Application of OsPUB16 gene in brown planthopper resistance of rice

Abstract

The invention discloses an application of an OsPUB16 gene in brown planthopper resistance of rice. The nucleotide sequence of the OsPUB16 gene is as shown in SEQ ID NO. 1, and the amino acid sequence of the protein coded by the OsPUB16 gene is as shown in SEQ ID NO. 2. The OsPUB16 gene is subjected to overexpression and knockout, and after resistance identification, it is found that the overexpression of the OsPUB16 gene can reduce the resistance of rice to brown planthopper, and the knockout of the OsPUB16 gene can improve the resistance of rice to brown planthopper. The discovery of the invention provides a new thought and direction for breeding rice varieties with higher brown planthopper resistance.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to application of the OsPUB16 gene in rice resistance to brown planthoppers. Background Art

[0002] The brown planthopper (Nilaparvata lugens) is a major pest in rice-growing areas. Its explosive growth and migratory nature can cause widespread and severe damage.

[0003] Currently, chemical pesticides are the primary method of controlling brown planthoppers. However, the overuse of pesticides not only increases farmers' production and labor costs but also causes irreversible damage to the environment. Furthermore, pesticides can kill the brown planthopper's natural enemies, increasing the pest's resistance and potentially triggering a resurgence of the insecticide. Utilizing rice resistance genes to breed insect-resistant varieties is currently the most cost-effective control strategy. The International Rice Research Institute (IRRI) has demonstrated in its practice of controlling brown planthoppers that planting rice varieties with varying resistance can effectively control the rapid growth of brown planthopper populations and, to a certain extent, slow the rate of biotype or virulence mutation, thereby achieving long-lasting resistance. Therefore, the continuous discovery and cloning of new resistance genes and their application in breeding are key research topics for the comprehensive control of brown planthoppers. Furthermore, the cloning of resistance genes and the elucidation of their insect resistance mechanisms will enrich the research findings of rice functional genomics.

[0004] The ubiquitin-proteasome system (UPS), a highly conserved protein-selective degradation mechanism in eukaryotes, plays a core regulatory role in plant development and stress responses by marking target proteins with polyubiquitination. Previous studies have shown that PUB family members are involved in a variety of physiological processes: Wang et al. found that OsPIE3 (a PUB16 ortholog) negatively regulates rice blast resistance by degrading the β-lectin receptor kinase PID2. Lv et al. demonstrated that OsPUB16 inhibits ABA and JA biosynthesis through the SAPK9-OsMADS23-OsAOC signaling cascade, thereby reducing drought tolerance. Although these studies have revealed the function of PUB16 in stress responses, its response mechanism to brown planthoppers has not yet been elucidated. Summary of the Invention

[0005] The purpose of the present invention is to provide an application of the OsPUB16 gene in rice resistance to brown planthoppers.

[0006] The technical solution adopted in the present invention is as follows: OsPUB16 protein, wherein the OsPUB16 protein is selected from the group consisting of: (A) a protein having the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing; (B) A protein comprising an amino acid sequence having 95% or more, preferably 98% or more, more preferably 99% or more identity with the amino acid sequence shown in SEQ ID NO. 2 and having the same function.

[0007] Furthermore, the protein (B) can be obtained by replacing, substituting, adding or deleting one or more amino acids in the sequence of (A).

[0008] The above-mentioned OsPUB16 protein encoding gene OsPUB16 is selected from: (A) a DNA molecule having the base sequence shown in SEQ ID NO. 1 in the sequence listing; (B) a DNA molecule encoding a protein having the amino acid sequence shown in SEQ ID NO. 2 in the sequence listing; (C) A DNA molecule having a base sequence that is 95% or more, preferably 98% or more, more preferably 99% or more identical to the base sequence shown in SEQ ID NO. 1 and having the same function.

[0009] A vector for knocking out the above-mentioned OsPUB16 gene. In one embodiment, the vector is a CRISPR / Cas9 vector for the above-mentioned OsPUB16 gene. The CRISPR / Cas9 vector is generated using an optimized Cas9 gene (Ma et al., 2013, A Robust CRISPR / Cas9 System for Convenient, High-Efficiency Multiplex Genome Editing in Monocot and Dicot Plants. Molecular Plant. 2015), comprising an expression cassette and a final vector, wherein the expression cassette contains an sgRNA that specifically targets OsPUB16, and its DNA sequence is: CCTTGATCACTTGGAGGTGG. After the expression cassette and the final vector are connected and transferred into rice, the sgRNA can guide Cas9 to cut the target gene OsPUB16, thereby causing the gene to mutate and cause its loss of function.

[0010] A method for constructing the above-mentioned CRISPR / Cas9 vector, the method comprising: 1) According to the website http: / / skl.scau.edu.cn / home / , based on the PAM site with the terminal sequence of NGG, a 20 bp specific target sequence targeting the N-terminus of the OsP UB16 coding region was selected as follows: CCTTGATCACTTGGAGGTGG; 2) Primers were designed according to the target DNA sequence, and BsaI restriction sites were added to both ends of the primers. The primer sequences were as follows: UF: CTCCGTTTTACCTGTGGAATCG, OsPUB16-5'BsaI-gRT1: 5'-CGATGACCTTGATCACTTGGAGGgttttagagctagaaat-3', gRNA-R: CGGAGGAAAATTCCATCCAC, OsPUB16-3'BsaI-OsU3T1: 5'-ACGTCGCCACCTCCAAGTGATCAgccacggatcatctgc-3'; B1': TTCAGAggtctcTctcgCACTGGAATCGGCAGCAAAGG, B2: AGCGTGggtctcGtcagGGTCCATCCACTCCAAGCT C; 3) Using the intermediate vector as a template, three rounds of PCR amplification were performed using three primer pairs: UF / OsPUB16-3'BsaI-OsU3T1, OsPUB16-5'BsaI-gRT1 / gRNA-R, and B1' / B2, respectively, to obtain an expression cassette with a linker; 4) After amplification, the final product is purified and recovered by gel excision. The final vector pYLCRISPR / Cas9, restriction enzymes, and T4 ligase are added and ligated simultaneously according to a specific system. 5) The ligation product was transformed into Escherichia coli strain DH5α, coated with kanamycin-resistant medium, and colony PCR screening was performed to obtain positive transformants; the positive transformants and the plasmid of the final vector pH-Ubi-cas9-7 were separately extracted and recombined at a 1:1 ratio using the LR enzyme in the Gateway system. The two were transformed into Escherichia coli strain DH5α and coated with spectinomycin-resistant medium to obtain transformants. The plasmid of the transformants was extracted and sent for sequencing. The positive transformants were the final CRISPR / Cas9 vector, named pH-Ubi-cas9-pub16:sgRNA.

[0011] Application of the above-mentioned OsPUB16 protein or its encoding gene or the CRISPR / Cas9 vector of its encoding gene in improving plant resistance to brown planthopper.

[0012] In the above application, the plant is preferably a monocotyledonous plant or a dicotyledonous plant, and the monocotyledonous plant is rice.

[0013] A method for cultivating transgenic plants, comprising the following steps: introducing the gene encoding the OsPUB16 protein into a target plant to obtain a transgenic plant, wherein the transgenic plant is sensitive to feeding by brown planthoppers; or introducing a CRISPR / Cas9 vector encoding the gene into a target plant to obtain a knockout transgenic plant, wherein the transgenic plant has significant resistance to feeding by brown planthoppers.

[0014] In the above method, the gene encoding the OsPUB16 protein is introduced into the target plant via a recombinant vector; The recombinant vector is a recombinant vector obtained by inserting the coding gene of the protein OsPUB16 into an expression vector, for example, a recombinant vector prepared by the above-mentioned method; the plant is a monocot or a dicot, and the monocot is rice.

[0015] In the above method, the transgenic plant has significant resistance to feeding by brown planthoppers, which is specifically reflected in that after feeding by brown planthoppers, the honeydew area, feeding preference and insect body weight of the transgenic plant are reduced.

[0016] Plant expression vectors include but are not limited to pCambia2300, pCambia1300, pCambia1301, pCambia3301, pWM101, and the like; rice varieties are preferably those sensitive to RGSV, such as Zhonghua 11, Xiushui 11, Nipponbare, and Wu 3; and the transformation method for rice tissues or cells can be selected from Agrobacterium-mediated method, gene gun method, electroporation method, pollen tube introduction method, liposome fusion method, and any other method for introducing plasmids.

[0017] Those skilled in the art will appreciate that a protein can be modified by replacing, substituting, adding, or deleting one or more amino acids in its sequence without altering its function. Therefore, the present invention should be understood to include such modifications to the (OsPUB16) protein shown in SEQ ID NO: 2.

[0018] The base sequence of the OsPUB16 gene is not limited to that shown in SEQ ID NO: 1 in the sequence listing, but also includes DNA sequences comprising a combination of codons corresponding to amino acid residues in OsPUB16 and the modified OsPUB16 protein described above. Codon selection can be performed according to conventional methods or based on the codon preference of the host cell.

[0019] Experiments of the present invention have shown that OsPUB16 is overexpressed and sensitive to feeding by brown planthoppers. The rice OsPUB16 gene is knocked out by CRISPR / Cas9 to obtain an OsPUB16 mutant that is resistant to feeding by brown planthoppers.

[0020] The significant advantages of the present invention are: (1) The OsPUB16 gene of the present invention is an insect-resistant gene and can be well applied in insect-resistant breeding of hybrid rice.

[0021] (2) OsPUB16 knockout rice has strong resistance to brown planthoppers. Highly resistant plants can be quickly identified at the seedling stage, and susceptible plants can be eliminated in a timely manner. This not only saves production costs, but also improves the selection efficiency of resistant materials and shortens the breeding cycle of rice varieties. This is of great significance for insect-resistant breeding. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] Figure 1 : Identification of OsPUB16 overexpression (A) and knockout mutant (B) materials.

[0023] Figure 2 : Phenotypic diagram and honeydew detection of brown planthoppers after feeding on OsPUB16 genetic material.

[0024] Figure 3 : The weight of brown planthoppers after feeding on OsPUB16 genetic material.

[0025] Figure 4 : Statistics of brown planthopper's avoidance to OsPUB16 genetic material.

[0026] Figure 5 : Feeding preference test device. DETAILED DESCRIPTION

[0027] In order to make the contents of the present invention easier to understand, the technical solutions of the present invention are further described below in conjunction with specific implementation methods, but the present invention is not limited thereto.

[0028] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0029] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0030] Example 1. Obtaining OsPUB16 protein and its encoding gene 1. Obtaining the OsPUB16 protein and its encoding gene The rice OsPUB16 sequence is publicly available in the Rice Genome Annotation Database (http: / / rice.plantbiology.msu.edu / ) and can be retrieved through LOC_Os01g66130. The DNA sequence starting from the ATG initiation codon of the OsPUB16 CDS sequence was truncated, and PCR primers were designed: OsPUB16 CDS-F: 5′-ATGGATTCAGTGTCATTGTCA-3′, OsPUB16CDS-R: 5′-TTACCCTCTCCCAACCCTGAC-3′.

[0031] 2. Cloning of the full-length sequence of OsPUB16 and obtaining a recombinant vector containing the fragment Primers were designed based on the sequences shown in SEQ ID NOs. 1 and 2, and the required restriction sites were added to both ends of the primers. The primer sequences were OsPUB16-5'SfiI: 5'-GGCCATTACGGCCATGGATTCAGTGTCATTGTCA-3', OsPUB16-3'Sfi I: 5'-GGCCGAGGCGGCCTTACCCTCTCCCAACCCTGAC-3'.

[0032] Total RNA from Oryza sativa L. japonica cv. Zhonghua 11 (Xu Yu et al., "Cloning of the 'Zhonghua 11' Rice Glutenin Gt1 Gene and Construction of a Waxy Gene Promoter-Directed Gt1 Gene Expression Vector," Journal of Shanghai Normal University (Natural Science Edition), Vol. 39, No. 2, April 2010, p. 204, publicly available from Peking University) was extracted using Invitrogen's TRIzol Reagent according to the manufacturer's instructions. Reverse transcription was performed using the company's SuperScript II Reverse Transcriptase to generate cDNA. The primer used for reverse transcription was a 16-nucleotide Oligod(T) primer.

[0033] The cDNA obtained by reverse transcription was used as a template and the primers OsPUB16-5'Sfi I and OsPUB16-3'Sfi I were used to perform PCR (Polymerase Chain Reaction) reaction to obtain a PCR product having the nucleotide sequence shown in SEQ ID NO. 1 in the sequence listing.

[0034] After recovering the PCR product, it was digested with the restriction endonuclease SfiI to recover the digestion product; the vector pCambia2300 was digested with the restriction endonuclease SfiI to recover the vector backbone; the digestion product and the vector backbone were ligated with T4 ligase and transformed into Escherichia coli strain DH5α to obtain transformants. The plasmid extracted from the transformant was sequenced. The correct plasmid was obtained by inserting the OsPUB16 gene shown in SEQ ID NO. 1 in the sequence listing between the SfiI restriction sites of the vector pCambia2300. This plasmid was designated pCambia2300-OsPUB16 and is the recombinant vector.

[0035] Example 2. Preparation of genetic materials for OsPUB16 overexpression and OsPUB16 CRISPR / Cas9 mutants 1. Construction of expression vector 1) Construction of pCambia2300-OsPUB16 is shown in Example 1.

[0036] 2) Based on the website http: / / skl.scau.edu.cn / home / and the PAM site at the end of the NGG sequence, a 20-bp specific target sequence targeting the N-terminus of the OsPUB16 coding region was selected as follows: CCTTGATCACTTGGAGGTGG. Primers were designed based on the target DNA sequence and BsaI restriction sites were added to both ends of the primers. The primer sequences were: UF: CTCCGTTTTACCTGTGGAATCG, OsPUB16-5'BsaI-gRT1: 5'-CGATGACCTTGATCACT Using the intermediate vector as a template, three rounds of PCR amplification were performed using three primer pairs: UF / OsPUB16-3'BsaI-OsU3T1, OsPUB16-5'BsaI-gRT1 / gRNA-R, and B1' / B2, respectively, to obtain the expression cassette with a linker. After amplification, the final product was purified and recovered by gel excision. The final vector pYLCRISPR / Cas9, along with restriction enzymes and T4 ligase, was added and ligated simultaneously according to a specific system. The ligation product was transformed into E. coli DH5α, coated with Cannabinoid-resistant medium, and screened for positive transformants using colony PCR. The positive transformants and the plasmids of the final vector pH-Ubi-cas9-7 were extracted and recombined at a 1:1 ratio using the LR enzyme in the Gateway system. The transformed E. coli DH5α was then coated with spectinomycin-resistant medium to obtain transformants. The plasmids of the transformants were extracted and sent for sequencing. The positive transformants were the final recombinant vector, designated pH-Ubi-cas9-pub16:sgRNA.

[0037] 2. Obtaining OsPUB16-overexpressing transgenic rice and OsPUB16 CRISPR / Cas9 1) Callus Induction Culture: Hull the seeds of Zhonghua 11 rice (hereinafter also referred to as wild-type rice) and soak them in 70% ethanol for 10 minutes, then in 0.1% mercuric chloride for 30 minutes; perform surface sterilization. Rinse the solution on the seed surface with plenty of sterile water, and absorb the moisture on the seed surface with sterile filter paper. Place the seeds on a plate of mature embryo callus induction medium, seal the edge of the plate with Parafilm, and culture in a dark incubator at 26°C. After approximately 15 days, carefully remove the grown callus and transfer it to a mature embryo subculture medium, and continue culturing under the same conditions. Subculture should be performed every two weeks. For transformation, select light yellow granular callus that has been subcultured for about 5 days.

[0038] 2) Cultivation of Agrobacterium pCambia2300-OsPUB16 and pH-Ubi-cas9-pub16:sgRNA were electroporated into Agrobacterium EHA105 to obtain recombinant bacteria EHA105 / pCambia2300-OsPUB16 and recombinant bacteria EHA105 / pH-Ubi-cas9-pub16:sgRNA, respectively.

[0039] Streak EHA105 / pCambia2300-OsPUB16 and EHA105 / pH-Ubi-cas9-pub16:sgRNA on LB plates containing antibiotics (50 mg / L Kanamycin, 50 mg / L Rifampicin) and culture at 28°C for 2 days. Pick a single colony and inoculate it into liquid LB medium and culture it at 28°C with shaking until the OD 600 The concentration of acetosyringone was about 0.5, and acetosyringone was added to a final concentration of 100 mM to obtain an Agrobacterium suspension for transforming rice callus tissue.

[0040] 3) Co-culture of rice callus and Agrobacterium Place the subcultured callus into a sterile Erlenmeyer flask and pour the Agrobacterium suspension into the flask until it is submerged. Incubate at room temperature for 20 minutes, gently shaking the flask occasionally to ensure full contact between the callus and the bacterial suspension. Gently remove the callus with sterile tweezers, place it on sterile filter paper to absorb excess bacterial suspension, and transfer it to a co-cultivation medium plate lined with sterile filter paper. Incubate in the dark at 28°C for 3 days to obtain the co-cultivated callus.

[0041] 4) Screening and differentiation of resistant callus The co-cultivated callus tissue was washed with an appropriate amount of sterile water to remove any residual Agrobacterium on the surface. It was then placed on a screening medium and incubated in the dark at 26°C for screening. After two weeks, it was transferred to a fresh screening medium and screening continued for another two weeks. Callus tissue that appeared to be in good condition after two rounds of screening was selected and transferred to differentiation medium plates. The cells were incubated in the dark for three days before being transferred to a light incubator (15 hours per day) for light culture. Differentiated seedlings were visible after one month. When the differentiated seedlings reached approximately 2 cm in size, they were transferred to rooting medium in a conical flask and cultured for approximately two weeks. Seedlings with good growth and a well-developed root system were selected, the culture medium on the roots was washed off with tap water, and the cells were transplanted into soil. The seeds were harvested to obtain T1-generation OsPUB16-overexpressing rice seeds and T1-generation OsPUB16 CRISPR / Cas9-transfected rice seeds, respectively. T1-generation OsPUB16-overexpressing rice and OsPUB16 CRISPR / Cas9-transfected rice were sown.

[0042] T1 rice seeds were initially screened with hygromycin or G418 (the pCambia2300 vector carries a G418 resistance selection gene, while the pH-Ubi-cas9-7 vector carries a hygromycin resistance selection gene). Germinated seeds indicated that the vector had been transferred into the rice plants. Germinated seeds were planted in soil and allowed to grow for two weeks. 0.1 g of leaves were then collected and ground into a powder using liquid nitrogen.

[0043] 200 μl of protein extraction buffer (0.25 M Tris-HCl, pH 6.8, 8% SDS, 8% β-mercaptoethanol, 20% glycerol) was added to leaf powder of transgenic rice lines overexpressing OsPUB16, incubated on ice for 10 min, boiled at 100°C for 10 min, and centrifuged at 12,000 rpm at 4°C for 10 min. The supernatant was collected and subjected to SDS-PAGE. After transfer to a membrane, Western blotting was performed. SDS-PAGE and Western blotting were performed according to known methods and product instructions. Figure 1 As shown, two strains, OsPUB16 OE#1 and OsPUB16 OE#2, were selected for subsequent insect resistance analysis experiments.

[0044] Leaf powder of the OsPUB16 CRISPR / Cas9 transgenic rice line was used to extract genomic DNA. The specific method was referred to the High-Efficiency Plant Genomic DNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., Cat. No.: DP350). Subsequently, 0.5 g of genomic DNA was used as a template, and primers PUB16-F': 5'-CAGTGTCATTGTCACTACT-3' and PUB16-R': 5'-AAATAAATCTTGCTCATCATTTGA-3' were used for PCR reaction. The PCR products were directly sent for sequencing, and then sequence alignment was performed. Figure 1As shown, two positive strains were selected and named Ospub16#9 and Ospub16#17 for subsequent insect resistance analysis experiments.

[0045] Example 3: Overexpression of OsPUB16 increases sensitivity to feeding by brown planthoppers. Ospub16 can improve the resistance of rice to brown planthoppers.

[0046] Wild-type rice ZH11, OsPUB16 overexpressing rice, and OsPUB16 CRISPR / Cas9 rice materials were sown at the same time. 20 plump seeds were sown for each material in a separate black plastic seedling box (7.2 cm in diameter, 5 cm in bottom diameter, 8 cm in height). When the plants grew to the three-leaf stage, 12 seedlings with uniform growth were retained in each row, and the seedling trays were placed in a 200-mesh gauze. 2nd-instar brown planthopper nymphs were inoculated at a rate of 8-10 per seedling. When more than 90% of the susceptible control plants died, the resistance level was evaluated according to the degree of damage to each seedling, and the resistance score of each material was obtained by weighted average calculation. Honeydew area test: Select rice plants with uniform growth at the four-leaf stage and transplant them into plastic cups (9 cm in diameter, 500 ml). One seedling was placed in each plastic cup and cultured with the prepared nutrient solution. The mouth of the cup is sealed with a round filter paper, and then a small hole is drilled in the center of the filter paper. The rice stalk is stuck into the filter paper with a hole in the center. The cup containing the brown planthopper nymphs covers the stalk, and then a similar plastic cup is turned upside down on it. Five nymphs are placed in each cup. After feeding for 48 hours, the filter paper is removed, and the number is written on the edge of the filter paper with a pencil. It is placed in an oven (constant temperature of 50°C) to dry for 20 minutes. After drying, it is taken out and evenly sprayed with 0.25% ninhydrin / ethanol solution, and placed in a 60°C oven for color development for 30 minutes. The purple part displayed on the filter paper is the area of honeydew secreted by the brown planthopper. After taking a picture and scanning it, the stained area is calculated on the imageJ software. The results are as follows Figure 2 As shown in the figure, compared with wild-type rice ZH11, OsPUB16 overexpressing rice is susceptible to brown planthoppers, while OsPUB16 CRISPR / Cas9 rice is resistant. The honeydew area secreted by brown planthoppers on OsPUB16 overexpressing rice is significantly larger than that on OsPUB16 CRISPR / Cas9 rice. Figure 3 As shown, compared with wild-type rice ZH11, the body weight of brown planthoppers feeding on OsPUB16-overexpressing rice materials increased, while the body weight of brown planthoppers feeding on OsPUB16 CRISPR / Cas9 rice materials decreased.

[0047] After the transgenic rice materials were cultured for one month, a feeding preference experiment was conducted.

[0048] The device was designed and drawn using Auto CAD 2024, and the panels were cut by Shanghai Luoyu Rubber and Plastic Products Co., Ltd. Figure 5 . Use UV curing agent to bond and seal to ensure that there is no insect leakage and no air leakage. This device is a feeding preference test device. Put the rice after different treatments into the device at intervals, and put a few rice planthoppers in. Seal the device, use a camera to take pictures at intervals for one day, count the number of rice planthoppers feeding on different rice at different time periods, and judge whether the treated rice attracts or avoids rice planthoppers. The results are as follows Figure 4 As shown, brown planthoppers have a greater feeding preference for OsPUB16-overexpressing rice materials than for OsPUB16CRISPR / Cas9 rice.

[0049] The experiments of the present invention have shown that brown planthoppers prefer to feed on rice with excessive accumulation of OsPUB16 protein, and transgenic rice in which OsPUB16 is knocked out through the CRISPR / Cas9 pathway increases resistance to feeding by brown planthoppers.

Claims

1. OsPUB16 The application of a gene in regulating rice resistance to brown planthopper is characterized by: described OsPUB16 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

2. The use according to claim 1, characterized in that: The regulation includes overexpression OsPUB16 Genes that make rice less resistant to brown planthoppers, and knockout OsPUB16 Genes make rice more resistant to brown planthoppers.

3. A method for regulating rice resistance to brown planthoppers, characterized by: When it is necessary to reduce the resistance of rice to brown planthoppers, OsPUB16 When it is necessary to improve the resistance of rice to brown planthoppers, the OsPUB16 gene knockout; described OsPUB16 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

4. OsPUB16 The application of the gene in rice breeding is characterized by: The rice breeding includes overexpression OsPUB16 Rice lines that acquired brown planthopper susceptibility genes, and OsPUB16 Genetically obtained rice lines resistant to brown planthoppers; OsPUB16 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

5. A method for constructing transgenic rice susceptible to brown planthoppers, characterized by: Build OsPUB16 The gene overexpression vector is transformed into rice and the rice is cultivated; described OsPUB16 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.

2.

6. A method for constructing transgenic rice resistant to brown planthopper, characterized by: Build OsPUB16 The gene knockout vector is transformed into rice and the rice is cultivated; described OsPUB16 The nucleotide sequence of the gene is shown in SEQ ID NO.1, and the amino acid sequence of the protein encoded by the gene is shown in SEQ ID NO.2.

Images