNA interference efficiency column chart (the vertical coordinate represents the relative expression amount of the MRPL13 gene, and the horizontal coordinate represents the control group dsGFP and the experimental group dsMRPL13);
[0015] Figure 2 is a nymph mortality column chart of the 4th instar larvae after 24 hours of RNA interference (the vertical coordinate represents the mortality of the locust larvae, the horizontal coordinate represents the recording days, Control represents the control group, and dsMRPL13 represents the experimental group). DETAILED DESCRIPTION
[0016] The application will be described in detail below in combination with the drawings.
[0017] EMBODIMENT
[0018] 1. Extraction of locust genomic RNA:
[0019] 1) Put the locust sample into a 1.5 mL centrifuge tube, add 200 uL TRIzol, grind the tissue uniformly with a tissue grinder, then add 800 uL TRIzol, mix thoroughly, and then stand at room temperature for 5 min to obtain a lysis solution;
[0020] 2) Add 200 uL chloroform to the lysis solution, shake vigorously for 15 s, and stand at room temperature for 10 min;
[0021] 3) Centrifuge at 4°C (12000 rpm x 15 min), and transfer the supernatant to a new 1.5 mL centrifuge tube;
[0022] 4) Add 500 μL of isopropanol, mix gently, and stand at room temperature for 10 min;
[0023] 5) Centrifuge at 4°C (12000 rpm x 10 min), and remove the supernatant;
[0024] 6) Add 1 mL of 75% ethanol (prepared with RNase-free water), and gently mix the precipitate; centrifuge at 4°C (12000 rpm x 5 min), and discard the supernatant;
[0025] 7) Repeat step 6) once;
[0026] 8) Dry at room temperature for 5-10 min, and add 20-40 μL of RNase-free water to dissolve the precipitate; gently blow the solution with a pipette to aid dissolution, and store the obtained RNA solution at -80°C for later use.
[0027] 2. Reverse transcription of RNA:
[0028] Add 1 ul of the above RNA solution to a 200 μl RNase-free centrifuge tube, and follow the steps of the 1st strand cDNA Synthesis Kit (6110A) of TAKARA to obtain the first strand cDNA, which is stored at -20°C for later use.
[0029] 3. Amplification and purification of the target fragment of the Asian migratory locust MRPL13 gene:
[0030] The above cDNA template is used for PCR amplification, and the reaction system is shown in Table 1.
[0031]
[0032] The upstream primer and the downstream primer are as follows:
[0033] 7MRPL13 T7+F: taatacgactcactatagggGCTACATGGCAGAACCCATT (SEQ ID NO: 3);
[0034] 7MRPL13 T7+R: taatacgactcactatagggTTGGAACTGGCCTTATCTGC (SEQ ID NO: 4).
[0035] PCR reaction procedure is shown in Table 2.
[0036]
[0037] PCR product was detected by 1% agarose gel (220V, electrophoresis for 25 min), and a single bright band was shown, indicating that the PCR product was available. The PCR product was purified by PCR clean kit, and the purified PCR product was sent to Shengong Bioengineering (Shanghai) Co., Ltd. for sequencing test, and the nucleotide sequence is shown as SEQ ID NO: 2.
[0038] 4. Synthesis and purification of dsRNA of Locusta migratoria MRPL13 gene:
[0039] 1) After mixing the reagents according to Table 3, mix gently, and centrifuge momentarily; put into 37℃ metal bath for 4 hours;
[0040]
[0041] 2) The material to be purified was diluted to 200μL with DEPC H2O;
[0042] 3) Add half the volume (100μL) of water-saturated phenol reagent and half the volume of chloroform (100μL).
[0043] 4) Mix gently, and centrifuge in 4℃ centrifuge (12000rpm, 4℃) for 15 min;
[0044] 5) Take the upper phase, add an equal volume of chloroform (200μL), mix gently, and centrifuge in 4℃ centrifuge (12000rpm, 4℃) for 15 min;
[0045] 6) Take the upper phase, add 1 / 10 volume (20μL) of 3M sodium acetate (pH 5.2) and 2.5 volumes (500μL) of 100% ethanol (stored at -20℃), mix gently, and stand at -20℃ for half an hour;
[0046] 7) Centrifuge in 4℃ centrifuge (12000rpm, 4℃) for 30 min;
[0047] 8) At this time, there is a white precipitate at the bottom of the centrifuge tube, discard the supernatant, add 80% ethanol (stored at -20℃) and mix gently to wash the precipitate;
[0048] 9) Centrifuge in 4℃ centrifuge (7500rpm, 4℃) for 5 min;
[0049] 10) Slowly pipette out the ethanol, and slowly pipette out the supernatant close to the precipitate with 10 μL pipette; to prevent the precipitate from being pipetted out, finally open the centrifuge tube with a small amount of residual ethanol and place it in a 37°C incubator for about 10 min, and the ethanol evaporates completely;
[0050] 11) Add 20 μL of enzyme-free H2O, tap the bottom of the tube, and let the precipitate dissolve completely. The obtained dsRNA (one strand of the dsRNA is the same as the sequence of the target fragment SEQ ID NO: 2, and the other strand is the reverse complement of SEQ ID NO: 2) is stored at -80°C.
[0051] 5, RNA interference of P. dorsalis MRPL13 (injection interference)
[0052] According to Table 4, injection interference was performed on P. dorsalis 3-5 instar larvae (injection once per instar, within 2 days before entering each instar), the control group was injected with dsGFP, and the test group was injected with dsMRPL13. The control group and the test group each had 4 replicates, and each replicate had 40 larvae. The insects treated in the same replicate were placed in the same insect rearing tank (16 cm x 12.5 cm x 12.5 cm), and sufficient and quantitative young wheat grass was added for normal feeding in the incubator.
[0053]
[0054] 6, RNA interference efficiency detection and mortality statistics of P. dorsalis MRPL13 gene
[0055] At 24 h after injection interference of 5 instar larvae, 3 replicates (3 larvae per replicate) were taken from each group for RNA extraction and subsequent fluorescence quantitative PCR detection of MRPL13 gene expression. The primer sequences for real-time fluorescence quantitative PCR of MRPL13 gene and internal reference gene actin are as follows:
[0056] qMRPL13-F2: ACAAGGACCCGACAATGGTAATGC (SEQ ID NO: 5);
[0057] qMRPL13-R2: GCCTTATCTGCCTGATCTGGTTGG (SEQ ID NO: 6);
[0058] actinF-F: CGAAGCACAGTCAAAGAGAGGTA (SEQ ID NO: 7);
[0059] actinF-R: GCTTCAGTCAAGAGAACAGGATG (SEQ ID NO: 8).
[0060] Real-time fluorescence quantitative results show that after injection of interference, the expression amount of the MRPL13 gene of the Asian migratory locust is significantly down-regulated compared with the control group (injection of dsGFP) (P<0.05), which indicates that the RNAi interference is successful (see Figure 1 ). The number of dead locusts is counted 24 hours after injection of the 4th instar larvae, and a total of 11 days are counted. Compared with the control group, the mortality of the treatment group starts to increase on the 2nd day, and reaches 89% on the 11th day (see Figure 2 ). It is indicated that the transcription level knockdown of MRPL13 can cause the death of the Asian migratory locust larvae. The pest control research mainly adopts injection method and feeding method, and the two methods have the same action principle and effect, and the present application adopts the injection method to perform experimental research.
[0061] Finally, it should be noted that the above content is only used to illustrate the technical solutions of the present application, and is not a limitation on the protection scope of the present application, and the simple modification or equivalent replacement of the technical solutions of the present application by the ordinary skilled in the art does not deviate from the essence and scope of the technical solutions of the present application.
Claims
1. dsRNA synthesized from an RNA interference fragment of the MRPL13 gene of Locusta migratoria, characterized in that: The nucleotide sequence of one strand of the dsRNA is identical to the sequence of SEQ ID NO: 2, and the nucleotide sequence of the other strand of the dsRNA is reverse complementary to the sequence of SEQ ID NO:
2.
2. The use of the dsRNA of claim 1 in the control of Locusta migratoria, which causes RNA interference in the larvae of Locusta migratoria, leading to the death of the larvae.
Citation Information
Patent Citations
Dsrna as insect control agent
CA2633576A1
Application of migratory locust Rab11A gene and dsRNA thereof in migratory locust prevention and treatment
CN112662689A