Composition for improving tolerance of plants to saline-alkali soil and application of composition

Abstract

The invention discloses a composition for improving the tolerance of plants to saline-alkali soil and application of the composition. The present invention relates to the field of microorganisms, and provides a composition, which contains a Botrytis cinerea strain 7466 (ACCC 34101), a Chaetomium globosum strain 7126 (ACCC 34102), and a Cladosporium halotolans strain 7309 (ACCC 34103), and a preparation method of the composition, the preparation method of the composition, and the preparation method of the composition, the composition provided by the invention can improve the salt and alkali tolerance of plants. The method is of great significance in saline-alkali soil restoration and improvement and growth promotion of crops such as soybeans.

Description

Technical Field

[0001] The present invention relates to the field of microorganisms, and in particular to a composition for improving plant tolerance to saline-alkali soil and its application. Background Art

[0002] Botryotrichum sp. is a genus of saprophytic fungi found widely in a variety of soils. Currently, research on this genus is limited, focusing on its taxonomic status and metabolites. Existing studies have revealed that Botryotrichum may produce antimicrobial metabolites (such as polyketides and botryolides) to inhibit pathogens, thereby indirectly promoting plant growth. Chaetomium sp. has been further studied on saline-alkali soils. This genus directly promotes plant growth by regulating the plant's antioxidant enzyme system and osmotic balance, as well as producing IAA and siderophores. Chaetomium also produces secondary metabolites with strong inhibitory activity against Fusarium, maintaining plant growth in environments with high pathogen concentrations. This genus also produces a variety of cellulose-degrading enzymes that can convert soil cellulose into organic matter, enhancing the fertility of saline-alkali soils. This not only stimulates the accumulation of other beneficial microorganisms, but also provides a carbon source for plants. In summary, Chaetomium sp. is an excellent material for microbial agents to improve saline-alkali soils and promote plant growth. Cladosporium sp. can adapt to extreme environments such as saline-alkali soils by regulating antioxidant enzyme systems and osmotic pressure balance. Cladosporium halotolerans strains can produce IAA and ACC dehydrogenases to promote plant growth and alleviate damage to plants caused by saline-alkali stress. In environmental management, this genus has also demonstrated excellent remediation effects, primarily in pesticide degradation and heavy metal removal. Furthermore, this genus can produce antimicrobial metabolites such as polyketides to inhibit the growth of pathogens, making it a potential strain for antimicrobial and growth-promoting applications in saline-alkali soils.

[0003] Soluble salt content and exchangeable Na in saline-alkali soil + If the content exceeds the threshold that plants can bear, it will inhibit their normal growth and metabolism process, seriously hindering the development of crop resources. Salinization will not only change the soil aggregate structure and physical and chemical properties, but also indirectly affect the abundance of soil organisms (plants, protozoa and microorganisms). More HCO3 - 、CO3 2-It will also cause osmotic stress and ion poisoning to plants, resulting in a significant decrease in the abundance of beneficial microorganisms. Once plants lose the assistance of beneficial microorganisms, they are easily infected by pathogens. Soybean is an important oil crop and protein source in my country. Faced with the growing demand for it, it has always been unable to get rid of the dilemma of low yield and dependence on imports. The main type of saline-alkali land in Northeast my country is soda saline-alkali land, so the use of saline-alkali land resources to grow soybeans not only alleviates the demand pressure of soybeans in my country, but also provides a research base for saline-alkali land restoration through microbial-plant interactions and the development of sustainable agriculture. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to provide a composition for improving plant tolerance to saline-alkali land and application thereof.

[0005] In a first aspect, the present invention claims a composition.

[0006] The composition claimed in the present invention contains Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron or their offspring (daughter);

[0007] The Botryotrichum atrogriseum is the Botryotrichum atrogriseum strain 7466, which is numbered ACCC 34101 in the Agricultural Microbiology Center of the China Culture Collection Administration;

[0008] The Chaetomium globosum is the Chaetomium globosum strain 7126, which is numbered ACCC 34102 in the Agricultural Microbiology Center of the China Culture Collection Administration;

[0009] The salt-tolerant Cladosporium is the salt-tolerant Cladosporium (Cladosporium halotolerans) strain 7309, which is numbered ACCC 34103 in the Agricultural Microbiology Center of the China Culture Collection Administration.

[0010] Furthermore, the main activities in the composition are the dark gray mold, the globosum Chaetomium and the salt-tolerant Cladosporium; in the composition, the CFU ratio of the dark gray mold, the globosum Chaetomium and the salt-tolerant Cladosporium is 1:1:1.

[0011] The dark gray spore mold, the globosum fungus, the salt-tolerant spore mold and their corresponding offspring (progeny) have the same or similar functions. The dark gray spore mold, the globosum fungus, the salt-tolerant spore mold and their corresponding offspring (progeny) have the same or similar physiological and biochemical characteristics.

[0012] Furthermore, the active ingredients in the composition may also include cultures and / or metabolites of the three strains of Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron.

[0013] Among them, the culture is a substance obtained by culturing the three strains of the dark gray fungus, the globosum fungus and the haloduronic acid fungus in the corresponding microbial culture medium (all substances in the culture container, that is, fermentation products, such as the corresponding strains and the substances secreted into the liquid culture medium, that is, fermentation liquid, or the corresponding strains and the substances secreted into the solid culture medium, that is, solid fermentation products).

[0014] In the above culture, the substances include the three strains of fungi (their own fungi) of Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron described in the first aspect above and / or their metabolites.

[0015] The term "metabolite" refers to the primary and / or secondary metabolites produced during microbial metabolism. Primary metabolism refers to the process by which microorganisms absorb various nutrients from the outside world and, through catabolism and anabolism, generate substances and energy to sustain life activities. The products of primary metabolism are primary metabolites, such as monomers such as monosaccharides or monosaccharide derivatives, nucleotides, vitamins, amino acids, fatty acids, and various macromolecular polymers composed of them, such as proteins, nucleic acids, polysaccharides, and lipids. Secondary metabolism refers to the process by which microorganisms, during a certain growth period, use primary metabolites as precursors to synthesize substances with no clear function in the microorganism's life activities. The products of secondary metabolism are secondary metabolites, which are mostly compounds with relatively complex molecular structures. Based on their functions, they can be divided into types such as antibiotics, hormones, alkaloids, and toxins.

[0016] The term "culture" refers to a general term for liquid or solid culture media containing a microbial population after artificial inoculation and cultivation. This refers to products obtained by growing and / or amplifying microorganisms. These can be biologically pure cultures of the microorganisms (i.e., the three strains of Botrytis cinerea, Chaetomium globosum, and Cladosporium halodendrium), or they can contain a certain amount of culture medium, metabolites, or other components produced during the culture process. The term "culture" also includes subcultures obtained by subculturing microorganisms, which can be cultures of a single generation or a mixture of several generations.

[0017] Furthermore, the composition can be a composite bacterial agent or a growth substrate for plants.

[0018] The above-mentioned bacterial agent refers to a live bacterial preparation made by expanding the target microorganisms and using a carrier as an adsorbent to adsorb the fermentation liquid or solid fermentation product of the bacteria.

[0019] The carrier can be a biologically inert carrier commonly used in the pesticide field. The carrier can be a solid carrier or a liquid carrier; the solid carrier can be biochar, a mineral material, a plant material, or a polymer compound; the mineral material can be at least one of clay, talc, kaolin, montmorillonite, white carbon, zeolite, silica, and diatomaceous earth; the plant material can be at least one of corn flour, soy flour, and starch; the polymer compound can be polyvinyl alcohol or polyglycol; the liquid carrier can be an organic solvent, vegetable oil, mineral oil, or water; the organic solvent can be decane or dodecane.

[0020] In the above-mentioned microbial agent, the active ingredients of the microbial agent may be the three strains of the dark gray Botrytis cinerea, the globosum Chaetomium sphaeroides and the haloduronic acid Cladosporium halodurans, their cultures and / or their metabolites. The active ingredients of the microbial agent may also contain other biological components or non-biological components.

[0021] The above-mentioned microbial agents may be in various dosage forms, such as liquid, emulsion, suspension, powder, granule, wettable powder or water-dispersible granule.

[0022] As needed, surfactants (such as Tween 20, Tween 80, etc.), binders, stabilizers (such as antioxidants), pH regulators, etc. may be added to the bacterial agent.

[0023] The composite inoculant may also include auxiliary materials such as water, a carbon source, and / or a nitrogen source. Carbon sources are carbon-containing compounds that are nutrients for microbial growth and include fast-acting and slow-acting carbon sources such as sugars, oils, organic acids and organic acid esters, and small-molecule alcohols. Nitrogen sources are substances that provide the nitrogen element required for microbial nutrition and include fast-acting and slow-acting nitrogen sources such as peanut meal, soybean meal, yeast powder, peptone, ammonia, ammonium salts, and nitrates.

[0024] The growth substrate further comprises at least one of the following: soil, sand, and an inert granular substrate (eg, vermiculite).

[0025] The composition has at least one of the following characteristics:

[0026] (A1) Improve plant tolerance to saline-alkali stress;

[0027] (A2) promoting plant germination;

[0028] (A3) Promote plant growth.

[0029] In a second aspect, the present invention claims the use of the composition described in the first aspect above in any of the following:

[0030] (B1) Improve plant tolerance to saline-alkali stress;

[0031] (B2) preparing a product for improving the tolerance of plants to saline-alkali stress;

[0032] (B3) Promote plant germination;

[0033] (B4) preparing products for promoting plant germination;

[0034] (B5) Promote plant growth;

[0035] (B6) Preparation of products for promoting plant growth.

[0036] In a third aspect, the present invention claims protection for the use of the three strains of Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron described in the first aspect above in any of the following applications:

[0037] (B1) Improve plant tolerance to saline-alkali stress;

[0038] (B2) preparing a product for improving the tolerance of plants to saline-alkali stress;

[0039] (B3) Promote plant germination;

[0040] (B4) preparing products for promoting plant germination;

[0041] (B5) Promote plant growth;

[0042] (B6) Preparation of products for promoting plant growth.

[0043] In a fourth aspect, the present invention claims a method for improving a plant's tolerance to saline-alkali stress.

[0044] The method for improving plant tolerance to saline-alkali stress claimed in the present invention may include the following steps (C1) or (C2):

[0045] (C1) applying the composition described in the first aspect above to a plant or its growth medium, thereby improving the plant's tolerance to saline-alkali stress;

[0046] (C2) applying the three strains of Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron described in the first aspect to plants or their growth substrates, thereby improving the tolerance of the plants to saline-alkali stress.

[0047] In one embodiment of the present invention, the composition or the three strains of the dark gray hair mold, the globosporium, and the salt-tolerant cladosporium are suitable for the growth matrix (soil) of the plant, and the dosage of the three strains is 3.33×10 5 CFU / g soil.

[0048] Furthermore, the method of improving plant tolerance to saline-alkali stress of the present invention can be applied in the presence of barrier fungi.

[0049] In a fifth aspect, the present invention claims a method for promoting plant germination and / or promoting plant growth.

[0050] The method for promoting plant germination and / or promoting plant growth claimed in the present invention may include the following steps (D1) or (D2):

[0051] (D1) applying the composition described in the first aspect above to a plant or its growth medium, thereby promoting germination of the plant and / or promoting growth of the plant;

[0052] (D2) applying the three strains of Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron described in the first aspect to plants or their growth substrates, thereby promoting germination and / or growth of the plants.

[0053] In one embodiment of the present invention, the composition or the three strains of the dark gray hair mold, the globosporium, and the salt-tolerant cladosporium are suitable for the growth matrix (soil) of the plant, and the dosage of the three strains is 3.33×10 5 CFU / g soil.

[0054] In the above-mentioned related aspects, the promoting plant germination may be promoting plant germination under saline-alkali stress. Further, the promoting plant germination may be promoting plant germination under saline-alkali stress and in the presence of barrier fungi.

[0055] In the above-mentioned related aspects, the promoting plant growth may be promoting plant growth under saline-alkali stress. Further, the promoting plant growth may be promoting plant growth under saline-alkali stress and in the presence of barrier fungi.

[0056] Furthermore, the saline-alkali stress may be salt stress and / or alkali stress.

[0057] Furthermore, the salt stress may be a stress environment with an EC value (The value of Electrical Conductivity) less than 1 ms / cm (such as an EC value less than 0.5 ms / cm). The alkali stress may be a stress environment with a pH of 8.50-9.00.

[0058] In one embodiment of the present invention, the salt stress is specifically a stress environment with an EC value of 0.429ms / cm. The alkaline stress is specifically a stress environment with a pH of 8.56.

[0059] In one embodiment of the present invention, the saline-alkali stress is achieved by mixing a soil mixture (e.g., sandy soil) with a 1% saline-alkali content by mass with a normal soil (e.g., saline-alkali soil) at a volume ratio of 2:1. The saline-alkali mixture is composed of NaHCO₃ and Na₂CO₃ at a molar ratio of 9:1. This is used to simulate soda saline-alkali land in Northeast China.

[0060] In the above-mentioned related aspects, the obstructive fungus refers to a fungal pathogen that causes plant growth obstruction. In the present invention, the obstructive fungus is specifically Talaromyces cf. purpureogenus 7313 (ACCC 34104) and / or Plectosphaerella cf. cucumerina 7464 (ACCC 34105).

[0061] In the above-mentioned related aspects, the promoting plant germination may be specifically embodied as increasing the germination potential and / or germination rate of the plant.

[0062] In the above-mentioned related aspects, the promotion of plant growth can be specifically embodied as all or part of the following: promoting the increase of plant height, promoting the increase of plant aboveground fresh weight, promoting the increase of plant main root length, promoting the increase of plant underground fresh weight, and promoting the increase of plant total root length.

[0063] In an embodiment of the present invention, the promoting of plant height increase is to promote an increase in plant height by 36.9%; the promoting of plant aboveground fresh weight increase is to promote an increase in plant aboveground fresh weight by 32.37%; the promoting of plant main root length increase is to promote an increase in plant main root length by 45.86%; the promoting of plant underground fresh weight increase is to promote an increase in plant underground fresh weight by 43.09%; the promoting of plant total root length increase is to promote an increase in plant total root length by 29.17%.

[0064] In another embodiment of the present invention, the promoting of plant height increase is to promote an increase in plant height by 41.82%; the promoting of plant aboveground fresh weight increase is to promote an increase in plant aboveground fresh weight by 50.98%; and the promoting of plant total root length increase is to promote an increase in plant total root length by 30.38%.

[0065] In the above related aspects, the plant may be any of the following:

[0066] (E1) angiosperms;

[0067] (E2) dicots;

[0068] (E3) Fabales;

[0069] (E4) Leguminosae;

[0070] (E5) Glycine max;

[0071] (E6)Soybean.

[0072] In one embodiment of the present invention, the plant is specifically soybean.

[0073] Experiments have shown that under saline-alkali stress, the composite microbial agent provided by the present invention, including Botryotrichum atrogriseum strain 7466, Chaetomium globosum strain 7126, and Cladosporium halotolerans strain 7309, can promote soybean germination and growth compared to a group without the agent. This shows that the composite microbial agent provided by the present invention can improve the salt-alkali tolerance of plants. The present invention has important significance for the restoration and improvement of saline-alkali land and the promotion of the growth of crops such as soybeans. BRIEF DESCRIPTION OF THE DRAWINGS

[0074] Figure 1 This is the colony morphology of strain 7466.

[0075] Figure 2 This is the colony morphology of strain 7126.

[0076] Figure 3 This is the colony morphology of strain 7309.

[0077] Figure 4 This is the colony morphology of strain 7313.

[0078] Figure 5 This is the colony morphology of strain 7464.

[0079] Figure 6 This is the phylogenetic tree of strain 7466.

[0080] Figure 7 This is the phylogenetic tree of strain 7126.

[0081] Figure 8 This is the phylogenetic tree of strain 7309.

[0082] Figure 9 This is the phylogenetic tree of strain 7313.

[0083] Figure 10 This is the phylogenetic tree of strain 7464.

[0084] Figure 11 The potted plant growth conditions of the composite bacterial agent and the functional identification of each single bacteria in Example 3.

[0085] Figure 12The plant growth conditions of the BCC combination and the control group in Example 3 are shown.

[0086] Figure 13 The plant growth conditions of the growth disorder group W and the treatment group T after inoculation with BCC in Example 4 are shown. DETAILED DESCRIPTION

[0087] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0088] Unless otherwise specified, the experimental methods in the following examples are conventional methods and were performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials and reagents used in the following examples, unless otherwise specified, were all commercially available.

[0089] The culture medium involved in the following examples:

[0090] (1) Corn flour and vermiculite solid fermentation medium: Corn flour and fine-grained vermiculite were mixed in a volume ratio of 1:4, and 0.4 times the volume of pure water was added and stirred. Approximately 100 g of the mixture was placed in a 250 mL conical flask, sealed with a high-temperature resistant sealing film, and sterilized twice with high-pressure steam (121°C, 1 h).

[0091] (2) PDA medium: 200 g potato, 20 g glucose, 5 g peptone, 3 g potassium dihydrogen phosphate, 1.5 g magnesium sulfate, 15-20 g agar, 1000 ml water, natural pH.

[0092] The Botryotrichum atrogriseum strain 7466 in the following examples has been deposited with the Agricultural Microorganism Center of the China Culture Collection of Microorganisms, also known as the Agricultural Culture Collection of China (ACCC) before the filing date of the present application. The strain number is ACCC 34101 and the collection date is May 21, 2025. From the date of collection, the public can obtain the strain from the Agricultural Microorganism Center of the China Culture Collection of Microorganisms. The ACCC has a dedicated website at http: / / www.accc.org.cn, and the public can directly order strains online.

[0093] The Chaetomium globosum strain 7126 used in the following examples has been deposited with the Agricultural Microorganism Center of the China Culture Collection of Microorganisms (also known as the Agricultural Culture Collection of China, ACCC) before the filing date of the present application. The strain number is ACCC 34102, and the collection date is May 21, 2025. From that date, the public can obtain the strain from the Agricultural Microorganism Center of the China Culture Collection of Microorganisms. The ACCC has a dedicated website at http: / / www.accc.org.cn, where the public can directly order strains online.

[0094] The salt-tolerant Cladosporium halotolerans strain 7309 in the following examples has been deposited in the Agricultural Microorganism Center of the China Culture Collection of Microorganisms, also known as the Agricultural Culture Collection of China (ACCC) (address: 12 Zhongguancun South Street, Haidian District, Beijing, Institute of Agricultural Resources and Agricultural Regional Planning, Chinese Academy of Agricultural Sciences, zip code 100081) before the filing date of this application. The strain number is ACCC 34103 and the collection date is May 21, 2025. From the date of collection, the public can obtain the strain from the Agricultural Microorganism Center of the China Culture Collection of Microorganisms. The ACCC has a dedicated website at http: / / www.accc.org.cn, and the public can directly order strains online.

[0095] The Talaromyces cf. purpureogenus 7313 in the following examples has been deposited in the Agricultural Microorganism Center of the China Culture Collection of Microorganisms, also known as the Agricultural Culture Collection of China (ACCC) (address: 12 Zhongguancun South Street, Haidian District, Beijing, Institute of Agricultural Resources and Agricultural Regional Planning, Chinese Academy of Agricultural Sciences, zip code 100081) before the filing date of this application. The strain number is ACCC 34104 and the collection date is May 27, 2025. From the date of collection, the public can obtain the strain from the Agricultural Microorganism Center of the China Culture Collection of Microorganisms. The ACCC has a dedicated website at http: / / www.accc.org.cn, and the public can directly order strains online.

[0096] The Plectosphaerella cf. cucumerina 7464 in the following examples has been deposited in the Agricultural Microorganism Center of the China Culture Collection of Microorganisms, also known as the Agricultural Culture Collection of China (ACCC) before the filing date of the present application. The address is: Institute of Agricultural Resources and Agricultural Regional Planning, Chinese Academy of Agricultural Sciences, No. 12, Zhongguancun South Street, Haidian District, Beijing, Postal Code 100081. The strain number is ACCC 34105 and the collection date is May 27, 2025. From the date of collection, the public can obtain the strain from the Agricultural Microorganism Center of the China Culture Collection of Microorganisms. ACCC has a dedicated website at http: / / www.accc.org.cn, and the public can directly order strains online.

[0097] Example 1: Isolation and identification of the strain of the present invention

[0098] Strains were isolated from soda saline-alkali soil in Northeast China, and the dark gray hairy spore mold strain 7466, globosum strain 7126 and salt-tolerant cladospore strain 7309 of the present invention as well as the barrier fungus group purple tularemia strain 7313 and tinea cystis strain 7464 were obtained.

[0099] 1. Isolation and purification of each strain

[0100] Weigh 5g of rhizosphere / topsoil into a 250mL conical flask (add 45mL of pure water and 0.5mL of Tween 80), and then place it on a shaker at 180r / min for 30min. Pipette 1mL of liquid from the system into a 10mL shaking tube, add pure water to the new 10mL system and perform gradient dilution to 10 -4 , from 10 -2 , 10 -3 , 10 -4 In the gradient system, 100 μL is taken each time and spread on 18 different solid culture media (Φ=90 mm). Each gradient is repeated 9 times, and every three repetitions are placed in an incubator set at 15°C, 25°C and 35°C for 3-7 days. Observation starts from the 3rd day of culture and continues until the 7th day. The hyphae at the edge of a single fungal colony picked with an inoculation loop are placed on a PDA culture medium (Φ=90 mm). The inoculated culture dish is placed at room temperature for culture, and the culture medium source, temperature, location and other information of the strain are recorded. Observe its morphology every day. If there is any sign of cross contamination or impure fungal colonies, purify it in time. The bacterial strains obtained are numbered 7466, 7126, 7309, 7313 and 7464.

[0101] 2. Molecular identification of each strain

[0102] 1. Strain morphology

[0103] Strain 7466: The colonies on PDA plates are initially villiform or loosely flocculent, and later become gray-brown in color, with light-colored edges and a bulge in the center. Melanin deposition is common in old hyphae and spores. Conidiophores are loose and villiform, conidia and conidiophores are colorless or brightly colored, hyphae-like, or differentiated into special forms, dispersed and not connected into bundles. Conidia have no septa, and conidiophores are long, which is significantly different from conidia. The conidiophores are branched at the top, with terminal conidial heads, and conidia are spherical or ovoid. Figure 1 shown.

[0104] Strain 7126: Grows rapidly on PDA medium, with colonies covering the entire surface within two weeks. Initially, the colonies are fluffy or loosely flocculent, with neat and intact edges, and are often covered with numerous perithecia. Mycelium is initially white or light yellow, gradually turning olive green or gray-brown as the culture time increases. The back of the colony gradually turns brown over time, and the perithecia are black. Figure 2 shown.

[0105] Strain 7309: Colonies are olive green to dark green, with a powdery or velvety surface. On PDA medium, the colony margins are irregular, and the back of the colony is black. Conidiophores are erect, short-branched, distinctly separated, and may form radial branches at the apex. Conidia are ovoid. Figure 3 shown.

[0106] Strain 7313: It grows rapidly on the culture medium. The colony has a velvety or flocculent texture. The mycelium changes from light white to orange. The spores are yellow-green at the beginning, and turn green-brown in the later stage and cover the entire culture medium. The surface often appears powdery due to the production of spores. The back of the colony is red. Figure 4 shown.

[0107] Strain 7464: The colony grows slowly, has a velvety or sticky texture, and sometimes has wrinkles on the surface. It is white in color, and the back of the colony is white. Figure 5 shown.

[0108] 2. Construction of strain phylogenetic tree

[0109] A certain amount of hyphae was scraped and DNA was extracted using a fungal genomic DNA extraction kit (Solarbio). PCR amplification was performed on the internal transcribed spacer (ITS), RNA polymerase II (RPB2), β-tubulin (TUB2), and the D1 / D2 variable region of the large ribosomal subunit (LSU) of strain 7466; PCR amplification was performed on the internal transcribed spacer (ITS), β-tubulin (TUB2), and the D1 / D2 variable region of the large ribosomal subunit (LSU) of strain 7126; and PCR amplification was performed on the internal transcribed spacer (ITS) and transcription elongation factor (TEF 1-α) of strain 7309. Sequencing was performed on the internal transcribed spacer (ITS) of strains 7313 and 7464. Primers were synthesized by Sangon Biotech Co., Ltd.

[0110] Amplification system: 2× Taq PCR polymerase 12.5 μL, DNA template 1 μL, front primer 1 μL, back primer 1 μL, ddH2O added to 25 μL.

[0111] PCR reaction program: initial denaturation: 94°C, 5 min; 40 cycles [denaturation: 94°C, 45 s; annealing (ITS / LSU: 48°C, 30 s; TEF: 52°C, 30 s; RPB2: 55°C, 30 s), extension: 72°C, 90 s]; final extension: 72°C, 6 min.

[0112] The PCR amplification products were electrophoresed on a 1.5% agarose gel using a 2000 bp DNA marker as a control to observe the bands. PCR products with clear bands were sent to Sangon Biotech for sequencing.

[0113] Sequences of reference strains of the genera Botryotrichum, Chaetomium, and Cladosporium were downloaded from GenBank. Sequence alignment and gene assembly were performed using ACOPTools V2. A phylogenetic tree was constructed using PAUP 4.0 software using the maximum parsimony (MP) method. The bootstrap nreps parameter was set to 1000. The Kishino-Hasegawa test was used to verify the topologically optimal tree, and the tree file was exported. The subsequent phylogenetic tree was processed using the ITOL website (https: / / itol.embl.de / ). The primers (5'-3') are as follows:

[0114] ITS amplification:

[0115] TS1:TCCGTAGGTGAACCTGCGG;

[0116] ITS4:TCCTCCGCTTATTGATATGC;

[0117] RPB2 amplification:

[0118] RPB2AM-1bf: CCAAGGTBTTYGTSAACGG;

[0119] RPB2AM-7R:GAATRTTGGCCATGGTRTCCAT;

[0120] TUB2 amplification:

[0121] T1:AACATGCGTGAGATTGTAAGT;

[0122] TUB4Rd:CCRGAYTGRCCRAARACRAAGTTGTC;

[0123] LSU Amplification:

[0124] NL1:GGARGTACCAGTSATCATGTT;

[0125] NL4:GGARGTACCAGTSATCATGTT;

[0126] TEF amplification:

[0127] EF1-728F:CATCGAGAAGTTCGAGAAGG;

[0128] EF2:GGARGTACCAGTSATCATGTT.

[0129] The ITS gene sequencing results of strain 7466 are shown in SEQ ID No. 1, the TUB2 gene sequencing results of strain 7466 are shown in SEQ ID No. 2, the RPB2 gene sequencing results of strain 7466 are shown in SEQ ID No. 3, and the LSU gene sequencing results of strain 7466 are shown in SEQ ID No. 4.

[0130] The ITS gene sequencing result of strain 7126 is shown in SEQ ID No. 5, the TUB2 gene sequencing result of strain 7126 is shown in SEQ ID No. 6, and the LSU gene sequencing result of strain 7126 is shown in SEQ ID No. 7.

[0131] The ITS gene sequencing result of strain 7309 is shown in SEQ ID No. 8, and the TEF gene sequencing result of strain 7309 is shown in SEQ ID No. 9.

[0132] The ITS gene sequencing results of strain 7313 are shown in SEQ ID No.10.

[0133] The ITS gene sequencing results of strain 7464 are shown in SEQ ID No.11.

[0134] Phylogenetic tree of strain 7466 Figure 6 shown.

[0135] Phylogenetic tree of strain 7126 Figure 7 shown.

[0136] Phylogenetic tree of strain 7309 Figure 8 shown.

[0137] Phylogenetic tree of strain 7313 Figure 9 shown.

[0138] Phylogenetic tree of strain 7464 Figure 10 shown.

[0139] Based on the above results of ITS, RPB2, LSU and TEF gene sequencing of each strain, the identification results are as follows:

[0140] Strain 7466 is Botryotrichum atrogriseum and was collected on May 21, 2025, at the Agricultural Microbiology Center of the China Culture Collection Administration (also known as the Agricultural Culture Collection of China, ACCC). Address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China, with the number ACCC 34101. Hereinafter, it will be referred to as strain 7466 or Botryotrichum atrogriseum 7466.

[0141] Strain 7126 is Chaetomium globosum and was collected on May 21, 2025, at the Agricultural Microbiology Center of the China Culture Collection Administration (also known as the Agricultural Culture Collection of China, ACCC). Address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China, with the number ACCC 34102. Hereinafter referred to as strain 7126 or Chaetomium globosum 7126.

[0142] Strain 7309 is a salt-tolerant Cladosporium halotolerans strain and was deposited with the Agricultural Microbiology Center of the China Culture Collection of Microorganisms (also known as the Agricultural Culture Collection of China, ACCC) on May 21, 2025, under the registration number ACCC34103. This strain is hereinafter referred to as strain 7309 or salt-tolerant Cladosporium 7309.

[0143] Strain 7313 is a recently produced Talaromyces cf. purpureogenus and was collected on May 27, 2025, at the Agricultural Microbiology Center of the China Culture Collection Administration (also known as the Agricultural Culture Collection of China, ACCC; address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China), with the number ACCC 34104. Hereinafter, it will be referred to as strain 7313 or recently produced Talaromyces cf. purpureogenus 7313.

[0144] Strain 7464 is Plectosphaerella cf. cucumerina and was deposited on May 27, 2025, at the Agricultural Microbiology Center of the China Culture Collection Administration (also known as the Agricultural Culture Collection of China, ACCC; address: Institute of Agricultural Resources and Regional Planning, Chinese Academy of Agricultural Sciences, 12 Zhongguancun South Street, Haidian District, Beijing, 100081, China), with the number ACCC 34105. Hereinafter, it will be referred to as strain 7464 or Plectosphaerella cf. cucumerina 7464.

[0145] Example 2: Preparation of composite bacterial agent

[0146] The bacterial strains 7466, 7126 and 7309 obtained in Example 1 were first transferred to the center of PDA culture medium (Φ=90mm) for activation and placed in a 28°C incubator for 3-7 days. When the fungal colony grows to half of the culture dish, a bacterial cake (Φ=5mm) is pressed out with a sterile punch. The sterilized corn flour vermiculite solid fermentation medium is opened on a clean bench and stirred with a sterilized glass rod to prevent the solid culture medium from condensing and agglomerating. The bacterial cake is then transferred to the solid culture medium, and 5-10 bacterial cakes are accessed per bottle of culture medium (considering the growth of the actual bacterial strain). In this process, each bacterial cake needs to be cleaned after transferring a strain to prevent cross contamination. The conical flask is cultured at room temperature and gently shaken left and right every day so that the bacterial cake is fully in contact with the culture medium. Cultivate for about 2 weeks, observe the growth and prepare to coat and count.

[0147] 1. Preparation of single bacterial agent

[0148] The strains 7466, 7126 and 7309 obtained in Example 1 were used to prepare single bacterial agents. When finally applied to the soil, the dosage of the single bacterial agents of the three fungi strains, 7466, 7126 and 7309, was 1×10 6 CFU / g soil.

[0149] 2. Preparation of double bacterial agent

[0150] The strains 7466, 7126, and 7309 obtained in Example 1 were combined in pairs to prepare a dual-bacterial agent. In the dual-bacterial agent, the CFU ratio between the two strains was 1:1. When finally applied to the soil, the dosage of each fungus was 5×10 5 CFU / g soil.

[0151] 3. Preparation of three-microbial agent

[0152] The composite bacterial agent composed of strains 7466, 7126 and 7309 obtained in Example 1 has a CFU ratio of 1:1:1. When finally applied to the soil, the dosage of 7466 was 3.33×10 5 CFU / g soil, the dosage of Chaetomium globosum 7126 was 3.33×10 5 CFU / g soil, the dosage of halophilic Cladosporium 7309 was 3.33×10 5 CFU / g soil.

[0153] 4. Preparation of dual strains of barrier fungi combination

[0154] The strains 7313 and 7464 obtained in Example 1 were used to prepare a dual-strain fungal combination, with a CFU ratio of 1:1. When finally applied to the soil, the amount of the purple cytoplasm fungus 7313 was 5×10 5 CFU / g soil, the dosage of Trichophyton cystis 7464 is 5×10 5 CFU / g soil.

[0155] Example 3: Functional identification of composite bacterial agents and individual bacteria

[0156] 1. Experimental Materials and Methods

[0157] Soda-alkali soil was simulated by adding 1% of the sand's weight to a molar ratio of NaHCO₃:Na₂CO₃ = 9:1. Sand and saline-alkali soil (2 mm sieved) were then mixed in a 2:1 volume ratio and sterilized at least three times with high-pressure steam (121°C, 2 h) before use. The mixed soil was packaged in plastic pots of specific specifications (bottom diameter 6.7 cm, mouth diameter 9.7 cm, height 8.7 cm), 300 g per pot. Because the fungal inoculum consisted of a cornmeal-vermiculite solid fermentation medium, to maintain nutritional consistency, all soil groups were supplemented with the required maximum weight of the same medium and mixed thoroughly. The soil in the pots after these treatments had an electrical conductivity (EC) of 0.429 mS / cm and a pH of 8.56.

[0158] The following soybean pot experiment was conducted:

[0159] (1) Comparison of different microbial components in saline-alkali soil

[0160] Saline-alkali soil (sieved 2 mm) was mixed with an equal weight of deionized water and stirred (25°C, 160 r / min) for 30 min, and centrifuged at high speed for 10 min (25°C, 5000 r / min) three times. The supernatant was filtered and the filtrate was collected.

[0161] CK: Only sterile water was added to the soil.

[0162] B: The soil extract, after being filtered through a 0.45 μm filter, was then filtered through a 0.22 μm filter. The 0.22 μm filter was placed in a 250 mL conical flask (containing 100 mL of sterile water) and shaken. The collected solution was used as an additive to the bacterial microbial component.

[0163] F: The filtrate was filtered through a 0.45 μm filter membrane, and the 0.45 μm filter membrane was placed in a 250 mL conical flask (containing 100 mL of sterile water) and shaken. The collected solution was used as an additive to the fungal microbial component.

[0164] BF: 50 mL of the solution containing the bacterial component and the fungal component were taken separately and mixed, and the solution was used as an additive to the bacterial and fungal microbial components.

[0165] (2) Treatment of single strain inoculation

[0166] Three treatments were set up, namely the Bo group with strain 7466, the Ch group with strain 7126, and the Cl group with strain 7309.

[0167] (3) Treatment of dual-strain inoculation

[0168] Three treatments were set up, namely, the Bo+Ch group with strains 7466 and 7126, the Bo+Cl group with strains 7466 and 7309, and the Ch+Cl group with strains 7126 and 7309.

[0169] (4) Treatment of three strain inoculations

[0170] One treatment was set up, which was a BCC group to which strains 7466, 7126, and 7309 were applied.

[0171] The soybean growth promotion pot screening experiment was repeated in 5 pots per treatment, with 10 seeds planted in each pot. Before planting soybeans, the strain inoculum was evenly mixed with the soil. The content of each strain in the single strain treatment was 10 6 CFU / g soil, the inoculation content of each strain in the double-strain treatment was 5×10 5 CFU / g soil, the inoculation content of each strain in the three-strain treatment was 3.33×10 5 CFU / g soil. The inoculated pots were moved to a light incubator and cultured under conditions of 16 h light, 25°C / 8 h dark, 18°C. Soybean germination was recorded daily in each group. Soybean samples were collected 14 days after sowing to measure plant height, stem diameter, taproot length, total root length, total root surface area, and aboveground fresh weight.

[0172] 2. Experimental Results and Analysis

[0173] (1) Identification of germination ability of soybean potted plants

[0174] The results are shown in Table 1 and Figure 11 As shown in the figure, on the fifth day after sowing, Botryotrichum globosum strain 7466, Chaetomium globosum strain 7126, and Cladosporium halotolerans strain 7309, whether as a single strain, a dual-strain combination, or a triple-strain combination, significantly improved soybean germination potential compared to the control. The triple-strain combination BCC achieved a germination rate of 98% at the end of the experiment, significantly outperforming the control and representing a 36.11% increase over the CK group, a 32.43% increase over the B group, a 13.95% increase over the F group, and a 32.43% increase over the BF group. Dual-strain inoculation and single-strain inoculation actually reduced soybean germination rates.

[0175] Table 1: Identification of the germination ability of different fungal combinations on soybean

[0176]

[0177]

[0178] Note: The germination potential was measured in the first 1 / 3 of the entire experimental period, that is, on the fifth day.

[0179] (2) Fungal combination promotes growth of aboveground parts of seedlings

[0180] The results are shown in Table 2 and Figure 11 As shown in the figure, on day 14 of sowing, the single strains, double strain combinations, and triple strain combinations of Botrytis cinerea 7466, Chaetomium globosum 7126, and Cladosporium halodendron 7309 all increased soybean plant height compared to the CK. However, looking at the overall aboveground part, the triple strain combination (BCC) significantly increased plant height and aboveground fresh weight compared to the CK, outperforming both the single strain and double strain groups. Compared to the CK, the BCC combination increased plant height by 36.90%, stem diameter by 4.19%, and aboveground fresh weight by 32.37%.

[0181] Table 2: Identification of the growth-promoting ability of different fungal combinations on soybean aerial parts

[0182] Group Plant height (cm) Stem diameter (mm) Fresh weight above ground (g) CK 13.66±1.91d 2.15±0.10ab 1.214±0.131b B 13.79±3.03d 2.10±0.17ab 1.242±0.155b F 15.35±2.52cd 2.10±0.19ab 1.298±0.174b BF 14.60±1.68d 2.09±0.21ab 1.258±0.133b Bo 14.96±2.99d 2.16±0.23ab 1.215±0.131b Ch 17.61±2.21abc 2.01±0.42ab 1.125±0.156b Cl 18.13±1.32ab 1.97±0.18b 1.251±0.133b Bo+Ch 17.97±3.10ab 2.03±0.22ab 1.287±0.196b Bo+Cl 18.44±1.99a 1.94±0.15b 1.145±0.101b Ch+Cl 15.78±3.11bcd 2.15±0.37ab 1.269±0.232b BCC 18.70±1.78a 2.24±0.13a 1.607±0.161a

[0183] Note: The numbers between different lowercase letters in the same column indicate significant differences (P<0.05).

[0184] (3) Fungal combination promotes growth of underground parts of soybean seedlings

[0185] The results are shown in Table 3 and Figure 12 As shown in Figure 3, the three-strain combination (BCC) significantly increased taproot length, underground fresh weight, and total root length compared to the control group, and was superior to the single-strain and dual-strain groups. Compared to the CK, the BCC combination significantly increased taproot length by 45.86%, underground fresh weight by 43.09%, and total root length by 29.17%, but had no significant effect on total root surface area.

[0186] Table 3: Identification of the growth-promoting ability of different fungal combinations on soybean underground parts

[0187]

[0188]

[0189] Note: The numbers between different lowercase letters in the same column indicate significant differences (P<0.05).

[0190] Example 4: Comparison of the effects of the fungal combination + barrier fungus group on soybean germination and seedling growth

[0191] 1. Experimental Materials and Methods

[0192] Soda-alkali soil was simulated by adding 1% of the sand's weight to a molar ratio of NaHCO₃:Na₂CO₃ = 9:1. Sand and saline-alkali soil (2 mm sieved) were then mixed in a 2:1 volume ratio and sterilized at least three times with high-pressure steam (121°C, 2 h) before use. The mixed soil was packaged in plastic pots of specific specifications (bottom diameter 6.7 cm, mouth diameter 9.7 cm, height 8.7 cm), 300 g per pot. Because the fungal inoculum consisted of a cornmeal-vermiculite solid fermentation medium, to maintain nutritional consistency, all soil groups were supplemented with the required maximum weight of the same medium and mixed thoroughly. The soil in the pots after these treatments had an electrical conductivity (EC) of 0.429 mS / cm and a pH of 8.56.

[0193] The following soybean pot experiment was conducted:

[0194] Control group: The barrier fungus group was selected as control group W. Barrier fungus group: A dual-bacterial agent was prepared using strains of the same origin (isolated from soda saline-alkali soil) of T. virescens 7313 and T. virescens 7464. The CFU ratio between the two strains was 1:1. When finally applied to the soil, the dosage of each fungus was 5×10 5 CFU / g soil (preparation method is the same as Example 2).

[0195] Treatment group: The BCC compound bacterial agent (see Example 3) was mixed with the CFU of the fungus group W at a ratio of 1:1 to prepare the treatment group T. The total amount of CFU fungal inoculum of the barrier fungus group and the BCC compound bacterial agent was 5×10 5 CFU / g soil, that is, the dosage of the near purple cytoplasm 7313 and the near tinea cyst 7464 is 2.5×10 5 CFU / g soil; the content of each strain inoculated in the BCC composite microbial agent was 1.667×10 5 CFU / g soil. Mix all fungal inocula until ready for use.

[0196] Three pots were planted for each treatment, with 10 seeds per pot. Before planting soybeans, the inoculum from each treatment was evenly mixed with the soil. The inoculated pots were transferred to a light incubator under conditions of 16 hours of light at 25°C / 8 hours of darkness at 18°C. Soybean germination was recorded daily for each group. On the 14th day after sowing, soybean samples were collected to measure plant height, stem diameter, taproot length, total root length, total root surface area, aboveground fresh weight, and aboveground fresh weight.

[0197] 2. Experimental Results and Analysis

[0198] (1) Effect of fungal combination BCC + barrier fungi group on promoting soybean germination

[0199] The results are shown in Table 4. On the seventh day, the germination rate of group W was 13.33%, while that of group T reached 33.33%. After the experiment, the germination rate of group T was 64.28% higher than that of group W.

[0200] Table 4: Evaluation of the antagonistic effect of fungal combination BCC and barrier fungal group on soybean germination ability

[0201] Group Germination potential (%) Germination rate (%) Remark W 13.33 46.67 control group T 33.33 76.67 Treatment group

[0202] Note: The germination potential was measured in the first 1 / 2 of the entire experimental period, that is, on the seventh day.

[0203] (2) Effect of fungal combination BCC + barrier fungi on growth promotion of aboveground part of soybean seedlings

[0204] The results are shown in Table 5. It can be seen that on the 14th day after sowing, the T group can significantly increase the plant height and aboveground fresh weight of soybeans compared with the W group. Compared with W, the T combination increased the plant height by 41.82%, the stem diameter by 10.00%, and the aboveground fresh weight by 50.98% ( Figure 13 ).

[0205] Table 5: Growth promotion of the aboveground part of soybean by the fungal combination BCC

[0206] Group Plant height (cm) Stem diameter (mm) Fresh weight above ground (g) W 12.17±2.18b 1.80±0.26 0.765±0.176b T 17.26±0.44a 1.98±0.19 1.155±0.095a

[0207] Note: The numbers between different lowercase letters in the same column are significantly different (P<0.05), and the independent sample t-test was used.

[0208] (3) Effect of fungal combination BCC + barrier fungi on the growth promotion of underground parts of soybean seedlings

[0209] The results are shown in Table 6. It can be seen that on the 14th day after sowing, the total root length of the soybean was significantly increased in the T group compared with the W group. The total root length of the T group was increased by 30.38% and the total root surface area was increased by 12.57% compared with the W group. Figure 13 ).

[0210] Table 6: Effect of fungal combination BCC on the growth promotion of underground parts of soybean seedlings

[0211] Group Taproot length (cm) Underground fresh weight (g) Total root length (cm) <![CDATA[Total root surface area (cm 2 )]]> W 2.42±0.66 0.132±0.032 25.0911±4.9716b 4.8263±1.2336 T 2.18±0.72 0.137±0.040 32.7141±2.8563a 5.4329±0.8730

[0212] The present invention has been described in detail above. For those skilled in the art, without departing from the purpose and scope of the present invention, and without the need to carry out unnecessary experimental conditions, the present invention can be implemented in a wide range under equivalent parameters, concentrations and conditions. Although the present invention provides specific embodiments, it should be understood that further improvements can be made to the present invention. In short, according to the principles of the present invention, this application is intended to include any changes, uses or improvements to the present invention, including changes that depart from the disclosed scope in this application and are made using conventional techniques known in the art.

Claims

1. A composition, characterized in that: The composition contains Botrytis cinerea, Chaetomium globosum and Cladosporium halodendron; The Botryotrichum atrogriseum is the Botryotrichum atrogriseum strain 7466, which is numbered ACCC 34101 in the Agricultural Microbiology Center of the China Culture Collection Administration; The Chaetomium globosum is the Chaetomium globosum strain 7126, which is numbered ACCC 34102 in the Agricultural Microbiology Center of the China Culture Collection Administration; The salt-tolerant Cladosporium is the salt-tolerant Cladosporium (Cladosporium halotolerans) strain 7309, which is numbered ACCC 34103 in the Agricultural Microbiology Center of the China Culture Collection Administration.

2. The composition according to claim 1, wherein: The main activities in the composition become the dark gray chrysosporium, the globosum and the haloduronic acid spore; In the composition, the CFU ratio of the Botrytis cinerea, the Chaetomium globosum and the Cladosporium halodendron is 1:1:

1.

3. The composition according to claim 1 or 2, characterized in that: The composition is a composite bacterial agent or a growth matrix for plants.

4. The composition according to any one of claims 1 to 3, characterized in that: The composition has at least one of the following characteristics: (A1) Improve plant tolerance to saline-alkali stress; (A2) promoting plant germination; (A3) Promote plant growth.

5. Use of the composition according to any one of claims 1 to 4 in any of the following: (B1) Improve plant tolerance to saline-alkali stress; (B2) preparing a product for improving the tolerance of plants to saline-alkali stress; (B3) Promote plant germination; (B4) preparing products for promoting plant germination; (B5) Promote plant growth; (B6) Preparation of products for promoting plant growth.

6. Use of the Botrytis cinerea, the Chaetomium globosum and the Cladosporium halodendron according to claim 1 in any of the following applications: (B1) Improve plant tolerance to saline-alkali stress; (B2) preparing a product for improving the tolerance of plants to saline-alkali stress; (B3) Promote plant germination; (B4) preparing products for promoting plant germination; (B5) Promote plant growth; (B6) Preparation of products for promoting plant growth.

7. A method for improving plant tolerance to saline-alkali stress, comprising the following steps (C1) or (C2): (C1) applying the composition according to any one of claims 1 to 4 to a plant or its growth medium, thereby improving the plant's tolerance to saline-alkali stress; (C2) applying the Botrytis cinerea, the Chaetomium globosum and the salt-tolerant Cladosporium of claim 1 to plants or their growth substrates, thereby improving the tolerance of the plants to saline-alkali stress.

8. A method for promoting plant germination and / or plant growth, comprising the following steps (D1) or (D2): (D1) applying the composition according to any one of claims 1 to 4 to a plant or its growth medium, thereby promoting germination of the plant and / or promoting growth of the plant; (D2) applying the Botrytis cinerea, the Chaetomium globosum and the Cladosporium halodendron of claim 1 to plants or their growth substrates, thereby promoting germination and / or growth of the plants.

9. The composition, use or method according to any one of claims 4 to 8, characterized in that: The promoting plant germination is promoting plant germination under saline-alkali stress; Furthermore, the promoting plant germination is promoting plant germination under saline-alkali stress and the presence of barrier fungi; and / or The promoting plant growth is promoting plant growth under saline-alkali stress; Furthermore, the promoting of plant growth is promoting plant growth under saline-alkali stress and the presence of barrier fungi.

10. The composition, use or method according to any one of claims 3 to 9, characterized in that: The plant is any one of the following: (E1) angiosperms; (E2) dicots; (E3) Fabales; (E4) Leguminosae; (E5) Glycine max; (E6)Soybean.

Images