Application of PRMT5 inhibitor or combination of PRMT5 inhibitor and anti-PD-1 antibody in preparation of medicine for treating kidney cancer
By combining the PRMT5 inhibitor GSK3326595 and anti-PD-1 antibodies, ferrodemort death in renal cancer cells was promoted, and the problems of low remission rate and drug resistance in existing renal cancer treatment were solved, and the synergistic inhibitory effect of renal cancer was achieved.
Patent Information
- Application Number
- CN202510700050.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-28
- Publication Date
- 2025-08-19
AI Technical Summary
The complete response rate of immune checkpoint inhibitors in the existing treatment of renal cancer is low, and they are prone to drug resistance, and lack effective targets and treatment options.
The PRMT5 inhibitor GSK3326595 was used in combination with anti-PD-1 antibody to promote ferrodystrophy of renal cancer cells and regulate the expression of ACSL4, so as to achieve synergistic inhibition of renal cancer cell growth.
It significantly inhibits the growth of renal cancer tissues, and the use of PRMT5 inhibitors and anti-PD-1 antibodies has synergistic effects, providing a new renal cancer treatment plan.
Smart Images

Figure CN120501749A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of biomedical technology, and specifically relates to the use of a PRMT5 inhibitor or a combination thereof with an anti-PD-1 antibody in the preparation of a drug for treating renal cancer. Background Art
[0002] Kidney cancer is a common malignant tumor of the urinary system, second only to prostate cancer and bladder cancer in incidence, and its incidence is increasing annually. Kidney cancer is a highly insidious disease, with approximately 30% of patients already having metastases to adjacent organs or distant lymph nodes at the time of initial diagnosis. Limited treatment options often lead to a poor prognosis.
[0003] The current standard treatment for advanced renal cancer is primarily a combination regimen centered around immune checkpoint inhibitors (ICIs), including ICIs plus targeted drug therapy (such as pembrolizumab + lenvatinib) and dual immunotherapy (such as nivolumab + ipilimumab). However, challenges persist, including low complete remission rates and the emergence of drug resistance after treatment. Therefore, further exploration of effective targets for the diagnosis and treatment of renal cancer is crucial.
[0004] Ferroptosis is a novel form of cell death, distinct from autophagy and apoptosis, and is often caused by lipid peroxidation. Increasing evidence suggests that ferroptosis plays an important role in the development of cancer. Protein arginine methyltransferase 5 (PRMT5) is a type II member of the protein arginine methyltransferase family (PRMTs). PRMT5 catalyzes the formation of symmetrically dimethylated arginine (SDMA) by transferring the methyl group of S-adenosylmethionine (SAM) to the guanidine nitrogen of protein arginine, and influences tumor progression through multiple pathways. Studies have shown that PRMT5 promotes the progression of prostate cancer by inhibiting the transcriptional activity of CAMK2N1 through symmetrically dimethylating histones. It can also promote the stability of KLF5 by methylating it, thereby accelerating the development of breast cancer. However, the regulatory role of PRMT5 on ferroptosis in renal cancer cells remains unclear. Summary of the Invention
[0005] In light of this, the present invention provides the use of a PRMT5 inhibitor or a combination thereof with an anti-PD-1 antibody in the preparation of a drug for the treatment of renal cancer. Using an epigenetic compound library, the present invention screened multiple PRMT5 inhibitors that can promote ferroptosis in renal cancer cells, demonstrating that PRMT5 can bind to and inhibit the expression of ACSL4. This study reveals for the first time the potential role and molecular mechanism by which PRMT5 regulates ACSL4 expression during ferroptosis to control cell fate, providing a basis and reference for the development of drugs for the treatment of renal cancer.
[0006] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:
[0007] The first aspect of the present invention provides use of the PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof in the preparation of a medicament for treating renal cancer.
[0008] Furthermore, the structural formula of the PRMT5 inhibitor GSK3326595 is shown in formula (I):
[0009]
[0010] Furthermore, the drug further comprises a pharmaceutically acceptable carrier.
[0011] In the present invention, the PRMT5 inhibitor GSK3326595 is an orally active, effective, and selective protein arginine methyltransferase 5 (PRMT5) inhibitor with a corresponding CAS number of 1616392-22-3 and a molecular formula of C 24 H 32 N6O3 has a molecular weight of 452.55 and a structural formula as shown in the above formula (I). Currently, there is no research or report on the use of GSK3326595 in the treatment of renal cancer.
[0012] In some embodiments, the pharmaceutically acceptable salt refers to a pharmaceutically acceptable salt of GSK3326595. Specifically, a pharmaceutically acceptable salt of GSK3326595 refers to a salt form obtained by modifying GSK3326595 to form a salt suitable for use in pharmaceutical formulations and clinical applications. Salts used in the salt modification process include, but are not limited to, inorganic acid salts (e.g., hydrochlorides, sulfates, phosphates) and organic acid salts (e.g., citrates, maleates, tartrates). These salts are suitable for use in contact with patients within the scope of sound medical judgment and do not produce undue toxicity, irritation, or allergic reactions.
[0013] In some embodiments, examples of pharmaceutically acceptable salts of GSK3326595 include, but are not limited to, salts having (as counterions) alkali metal ions such as Na + 、Li + or K + or salts with alkaline earth metal ions such as Ca 2+ or Mg 2+ or any other pharmaceutically acceptable metal ion such as Zn 2+ or Al 3+ or a pharmaceutically acceptable salt formed with an organic base such as diethanolamine, ethanolamine, N-methylglucamine, triethanolamine or tromethamine.
[0014] In some embodiments, pharmaceutically acceptable base addition salts are formed with metals or amines, such as alkali metal and alkaline earth metal hydroxides or organic amines. Examples of metals used as cations include magnesium, potassium, sodium, calcium, and the like. Examples of suitable amines include N,N'-dibenzylethylenediamine, diethanolamine, chloroprocaine, choline, ethylenediamine, N-methylglucamine, or procaine.
[0015] In some embodiments, base addition salts of acidic compounds can be prepared by contacting the free acid form with a sufficient amount of the desired base in a conventional manner to form the salt. The free acid can be regenerated by contacting the salt form with an acid and isolating the free acid in a conventional manner.
[0016] In some embodiments, pharmaceutically acceptable salts may include cations based on alkali and alkaline earth metals, such as sodium, potassium, calcium, lithium, magnesium, and the like, as well as non-toxic ammonium, quaternary ammonium, and amine cations, including but not limited to ammonium, tetramethylammonium, methylamine, dimethylamine, tetraethylammonium, trimethylamine, triethylamine, ethylamine, and the like. Salts of amino acids, such as gluconate, arginate, galacturonate, and the like are also contemplated.
[0017] The second aspect of the present invention provides the use of a PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof in combination with an anti-PD-1 antibody in the preparation of a medicament for treating renal cancer.
[0018] Furthermore, the catalog number of the anti-PD-1 antibody is A2122 (Selleck), and the clone number is RMP1-14; the structural formula of the PRMT5 inhibitor GSK3326595 is shown in formula (I):
[0019]
[0020] Furthermore, the concentration ratio of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody is (50 mg / kg): (100 μg / piece).
[0021] In a specific embodiment of the present invention, the present invention has experimentally demonstrated for the first time that the combination of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody has a synergistic therapeutic effect in the treatment of renal cancer. This result is a technical effect that was unexpected by those skilled in the art based on the prior art, that is, the technical solution provided in the second aspect of the present invention has achieved an unexpected technical effect.
[0022] In the present invention, the anti-PD-1 antibody was purchased from Selleck, with the corresponding catalog number being A2122 and the clone number being RMP1-14, and can be purchased by those skilled in the art through conventional purchasing channels.
[0023] Furthermore, the drug further comprises a pharmaceutically acceptable carrier.
[0024] Furthermore, the pharmaceutically acceptable carrier is a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler and / or a disintegrant.
[0025] Furthermore, the dosage form of the drug is injection, tablet, capsule, powder, granule, inhalant, gel, microsphere and / or aerosol.
[0026] In some embodiments, the diluent includes but is not limited to sodium chloride, glucose, lactose, starch, urea, water, and the like.
[0027] In some embodiments, the binder includes but is not limited to: gum arabic, gelatin, starch, sucrose, pregelatinized starch, dextrin, alginic acid and alginates, maltodextrin, methyl cellulose, carboxymethyl cellulose, ethyl cellulose, polyvinyl alcohol, polyethylene glycol, polyvinyl pyrrolidone, xanthan gum, hydroxypropyl cellulose, hydroxypropyl methylcellulose, etc.
[0028] In some embodiments, the surfactant includes, but is not limited to, polyoxyethylene sorbitan fatty acid ester, stearic acid monoglyceride, sodium lauryl sulfate, cetyl alcohol, and the like.
[0029] In some embodiments, the humectant includes but is not limited to glycerol, starch, and the like.
[0030] In some embodiments, the adsorption carrier includes but is not limited to starch, lactose, kaolin, bentonite, silica gel, bentonite, etc.
[0031] In some embodiments, the lubricant includes but is not limited to talc, calcium and magnesium stearate, hydrogenated vegetable oil, zinc stearate, glyceryl monostearate, polyethylene glycol, boric acid powder, sodium stearyl fumarate, polyoxyethylene monostearate, monolauric sucrose ester, sodium lauryl sulfate, magnesium lauryl sulfate, magnesium dodecyl sulfate, etc.
[0032] In some embodiments, the filler includes but is not limited to sorbitol, glucose, lactose, mannitol, xylitol, maltose, microcrystalline cellulose, erythrose, polymeric sugars, coupling sugars, sucrose, dextrin, starch, calcium carbonate, sodium alginate, laminarin powder, agar powder, sodium bicarbonate, etc.
[0033] In some embodiments, the disintegrant includes but is not limited to: cross-linked vinyl pyrrolidone, sodium carboxymethyl starch, low-substituted hydroxypropyl methyl, cross-linked sodium carboxymethyl cellulose, soybean polysaccharide, etc.
[0034] In some embodiments, the pharmaceutically acceptable carrier can be one conventionally used in various preparations, including but not limited to: isotonic agents, buffers, flavoring agents, excipients, fillers, adhesives, disintegrants or lubricants, etc.; it can also be selected for use in order to be compatible with the substance, including but not limited to: emulsifiers, solubilizers, antibacterial agents, analgesics or antioxidants, etc. Such excipients can effectively improve the stability and solubility of the active ingredients contained in the composition or change the release rate and absorption rate of the active ingredients, thereby improving the metabolism of various active ingredients in the organism, and further enhancing the administration effect of the composition.
[0035] In addition, excipients may be used to achieve specific drug delivery purposes or methods, such as sustained-release, controlled-release, and pulsed delivery, including but not limited to gelatin, albumin, chitosan, polyether or polyester polymers (e.g., polyethylene glycol, polyurethane, polycarbonate, and copolymers thereof). These excipients may be beneficial for drug delivery, including improved therapeutic efficacy, increased bioavailability, reduced toxic side effects, and improved patient compliance.
[0036] The third aspect of the present invention provides a pharmaceutical composition.
[0037] Furthermore, the pharmaceutical composition is any one of the following:
[0038] (1) A pharmaceutical composition comprising the PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof as described in the first aspect of the present invention;
[0039] (2) A pharmaceutical composition comprising the PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof and the anti-PD-1 antibody described in the second aspect of the present invention.
[0040] In some embodiments, the pharmaceutical composition may further comprise other therapeutic compounds that can be used to treat and / or assist in the treatment of renal cancer.
[0041] In some embodiments, the other therapeutic compounds that can be used for the treatment and / or adjuvant treatment of renal cancer can be administered simultaneously with or separately from the main active ingredient in the pharmaceutical composition of the present invention (PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof, or PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof and the anti-PD-1 antibody). During the treatment process, the dosage of the pharmaceutical composition of the present invention can be adjusted according to the severity of the symptoms, the frequency of recurrence, and the physiological response to the treatment regimen.
[0042] A fourth aspect of the present invention provides a pharmaceutical preparation.
[0043] Furthermore, the pharmaceutical preparation comprises the pharmaceutical composition described in the third aspect of the present invention.
[0044] Furthermore, the dosage form of the pharmaceutical preparation is an injection dosage form, a respiratory tract dosage form, a cavity dosage form, a mucosal dosage form or a skin dosage form.
[0045] In some embodiments, the dosage form of the pharmaceutical preparation is a dosage form that is prepared by conventional methods and is convenient for administration, including but not limited to: parenteral dosage forms, gastrointestinal dosage forms, and specific examples include but are not limited to: aqueous solution injection, powder injection, pills, powders, tablets, patches, suppositories, emulsions, creams, gels, granules, capsules, aerosols, sprays, powder sprays, sustained-release agents or controlled-release agents, etc.
[0046] In some embodiments, when the pharmaceutical preparation is an injectable, the solvent is one or more of water for injection, physiological saline, and 5% glucose injection, and excipients such as pH adjusters, osmotic pressure regulators, and antioxidants may be added as needed. The pH adjusters are selected from one or more of hydrochloric acid, sodium hydroxide, and citric acid-sodium citrate buffer; the osmotic pressure regulators are selected from one or more of sodium chloride, glucose, and mannitol; and the antioxidants are selected from one or more of sodium sulfite, sodium metabisulfite, and sodium thiosulfate.
[0047] In some embodiments, the pharmaceutical composition or pharmaceutical preparation of the present invention may further comprise additives such as stabilizers, buffers, bactericides, isotonic agents, pH control agents, surfactants, and chelating agents.
[0048] In some embodiments, suitable modes of administration of the pharmaceutical composition or pharmaceutical formulation of the present invention include any of the various methods and delivery systems known to those skilled in the art to physically introduce the pharmaceutical composition or pharmaceutical formulation of the present invention into the subject, including but not limited to oral administration, topical administration, parenteral administration, administration by inhalation spray, rectal administration, nasal administration, buccal administration, or administration via an implanted drug reservoir, etc.
[0049] In some embodiments, when the pharmaceutical composition or pharmaceutical preparation as described above is actually used, its administration regimen and dosage regimen can be selected according to a variety of factors, including the type, species, age, weight, sex and type of disease being treated of the subject; the severity of the disease being treated; the route of administration; the renal and liver function of the patient; and the specific compound used or other forms of the compound. A dosing and / or dosage regimen can be used, for example, to prevent a disease, inhibit (completely or partially inhibit) a disease, or stop the development of the disease. In a specific embodiment of the present invention, the disease refers to renal cancer.
[0050] The fifth aspect of the present invention provides an in vitro method for inhibiting the growth of renal cancer cells and promoting apoptosis of renal cancer cells for non-therapeutic purposes.
[0051] Furthermore, the method comprises the following step: treating an in vitro renal cancer cell line with the pharmaceutical composition described in the third aspect of the present invention or the pharmaceutical preparation described in the fourth aspect of the present invention.
[0052] In a specific embodiment of the present invention, the present invention experimentally demonstrates for the first time that the combination of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody has a synergistic inhibitory effect on renal cancer cells or renal cancer tissues. Therefore, the combination of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody can be used as an inhibitor to inhibit the growth of renal cancer cells and promote apoptosis of renal cancer cells for non-therapeutic purposes, and can be used in scientific research, such as to further study the growth and metabolic mechanisms or behaviors of renal cancer cells and screen for potential drugs for the treatment of renal cancer.
[0053] In a specific embodiment of the present invention, the synergistic effect of the combination of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody was further verified using the King's formula. The King's formula is a method for evaluating the combined effects of drugs. A q calculated based on the King's formula greater than 1.15 indicates a synergistic effect between the two drugs.
[0054] In addition, the present invention also provides a method for treating renal cancer, comprising the following steps: administering a therapeutically effective amount of the pharmaceutical composition of the third aspect of the present invention or the pharmaceutical preparation of the fourth aspect of the present invention to a subject in need.
[0055] In some embodiments, the pharmaceutical composition or pharmaceutical preparation can be administered to the subject by injection, topical administration, or oral administration. For example, the method can include administering the pharmaceutical composition or pharmaceutical preparation to the subject three times a day, once a day, once every two days, etc.
[0056] In some embodiments, the administration by injection may include subcutaneous injection, intramuscular injection, intravenous injection, etc. In some embodiments, the administration by injection may include injecting the pharmaceutical composition directly into the lesion or an area near the lesion, and in some embodiments, local administration may include rectal administration, nasal administration, ear administration, intramedullary administration, intraarticular administration, intrapleural administration, etc., or any combination thereof. In some embodiments, the pharmaceutical composition or pharmaceutical preparation may be administered to a subject via a combination of different modes of administration.
[0057] In the present invention, the effective amount refers to the amount of the compound effective to produce the desired preventive, allergic, or therapeutic effect. The amount of the pharmaceutical composition or formulation of the present invention required to achieve an effective amount will vary depending on factors such as the compound, the symptoms and their severity, and the age of the mammal being treated. However, the specific amount can be routinely determined by a person of ordinary skill in the art based on their knowledge in the art and the disclosure herein.
[0058] In the present invention, the subject is an animal, preferably a mammal (human and non-human animals), and the mammal includes but is not limited to: humans, non-human primates (especially higher primates, such as macaques, crab-eating macaques, short-tailed macaques, bear monkeys, flat-topped monkeys, golden monkeys and tree shrews), sheep, dogs, rodents (such as mice or rats), guinea pigs, goats, pigs, cats, rabbits, cows, any livestock or pets, etc. In a preferred embodiment of the present invention, the subject is a human.
[0059] Compared with the prior art, the present invention has the following advantages and beneficial effects:
[0060] The present invention discovered for the first time that the PRMT5 inhibitor GSK3326595 can significantly inhibit the growth of renal cancer tissue. In addition, the combined use of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody has a synergistic inhibitory effect on the growth of renal cancer tissue, that is, the combination of the two for the treatment of renal cancer has a significant synergistic enhancement effect. The present invention provides a new treatment plan and an effective drug combination strategy for the treatment of renal cancer, and has broad application prospects in the technical field of developing drugs for the treatment of renal cancer. BRIEF DESCRIPTION OF THE DRAWINGS
[0061] Figure 1 Figure 1: Epigenetic compound screening process for ferroptosis in renal cancer cells. Figure A: Schematic diagram of the epigenetic compound library screening strategy. Figure B: 786-O cells were seeded in a 96-well plate and cultured for 24 hours. After treatment with 0.2 μM RSL3 combined with DMSO or 10 μM inhibitor, cell viability was assessed using a CCK-8 assay.
[0062] Figure 2 : Effect of PRMT5 on renal cancer cell viability after ferroptosis induction, wherein, Figures AF: After treatment with a PRMT5 inhibitor (PRMT5i, GSK3326595) (A and D), PRMT5 knockdown (B and E), or overexpression (C and F), 786-O and ACHN cells were treated with RSL3 for 12 hours, and cell viability was detected using the CCK-8 assay;
[0063] Figure 3: Comparative analysis of PRMT5 combined with mass spectrometry and the FerrDb database. Figure A: Screening strategy for identifying potential PRMT5-regulated substrates that affect ferroptosis; Figure B: Protein expression levels of potential PRMT5-regulated substrates in 786-O cells detected by Western blot.
[0064] Figure 4 : Interaction between PRMT5 and ACSL4, wherein, Panel A: co-IP experiment in 786-O cells to detect the endogenous interaction between PRMT5 and ACSL4; Panel B: co-IP experiment in HEK293T cells to detect the exogenous interaction between PRMT5 and ACSL4; Panel C: Pull-down experiment using purified GST-tagged PRMT5 and 786-O cell lysate (asterisk: position of GST-PRMT5);
[0065] Figure 5 : Effect of PRMT5 on ACSL4 protein level, wherein, Figures A, E, I, B, F, and J: co-IP experiments in 786-O cells to detect the endogenous interaction between PRMT5 and ACSL4; Figures C, G, K, D, H, and L: co-IP experiments in ACHN cells to detect the exogenous interaction between PRMT5 and ACSL4;
[0066] Figure 6 : PRMT5i (GSK3326595) promotes ferroptosis and inhibits tumor formation in renal cancer cells in vivo, wherein, Panel A: Tumor size images of different groups; Panels BC: Calculation of tumor volume (n=6) and tumor weight (n=6) of subcutaneous transplanted tumors; Panel D: Flow cytometry analysis of relative lipid peroxidation levels in tumor cells isolated from transplanted tumors; Panels EF: Quantitative analysis of Ki-67 and other staining intensities in transplanted tumors, *p<0.05; **p<0.01; ***p<0.001;
[0067] Figure 7 : PRMT5i (GSK3326595) combined with PD1 inhibitor (anti-PD-1 antibody) promotes ferroptosis and inhibits tumor formation in renal cancer cells. Panel A: Tumor size images of different groups; Panels BC: Calculation of tumor volume (n=6) and tumor weight (n=6) of subcutaneous transplanted tumors; Panel D: Flow cytometry analysis of relative lipid peroxidation levels in tumor cells isolated from transplanted tumors, *p<0.05; **p<0.01; ***p<0.001;
[0068] Figure 8: IHC detection of the levels of TIIC-related markers, among which, Figures AB: Quantitative analysis of the staining intensity of Ki-67, CD3, CD8a and GZMB in transplanted tumors, *p<0.05; **p<0.01; ***p<0.001. DETAILED DESCRIPTION
[0069] The present invention will be further described below with reference to specific embodiments. The following specific embodiments are intended only to illustrate the present invention and are not to be construed as limiting the present invention. Those skilled in the art will appreciate that various changes, modifications, substitutions, and variations may be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the claims and their equivalents.
[0070] The experimental consumables, reagents, and raw materials used in the present invention are readily available to those of ordinary skill in the art and, unless otherwise specified, can be obtained commercially. Experimental methods for which specific conditions are not specified in the present invention are generally performed under conventional conditions or as recommended by the manufacturer. In particular, the following examples are intended only to illustrate the present invention and should not limit the scope of the present invention in any way. It should be noted that the experimental conditions and results described in the following examples are intended only to illustrate the present invention and should not, and will not, limit the present invention described in detail in the claims.
[0071] Example 1 PRMT5 inhibits ferroptosis of renal cancer cells in vitro
[0072] 1. Experimental methods
[0073] (1) To search for epigenetic compounds that may be involved in the ferroptosis process of renal cancer cells, we initially screened a library of 765 epigenetic compounds using the RSL3-induced ferroptosis model of renal cancer cells.
[0074] (2) The siRNA sequences involved are shown in Table 1:
[0075] Table 1
[0076] Sense Anti-sense si-PRMT5-nc UUCUCCGAACGUGUCACGUTT ACGUGACACGUUCGGAGAATT si-PRMT5-#1 GCUAAUUGUGGGAAAGCUUTT AAGCUUUCCCACAAUUAGCTT si-PRMT5-#2 GCCAUCACUCUUCCAUGUUTT AACAUGGAAGAGUGAUGGCTT si-PRMT5-#3 CCAGCAGGCCAUCUAUAAATT UUUAUAGAUGGCCUGCUGGTT
[0077] (3) Transfection of siRNA
[0078] Seeding cells: Seed the cells one day before transfection to ensure that the cell density reaches about 40%-50% at the time of transfection.
[0079] Prepare transfection complex: add 4 μL siRNA to 200 μL Buffer, mix thoroughly, add 4 μL Reagent, mix gently again, and incubate at room temperature for 10 minutes.
[0080] To transfect cells: Remove the cell growth medium and add 2 mL of fresh, pre-warmed medium containing 10% FBS and 1% PS to each well. Add the previously prepared transfection complex directly to the cells and gently rock the plate to ensure even mixing.
[0081] After 24 or 48 hours of transfection, subsequent functional experiments (such as cell viability assay, Lipid ROS assay, Fe 2+ content analysis, immunoprecipitation, etc.), or collect cells for protein or RNA extraction for subsequent experiments.
[0082] (4) CCK-8 cell viability assay
[0083] Seeding: After digesting and counting cells from each treatment group, resuspend the cells in serum-containing medium and seed 2000 renal cancer cells each from PRMT5-overexpressing, PRMT5-knockdown, PRMT5 inhibitor-treated, and control groups into the corresponding wells of a 96-well plate. Add 200 μL of PBS to the remaining wells to serve as blank controls.
[0084] Induction: Cells were induced with different concentrations of RSL3 and Erastin for 12 hours.
[0085] Detection: After cells have adhered, add culture medium containing CCK-8 assay solution to each well (culture medium to CCK-8 solution ratio of 9:1 by volume). Place the 96-well plate in an incubator and incubate for 1.5 hours. After incubation, measure absorbance using a microplate reader.
[0086] The absorbance of each sample was measured at 450 nm using a microplate reader. Statistical analysis was performed based on the results to evaluate cell viability in the different treatment groups.
[0087] 2. Experimental results
[0088] The results are as follows Figure 1 As shown in the results, multiple PRMT5 inhibitors such as LLY-283, GSK595, BRD0639, and HLCL-61 can significantly promote RSL-3-induced ferroptosis of renal cancer cells (human renal cancer cell line 786-O, Shanghai Cell Bank, Chinese Academy of Sciences). Among them, the promoting effect of HLCL-61 is the most obvious, which suggests the potential role of PRMT5 in inhibiting ferroptosis of cancer cells.
[0089] To confirm whether PRMT5 is involved in the ferroptosis process of renal cancer cells, we added the ferroptosis inducer RSL3 to two renal cancer cells (786-O and ACHN) treated with PRMT5i (GSK3326595), knocked down PRMT5, or overexpressed PRMT5, and then performed cell viability assays. The results showed that PRMT5i treatment and knockdown of PRMT5 inhibited the cell viability of renal cancer cells (see Figure 2 A and B, D and E in Figure 3), whereas overexpression of PRMT5 promoted the cell viability of renal cancer cells (see Figure 2 C and F in Figure 5).
[0090] Example 2 PRMT5 binds to and inhibits the expression of ACSL4
[0091] 1. Experimental methods
[0092] (1) Transfection of plasmid DNA
[0093] Seed the cells one day before transfection to ensure that the cell density reaches about 70%-80% at the time of transfection.
[0094] Preparation of DNA-Lipo8000 TM Complex: First, add 2 μL of target DNA to 100 μL of serum-free medium and mix thoroughly to form a DNA dilution solution. Then, immediately add 4 μL of Lipo8000 TM Add transfection reagent and mix gently.
[0095] Incubate at room temperature for 10-15 minutes to ensure stable transfection reagent complex formation.
[0096] Before cell transfection, remove the cell growth medium and replace it with pre-warmed medium containing 10% FBS and 1% PS. Then, gently add 100 μL of the prepared complex to each well and gently shake the culture plate to ensure even distribution of the mixture.
[0097] Place the plate in a 37°C, 5% CO2, saturated humidity incubator and continue incubation. Replace the culture medium 12-24 hours after transfection and collect whole-cell protein or RNA 48 hours later for subsequent experiments.
[0098] (2) Co-immunoprecipitation
[0099] Cell transfection was performed according to the previous steps, and 36-48 hours after transfection, the transfected cells were collected for co-immunoprecipitation experiments.
[0100] Discard the supernatant and wash the cell surface in the culture dish with 3-5 mL of PBS. Then add 1 mL of fresh PBS and gently scrape the cells from the culture dish and collect them in a 1.5 mL EP tube.
[0101] The ratio of Western lysis buffer to IP lysis buffer is Cocktail: 100: 1. Add 1 mL of the prepared lysis buffer to each EP tube.
[0102] Place the EP tube on ice and sonicate twice at 10% intensity for 10 seconds each. After lysis, centrifuge the sample at 12,000 rpm for 10 minutes in a refrigerated centrifuge. Collect the supernatant for subsequent experiments.
[0103] Take 1 / 10 of the supernatant as the total protein solution (Input) for subsequent analysis.
[0104] The magnetic bead pretreatment steps are as follows: Based on the required amount for each sample, pipette 25 μL of magnetic beads into a new EP tube (with the pipette tip cut off to avoid scratching the beads). Add an appropriate amount of 1× PBST solution and wash twice. Then, place the tube on a magnetic stand to separate the magnetic bead pellet using magnetic force, and discard the supernatant.
[0105] The EP tube was sealed and fixed with a sealing film, placed in a 4°C refrigerator, and rotated overnight by a Ferris wheel.
[0106] The next day, remove the overnight EP tube and place it on a magnetic rack. Discard the supernatant. Wash the magnetic beads with 1 mL of PBS for 5 minutes each time, three times, and discard the PBS.
[0107] Add 80 μL of 1× Loading Buffer and denature the protein sample at high temperature for 10 minutes. After treatment, proceed directly to the next step of Western Blot verification or store the sample in a refrigerator at 20°C until further use.
[0108] Western blot analysis is used to analyze the expression of the target protein in the input and IP samples. The specific steps include: first, loading the treated samples onto the gel, separating the proteins by electrophoresis, then transferring to a PVDF membrane, incubating with appropriate antibodies, and finally analyzing the band intensity and position of the target protein by chemiluminescence or other detection methods to evaluate its expression in different samples.
[0109] (3) The siRNA sequences involved are shown in Table 2:
[0110] Table 2
[0111] Forward(5'-3') Reverse(3'-5') ACSL4 GCTATCTCCTCAGACACACCGA AGGTGCTCCAACTCTGCCAGTA PRMT5 CTAGACCGAGTACCAGAAGAGG CAGCATACAGCTTTATCCGCCG
[0112] 2. Experimental results
[0113] To explore the molecular mechanism by which PRMT5 inhibits ferroptosis in renal cancer cells, we performed mass spectrometry analysis of PRMT5 protein binding. By comparing the potential binding proteins of PRMT5 in protein binding mass spectrometry with ferroptosis-related markers in the ferroptosis-related research database FerrDb, we obtained 25 potential substrates of PRMT5 and ranked them according to the number of binding peptides (see Figure 3 ). Validation of the top potential substrates showed that only the expression of long-chain acyl-CoA synthetase 4 (ACSL4) was upregulated after knockdown of PRMT5 in renal cancer cells, while the expression of other substrates did not change significantly (see Figure 3 Figure B in the figure).
[0114] Subsequently, we performed co-immunoprecipitation assays (co-IP) and the results showed that there is an endogenous interaction between PRMT5 and ACSL4 (see Figure 4 At the same time, MYC-PRMT5 and Flag-ACSL4 plasmids were co-transfected into HEK293T cells, and co-IP was performed to verify the exogenous interaction, and consistent results were obtained (see Figure 4 In addition, GST pulldown experiments confirmed the binding of GST-PRMT5 to ACSL4 (see Figure 4 Figure C in the figure).
[0115] Subsequently, we further verified the regulatory role of PRMT5 on ACSL4 expression. First, knockdown of PRMT5 and induction of PRMT5 inhibitors significantly increased the protein level of ACSL4, but there was no significant change in the transcription level of ACSL4 (see Figure 5 In contrast, overexpression of PRMT5 inhibited the protein expression of ACSL4 and had no significant effect on the transcription level of ACSL4 (see Figures A-H in the Figures B-C). Figure 5 IL diagram in ).
[0116] Example 3 PRMT5 inhibitors enhance the efficacy of immunotherapy by promoting ferroptosis in renal cancer cells
[0117] 1. Experimental Materials
[0118] (1) Experimental reagents
[0119] Anti-PD-1 antibody was purchased from Selleck, with the corresponding clone number RMP1-14 and catalog number A2122; control IgG antibody was purchased from Selleck, with the corresponding clone number 2A3 and catalog number A2123.
[0120] (2) Experimental cells
[0121] The human renal cancer cell line 786-O was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences, and the mouse renal cancer cell line RenCa was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.
[0122] (3) Experimental animals
[0123] This study used female BALB / c nude mice and BALB / c mice aged 4-6 weeks, purchased from Beijing Weitonglihua Laboratory Animal Technology Co., Ltd. The animals were maintained in an SPF-free environment at the Experimental Animal Center of Xuzhou Medical University and fed an autoclaved laboratory rodent diet. All animal experiments were conducted in strict accordance with the regulations of the Xuzhou Medical University Laboratory Animal Ethics Committee.
[0124] 2. Experimental methods
[0125] (1) Mouse subcutaneous tumor implantation model
[0126] Prepare the 786-O cell lines required for the experiment in advance, including blank control group, Fer-1 treatment group, PRMT5i (GSK3326595) treatment group and Fer-1 + PRMT5i (GSK3326595) treatment group, and perform tumor proliferation.
[0127] When preparing the injection solution, take the same cell suspension and mix it thoroughly with Matrigel. After mixing evenly, place the mixture in a 1.5 mL EP tube. Ensure that the number of cells in each 200 μL of the mixture is 5×10 6 . After marking, place it in an ice box for later use.
[0128] When inoculating cells, inoculate 200 μL of the cell mixture subcutaneously in each mouse. Label the mice as needed for the experiment.
[0129] The condition of the nude mice and the transplanted tumors were observed regularly every day. When the tumor growth was visible to the naked eye and there was no obvious absorption, the next drug treatment stage was entered.
[0130] At week 2 after inoculation, when subcutaneous tumors had formed, all four groups of animals were injected intratumorally with the ferroptosis inducer RSL3 (100 mg / kg, twice a week) for 14 days. Simultaneously, two of the groups received the ferroptosis inhibitor fer-1 (2 μg / mg, intraperitoneal injection daily) for 14 days.
[0131] After drug induction for 14 days, the experiment was terminated. The nude mice were killed by CO2 asphyxiation, and the subcutaneous tumors were removed and fixed in 4% paraformaldehyde.
[0132] (2) Immunohistochemistry (IHC) staining
[0133] Preparation: Turn on the sheet drying machine the day before, set the temperature to 65°C, and bake the sheet overnight until the residual wax on the surface is completely melted.
[0134] Dewaxing and hydration: After taking out the slices, immediately immerse them in xylene I, II, and III in sequence for 10 minutes each time, for a total of 3 times; then immerse them in anhydrous ethanol I and II in sequence for 5 minutes each time, for a total of 2 times, then immerse them in 95% ethanol for 5 minutes, 85% ethanol and 75% ethanol for 5 minutes each, and finally wash them with freshly prepared 1× PBS for 3 minutes, and repeat 3 times.
[0135] Antigen retrieval: Use a hot water bath. Set the water bath to 95°C. Once the water bath reaches the set temperature, add enough citric acid (pH 6.0) retrieval solution to the histochemical cassette to completely cover the sections. Place the cassette in the water bath for antigen retrieval. After 30 minutes of retrieval, remove the cassette and allow it to cool to room temperature for 1 hour.
[0136] Wash the sections with 1×PBS for 5 min × 3 times.
[0137] Add 3% H2O2 to each section to ensure that the tissue is completely covered, and then place the section in a light-proof humidified box for 10 minutes to remove peroxidase.
[0138] Wash the sections with 1×PBS for 5 min × 3 times.
[0139] The sections were blocked with 1× goat serum in a humidified chamber for 30 minutes.
[0140] Dilute the primary antibody (PRMT5 1:200, Ki-67 1:200) in 1× PBS and mix thoroughly. Then, add 30-60 μL of the antibody solution to each section, ensuring that the antibody completely covers the tissue, and incubate in a humidified chamber at 4°C overnight.
[0141] The next day, the wet box was taken out of the refrigerator and warmed to room temperature for 1 hour. The sections were then washed with 1× PBS for 3 minutes each time for a total of 3 washes.
[0142] Incubation with secondary antibody: Use rabbit antibody for incubation, first add enhancement solution, incubate at room temperature for 30 minutes, then wash twice with PBS, then add secondary antibody and continue incubation at room temperature for 30 minutes.
[0143] DAB color development: Cover the tissue surface with the color development solution and use a timer to measure the time. Observe in real time under a microscope. Stop the color development immediately when brownish-yellow particles appear on the slice. Process other tissue sections based on the color development time. After color development is complete, place the slices on a rack, facing away from a water source, and rinse with running distilled water.
[0144] Counterstaining nuclei with hematoxylin: Soak the tissue section in hematoxylin solution and lift it up and down 2 to 3 times to ensure uniform staining.
[0145] Dehydration and mounting: The dehydration and mounting process is as follows: Soak the sections in 75% ethanol, 85% ethanol, 95% ethanol, and absolute ethanol for 5 minutes each, followed by immersion in xylene for 5 minutes, repeating twice. Finally, mount the sections with neutral gum and photograph under a microscope.
[0146] (3) IHC scoring criteria
[0147] Three senior professionals used a double-blind method to perform IHC grading assessment: brown-yellow granular precipitation in the cytoplasm or nucleus was considered positive. First, based on the proportion of positive cells, it was divided into five levels: 0, 1-25%, 26-50%, 51-75%, and 76-100%, corresponding to 0 to 4 points respectively; secondly, based on the staining intensity, it was divided into 0 to 3 points, where no staining was 0 points, yellow was 1 point, brown-yellow was 2 points, and yellow-brown was 3 points. Finally, the score was calculated according to the product of the two values, and the higher the score, the stronger the expression. The expression of PRMT5 was divided into low expression 0-6 points and high expression 7-12 points.
[0148] (4) Data Analysis
[0149] Experimental data were analyzed and statistically analyzed using SPSS V22.0 and GraphPad Prism 8 software. Data between two groups were compared using the t-test; data from three or more groups were compared using one-way analysis of variance; and repeated-measures variables were compared using multivariate analysis of variance. Continuous data are presented as mean ± standard deviation (X ± s). At the hypothesis testing level of α = 0.05, p < 0.05 was considered statistically significant. In the figures, * indicates p < 0.05, ** indicates p < 0.01, and *** indicates p < 0.001.
[0150] 3. Experimental results
[0151] In previous studies, we have demonstrated that PRMT5 inhibitors (PRMT5i, GSK3326595) can promote ferroptosis in renal cancer cells in vitro. To further investigate the effect of PRMT5i (GSK3326595) on tumor ferroptosis in vivo, we subcutaneously transplanted 786-O cells (renal cancer cells) into BALB / c nude mice and intratumorally injected RSL3 into all tumors (see Figure 6 Tumor growth curves and weight measurements showed that PRMT5i (GSK3326595) significantly inhibited tumor growth (see Figure 6In addition, lipid peroxidation levels were significantly increased in PRMT5i-treated tumors (see Figures B and C). Figure 6 Immunohistochemistry (IHC) results showed that PRMT5i (GSK3326595) inhibited tumor growth by reducing Ki-67 expression (see Figure 6 E and F in Figure 5).
[0152] In addition, we further explored whether PRMT5 inhibitors (GSK3326595) could promote immunotherapy-induced ferroptosis in vivo. We established a mouse xenograft model by injecting Renca cells (renal cancer cells) into BALB / c mice. The mice were then divided into four groups and received IgG antibody (injection dose of 100 μg / mouse), anti-PD-1 antibody (injection dose of 100 μg / mouse), PRMT5 inhibitor (GSK3326595, injection dose of 50 mg / kg) or anti-PD-1 antibody + PRMT5 inhibitor (the injection doses of anti-PD-1 antibody and PRMT5 inhibitor GSK3326595 were 100 μg / mouse and 50 mg / kg, respectively) combined treatment (see Figure 7 Compared with anti-PD-1 antibody alone, the combination therapy significantly inhibited tumor growth (see Figure 5A). Figure 7 We also observed that the level of lipid peroxidation in tumors from the combined treatment group was significantly higher than that in the other treatment groups (see Figures B and C in the Supplementary Table). Figure 7 Figure D in the figure).
[0153] Using King's formula expression q=E A+B / (E A +E B -E A ×E B ) to judge whether the effect of the combined use of the two is better than that of using them alone, where E A+B is the inhibition rate of GSK3326595+anti-PD-1 antibody on tumor tissue growth, E A is the inhibition rate of GSK3326595 on tumor tissue growth, E B is the inhibition rate of a single anti-PD-1 antibody on tumor tissue growth; if q = 0.85-1.15, it is a simple superposition, 1.15 < q < 20 is synergy, q > 20 is significant synergy, q < 0.85 is antagonism, that is, when q > 1.15, it can be determined that the inhibitory effect of GSK3326595 and anti-PD-1 antibody on the growth of renal cancer tissue is a synergistic effect, rather than a simple superposition.
[0154] Specifically, regarding the tumor weight of each group ( Figure 7(Figure C in the figure), the tumor weight of the control group was 0.663g, the tumor weight of the PRMT5 inhibitor GSK3326595 treatment group was 0.384g, the tumor weight of the anti-PD-1 antibody treatment group was 0.177g, and the tumor weight of the PRMT5 inhibitor GSK3326595 + anti-PD-1 antibody combination treatment group was 0.017g. The calculation results of the renal cancer tissue growth inhibition rate of each group are as follows:
[0155]
[0156] The synergistic q value was calculated using King's formula. Substituting the calculated inhibition rate of renal cancer tissue into the result, we can see that q = E A+B / (E A +E B -E A ×E B )=97.44% / (42.08%+73.30%-42.08%×73.30%)=1.153, q>1.15, indicating that the inhibitory effect of PRMT5 inhibitor GSK3326595 and anti-PD-1 antibody on the growth of renal cancer tumor tissue is synergistic, that is, the combined use of the two in the treatment of renal cancer shows a synergistic therapeutic effect.
[0157] IHC results showed that the combination of anti-PD-1 antibody and PRMT5 inhibitor GSK3326595 synergistically reduced the level of Ki-67 in Renca tumor cells and increased the levels of tumor-infiltrating immune cell (TIIC)-related markers, including CD3, CD8a, and GZMB (see Figure 8 In summary, the combination of the PRMT5 inhibitor GSK3326595 and anti-PD-1 antibody enhanced the efficacy of immunotherapy and promoted ferroptosis of tumor cells in vivo.
Claims
1. Use of PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating renal cancer, wherein Characterized in that, the structural formula of the PRMT5 inhibitor GSK3326595 is as shown in formula (I): Formula (I).
2. The use according to claim 1, characterized in that The drug further comprises a pharmaceutically acceptable carrier.
3. Use of the PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof in combination with an anti-PD-1 antibody in the preparation of a drug for treating renal cancer, characterized in that: The catalog number of the anti-PD-1 antibody is A2122 (Selleck), and the clone number is RMP1-14; the structural formula of the PRMT5 inhibitor GSK3326595 is shown in formula (I): Formula (I).
4. The use according to claim 3, characterized in that The concentration ratio of the PRMT5 inhibitor GSK3326595 and the anti-PD-1 antibody is (50 mg / kg): (100 μg / piece).
5. The use according to claim 3, characterized in that The drug further comprises a pharmaceutically acceptable carrier.
6. The use according to claim 5, characterized in that The pharmaceutically acceptable carrier is a diluent, a binder, a surfactant, a wetting agent, an adsorption carrier, a lubricant, a filler and / or a disintegrant.
7. The use according to claim 3, characterized in that The dosage form of the drug is injection, tablet, capsule, powder, granule, inhalant, gel, microsphere and / or aerosol.
8. A pharmaceutical composition, characterized in that The pharmaceutical composition is any one of the following: (1) A pharmaceutical composition comprising the PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof as claimed in claim 1; (2) A pharmaceutical composition comprising the PRMT5 inhibitor GSK3326595 or a pharmaceutically acceptable salt thereof as claimed in claim 3 and the anti-PD-1 antibody.
9. A pharmaceutical preparation, characterized in that: The pharmaceutical preparation comprises the pharmaceutical composition according to claim 8; Optionally, the dosage form of the pharmaceutical preparation is an injection dosage form, a respiratory tract dosage form, a cavity dosage form, a mucosal dosage form or a skin dosage form.
10. A method for inhibiting the growth of renal cancer cells and promoting apoptosis of renal cancer cells in vitro for non-therapeutic purposes, characterized in that: The method comprises the following steps: treating an in vitro renal cancer cell line with the pharmaceutical composition according to claim 8 or the pharmaceutical preparation according to claim 9.
Citation Information
Patent Citations
Treatment of renal cancer using a combination of an Anti-PD-1 antibody and another Anti-cancer agent
CN106255510A
Combination of PRMT5 inhibitors and BCL-2 inhibitors
CN112912083A
PRMT5 inhibitor and application thereof
CN113045543A
PRMT5 inhibitor and application of combination of PRMT5 inhibitor and PD-L1 antibody blocking agent in lung cancer treatment
CN113908283A
Mixed formulations for sensitizing PD-1 antibodies and methods of use thereof
CN116196415A