A method for efficient genetic transformation and gene editing of brassica

By optimizing the PAM sequence of the CRISPR/Cas9 gene editing vector and introducing the GRF5-GIF1-GRF5 fusion protein, the problem of low efficiency in gene editing and genetic transformation of cabbage was solved, achieving highly efficient gene editing and genetic transformation results.

CN120519495BActive Publication Date: 2026-06-26INSTITUTE OF VEGETABLES & FLOWERS CHINESE ACADEMY OF AGRICULTURAL SCIENCES +2
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510595758.2
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Priority Date
2024-11-13
Filing Date
2025-05-09
Publication Date
2026-06-26
Estimated Expiration
2045-05-09

AI Technical Summary

Technical Problem

The gene editing and genetic transformation efficiency of cabbage is low. The transformation efficiency of the existing CRISPR/Cas9 technology is less than 1.0%, which is far lower than the 68% of rice, thus affecting the effectiveness of gene editing.

Method used

A CRISPR/Cas9 gene editing vector was used, and the PAM sequence was optimized to 5'-NGGT-3'. Simultaneously, an expression vector expressing the fusion protein GRF5-GIF1-GRF5 was introduced. Agrobacterium-mediated genetic transformation was then used to improve the regeneration and editing efficiency of cabbage.

Benefits of technology

It significantly improved the gene editing efficiency and genetic transformation efficiency of cabbage, with an average regeneration efficiency increase of 55.2% and an editing efficiency of 62.0%-62.5%, which is significantly higher than the existing technology level.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120519495B_ABST
    Figure CN120519495B_ABST
Patent Text Reader

Abstract

The application discloses a high-efficiency genetic transformation and gene editing method for cabbage, and belongs to the technical field of biological breeding, and comprises the following steps: (1) introducing a CRISPR / Cas9 gene editing vector into a callus of a target cabbage material; (2) screening the cabbage callus into which the CRISPR / Cas9 gene editing vector is successfully introduced, and subjecting the cabbage callus to regeneration culture; and (3) screening a T0 generation transgenic cabbage in which gene editing occurs; wherein the CRISPR / Cas9 gene editing vector contains sgRNA of a target editing gene, and a PAM sequence of the CRISPR / Cas9 gene editing vector is 5'-'NGGT'-3', wherein N is one of A, C and G. The method can significantly improve gene editing efficiency and types.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biotechnology, and in particular to a method for efficient genetic transformation and gene editing of cabbage. Background Technology

[0002] Brassica oleracea is an important biennial herbaceous species in the Brassicaceae family. It is estimated that 3.77 million hectares of cruciferous crops, such as cabbage, broccoli, and cauliflower, are cultivated globally, constituting an important agricultural resource (Li et al., 2024).

[0003] In recent years, CRISPR / Cas9 technology has been widely used in major crops such as rice, wheat, and potatoes. This technology can suppress gene expression to develop high-yielding, disease-resistant, or stress-tolerant crops (Gao, 2021; He et al., 2022).

[0004] However, the regeneration efficiency of transgenic cabbage is currently low, which limits the efficiency of Agrobacterium-mediated transformation to less than 1.0%, thus affecting the efficiency of CRISPR / Cas9 gene editing. Compared with the editing efficiency of 68% in rice, the editing efficiency of cabbage is low, at only 12.9% (Li et al., 2021). Summary of the Invention

[0005] In view of the needs and current status in this field, this invention provides a method for efficient genetic transformation and gene editing of cabbage based on research results, as follows:

[0006] In a first aspect, the present invention provides a method for efficient genetic transformation and gene editing of cabbage, characterized in that,

[0007] (1) Introduce the CRISPR / Cas9 gene editing vector into the callus tissue of the target cabbage material.

[0008] (2) Select cabbage callus tissues that have been successfully introduced into the CRISPR / Cas9 gene editing vector and regenerate them;

[0009] (3) Screening for T0 generation transgenic cabbage that has undergone gene editing;

[0010] The CRISPR / Cas9 gene editing vector contains the sgRNA of the target editing gene, and its PAM sequence is 5'-'NGGT'-3', where N is one of A, C, or G.

[0011] Preferably, the method is characterized in that it further includes, before or after, introducing an expression vector expressing the fusion protein GRF5-GIF1-GRF5 into the target cabbage material while introducing the CRISPR / Cas9 gene editing vector into the target cabbage material;

[0012] The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 has any of the following characteristics:

[0013] (1) From the N to the C end, the GRF5-1 peptide shown in Seq ID No.33, the GIF1 peptide shown in Seq ID No.37, and the GRF5-2 peptide shown in Seq ID No.34 were linearly fused; the peptides were linked by 3 to 5 alanine residues.

[0014] (2) From the N to the C end, its amino acid sequence is obtained by linear fusion of the GRF5-2 peptide shown in Seq ID No.34, the GIF1 peptide shown in Seq ID No.37, and the GRF5-1 peptide shown in Seq ID No.33; the peptides are linked by 3 to 5 alanine residues.

[0015] Preferably, in the method, the introduction of the CRISPR / Cas9 gene editing vector is carried out through Agrobacterium-mediated genetic transformation; the introduction of the expression vector for the fusion protein GRF5-GIF1-GRF5 is also carried out through Agrobacterium-mediated genetic transformation.

[0016] In another aspect, the present invention provides a cabbage growth regulator fusion protein, characterized in that its structure is represented as GRF5-GIF1-GRF5, and its amino acid sequence has any of the following characteristics:

[0017] (1) From the N to the C end, the GRF5-1 peptide shown in Seq ID No.33, the GIF1 peptide shown in Seq ID No.37, and the GRF5-2 peptide shown in Seq ID No.34 were linearly fused; the peptides were linked by 3 to 5 alanine residues.

[0018] (2) From the N to the C end, its amino acid sequence is obtained by linear fusion of the GRF5-2 peptide shown in Seq ID No.34, the GIF1 peptide shown in Seq ID No.37, and the GRF5-1 peptide shown in Seq ID No.33; the peptides are linked by 3 to 5 alanine residues.

[0019] Preferably, the cabbage growth regulator fusion protein is characterized in that its amino acid sequence is as shown in Seq ID No. 38.

[0020] In another aspect of the invention, protection is sought for providing a nucleotide sequence encoding the aforementioned cabbage growth regulator fusion protein.

[0021] Preferably, the nucleotide sequence is as shown in Seq ID No. 41.

[0022] In another aspect of the invention, protection is claimed for an expression vector loaded with the aforementioned nucleotide sequence.

[0023] The present invention further provides a kit for improving the efficiency of genetic transformation and gene editing of cabbage, characterized in that it contains a CRISPR / Cas9 gene editing vector, wherein the PAM sequence of the gene editing vector is 5'-'NGGT'-3', and N is one of A, C, or G.

[0024] Preferably, the kit is characterized in that it further comprises an expression vector expressing the cabbage growth regulator fusion protein.

[0025] This invention improves the gene editing and genetic transformation methods for cabbage. Experimental data show that, taking the PDS gene editing as an example, selecting 'T' as the last position of the PAM sequence 5'-NGG-3' in the CRISPR / Cas9 vector significantly increases the editing types and improves the editing efficiency of the CRISPR / Cas9 gene editing system in both dicotyledonous cabbage and monocotyledonous rice. Simultaneously, transforming the expression vector for the fusion protein GRF5-GIF1-GRF5 increases the average regeneration efficiency of cabbage by 55.2%. These improvements can significantly enhance the efficiency of molecular breeding of cabbage. In breeding applications experiments involving cabbage susceptibility genes (BoDMR6, BoBPM6) discovered concurrently by the inventors, the improved gene editing technology and genetic transformation method of this invention, when used to perform first-generation sequencing on selected T0 generation positive plants, showed that the transformation efficiencies of bobpm6 and bodmr6 were 5.5% and 8.2%, respectively; the editing efficiencies were 62.0% and 62.5%, respectively. These results are significantly higher than the technical levels reported in the art (cabbage genetic transformation efficiency is less than 1%, and editing efficiency is only 12.9%). Attached Figure Description

[0026] Figure 1 This is a schematic diagram of the PDS gene editing vector structure constructed by the present invention to study the effects of different PAM sequences on gene editing efficiency and type;

[0027] Figure 2 The experimental results show the effects of different PAM sequences on the efficiency and type of gene editing in rice.

[0028] The top graph shows rice plants where the OsPDS gene was knocked out using NGGN and NGGT PAM sequences, with red circles indicating plants that did not undergo gene editing; the bottom graph shows the rice OsPDS gene editing efficiency (bar graph) and editing type (line graph).

[0029] Figure 3 The experimental results show the effects of different PAM sequences on the efficiency and type of gene editing in cabbage.

[0030] The top graph shows the knockout of the BoPDS gene using NGGN and NGGT for PAM sequences, with Mock representing cabbage plants that did not undergo gene editing; the bottom graph shows the gene editing efficiency (bar graph) and editing type (line graph) of cabbage.

[0031] Figure 4 This invention presents the results of a study on the effects of growth condition factors on genetic transformation and regeneration efficiency. Specifically, the treatment expressing the GRF5-GIF1-GRF5 fusion protein resulted in an average increase of 55.2% in the regeneration efficiency of cabbage.

[0032] Figure 5 The diagram illustrates the structure of the cloned BoDMR6 gene and the gene editing process of this invention. Light pink represents the gene coding region (exon), dark pink represents the intron region, and the red underlined target 1 at the bottom of the first exon region represents the sgRNA target region. The nucleotide sequence below represents target region 1, where the wild-type target nucleotide sequence is shown underlined, and the other four are from the T0 generation mutant that underwent gene editing. Blue broken lines indicate deletions, and yellow letters indicate insertions. ACCG before the target site represents the PAM sequence.

[0033] Figure 6 The diagram illustrates the structure of the BoBPM6 gene cloned in this invention and the gene editing process. Light pink represents the gene coding region (exon), dark pink represents the intron region, and the red underlined target 1 at the bottom of the first exon region represents the sgRNA target region. The nucleotide sequence below represents target region 1, where the wild-type target nucleotide sequence is shown underlined, and the other four are from the T0 generation mutant that underwent gene editing. Blue broken lines indicate deletions, and yellow letters indicate insertions. ACCG before the target site represents the PAM sequence.

[0034] Figure 7 The results of a disease resistance study on bodmr6 plants with BoDMR6 gene editing are shown. Among them, the disease index of plants inoculated with black rot fungus decreased from 79.3 to 55.1; and the disease index of plants inoculated with clubroot disease decreased from 90.7 to 57.6 (significant).

[0035] Figure 8 The results of a study on the disease resistance of bobpm6 plants with BoBPM6 gene editing are shown. The disease indices for Fusarium wilt, black rot, and clubroot decreased significantly from 65.4 to 14.5, from 53.8 to 20.9, and from 63.1 to 55.7, respectively. Detailed Implementation

[0036] The present invention will be further described below with reference to specific implementation methods and accompanying drawings, but the present invention is not limited to the following embodiments. Unless otherwise specified, the experimental methods used in the following embodiments are conventional methods in the art, and the reagents used are commercially available.

[0037] Experimental materials used in this study:

[0038] The rice genetic transformation material used in this experiment was Nipponbare.

[0039] The wild-type cabbage variety 'M1' is an inbred line material, which the applicant's unit has preserved and can provide for verification experiments;

[0040] The CRISPR / Cas9 vector used for rice is pVS1, purchased from Addgene™.

[0041] The CRISPR / Cas9 vector used for cabbage was pYLCRISPR / Cas9-35S-B, purchased from Addgene. TM ;

[0042] Example 1. Construction of CRISPR / Cas9 editing vectors and the effect of PAM sequences on gene editing efficiency and editing type.

[0043] The inventors observed in their research that Cas9 (ScCas9) from *Streptococcus canis* requires a spacer adjacent motif (PAM) sequence such as 5'-NNG-3', after which any base can be chosen; however, editing efficiency is higher when the base following the PAM sequence is "T". http: / / crispor.tefor.net / ).

[0044] To test whether the "T" after the SpCas9 PAM sequence could enhance the editing efficiency of CRISPR / Cas9 technology, the inventors constructed CRISPR / Cas9 gene editing vectors (OsPDS and BoPDS) for rice and cabbage, respectively, to knock out the phytoene dehydrogenase gene PDS.

[0045] S1. Construction of PDS gene editing vector

[0046] To construct PDS knockout editing vectors for cabbage and rice, 5'-NGGN-3' and 5'-NGGT-3' were selected as the PAM sequences for rice and cabbage, respectively, where 'N' represents the three bases other than 'T'.

[0047] Based on the selected target sites and PAM sequences, target introduction sequence sgRNA and its adapter primers were designed (Table 1). After synthesis, they were ligated into pVS1 to obtain the rice PDS gene editing vector OsPDS. Similarly, based on the selected target sites and PAM sequences, target introduction sequence sgRNA and its adapter primers were designed (Table 2). After synthesis, they were ligated into pYLCRISPR / Cas9-35S-B(Bol) vector to obtain the cabbage PDS gene editing vector BoPDS.

[0048] A schematic diagram of the CRISPR / Cas9 construct is shown below. Figure 1 As shown: Figure A is a schematic diagram of the CRISPR / Cas9 construct OsPDS used for PDS editing in rice; NGGN (N1-N3) and NGGT (T1-T3) represent the locations of the target sites; Figure B is a schematic diagram of the CRISPR / Cas9 construct BoPDS used for PDS editing in cabbage; NGGN (N1-N2) and NGGT (T1-T2) represent the locations of the target sites.

[0049] Table 1. Rice PDS gene sgRNA sequence

[0050]

[0051]

[0052] Table 2. sgRNA sequence of PDS gene in cabbage

[0053]

[0054] The impact of S2.5'-NGGT-3'PAM sequences on CRISPR / Cas9 editing efficiency and the diversity of editing types

[0055] The rice editing vector OsPDS and the cabbage editing vector BoPDS constructed from S1 were introduced into the rice variety Nipponbare and the wild-type cabbage variety M1 through Agrobacterium-mediated genetic transformation, respectively.

[0056] Transform Agrobacterium according to standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix well, and then incubate on ice, in liquid nitrogen, at 37°C, and on ice for 5 min each time. Add 800 μl of LB liquid medium (antibiotic-free) and incubate at 200 rpm and 28°C with shaking for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard part of the supernatant, and gently aspirate the remaining bacterial cells. Spread the mixture onto LB solid medium containing kanamycin and rifampin, and incubate upside down at 28°C for 2-3 days to obtain Agrobacterium plasmids containing the PDS gene editing vectors BoPDS and OsPDS.

[0057] Rice genetic conversion is a well-known technique in the field, and the following is an example operation.

[0058] (1) Co-culture stage: The Agrobacterium that has been cultured in advance on AB medium is diluted with AAM liquid medium containing an appropriate amount of AS to about 0.2 OD600 to start the co-culture stage. The diluted bacterial solution is co-cultured with the pre-cultured vigorous rice callus for 3 days.

[0059] (2) Screening and Culture Stage: After co-culturing, the callus tissue is thoroughly cleaned with pre-sterilized sterile water containing antibiotic Tm and allowed to air dry at room temperature. All of the above operations should be performed under sterile conditions in a laminar flow hood. After the callus tissue is completely dried, it is transferred to a screening medium containing an appropriate amount of antibiotics using forceps. The medium is changed approximately every 10 days under light. Screening is performed by setting a gradient of decreasing antibiotic concentration, and the screening is repeated approximately 2-3 times.

[0060] (3) Differentiation stage: The selected callus tissue with good activity is transferred to the differentiation medium. The callus tissue with good activity will gradually turn green and differentiate into seedlings.

[0061] (4) Rooting stage: Transfer rice seedlings with a small amount of callus tissue to a rooting culture medium and culture them under light for about 2 weeks until most roots have grown.

[0062] Genomic DNA was extracted from rice seedlings, and resistance primers were used to identify the transformed seedlings. Positive rice lines were initially screened out and then further identified after being transplanted to the field.

[0063] The genetic conversion of cabbage is a well-known technique in the field, and the following is an example operation.

[0064] (1) Obtaining cabbage explants

[0065] Select mature, plump, and round cabbage seeds free of mold and disease spots. Disinfect the seeds with 75% alcohol for 3 minutes, then with 8-10% sodium hypochlorite solution for 8-10 minutes. Rinse three times with sterile water. After sterilization, blot off excess water using sterile filter paper in a laminar flow hood and arrange the seeds evenly on solid MS medium. Incubate for 5-7 days under 16h light / 8h dark conditions. Cut the cabbage hypocotyls into 0.8-1cm lengths to serve as recipients for Agrobacterium-mediated transformation.

[0066] (2) Genetic transformation of cabbage

[0067] Agrobacterium plasmids containing the PDS gene editing vector were cultured to OD600 = 0.4-0.6, centrifuged at 6000 rpm for 10 minutes, and then resuspended in liquid MS medium as the infection solution.

[0068] Infect cabbage explants for 8-10 minutes, then incubate in a co-culture medium at 25°C in the dark for 36-48 hours. Subsequently, transfer the explants to a selection medium containing 10 mg / L Basta, and maintain a 16-hour light / 8-hour dark cycle, changing the selection medium every two weeks. Once resistant shoots reach approximately 2-3 cm in length, cut them off and transfer them to a seedling growth medium containing termethin, and culture for 20-30 days under a 16-hour light / 8-hour dark cycle. Then, culture them in a rooting medium for 20 days. Plants with well-developed root systems are then transferred to vermiculite for 7 days to harden off before transplanting into potting soil.

[0069] After PCR amplification using Bar primers, T0 generation positive plants were obtained by detection using 1.0% agarose gel electrophoresis.

[0070] The Bar primer sequences are as follows:

[0071] BarH-F:5'-AAACCCACGTCATGCCAGTT-3'; SEQ ID No.31

[0072] BarH-R:5'-GTCTGCACCATCGTCAACCAC-3'; SEQ ID No.32

[0073] The selected T0 generation positive plants were subjected to first-generation high-throughput sequencing, and the sequencing results were statistically analyzed.

[0074] The results show:

[0075] For rice, among the positive edited plants with OsPDS knockout, the average increase in edit type using 'NGGT' compared to 'NGGN' was 28.6%; the average increase in edit efficiency was 13.8%. Figure 2 (and Table 3).

[0076] Table 3 shows statistical data on rice gene editing types and efficiency using different PAM sequences.

[0077]

[0078]

[0079]

[0080] For cabbage, knocking out BoPDS resulted in albino phenotypes in positively edited cabbage plants, with 'NGGN' edited plants essentially exhibiting chimerism. 'NGGT' showed a higher degree of editing in cabbage plants compared to 'NGGN,' with editing efficiency increasing from an average of 20.4% to an average of 68.7%. Figure 3 As shown in Table 4.

[0081] Table 4. Statistics on gene editing types and efficiency in cabbage

[0082]

[0083]

[0084] Results in rice and cabbage showed that selecting 'T' after 5'-NGG-3' of the PAM sequence significantly increased the number of editing types and improved the editing efficiency of the CRISPR / Cas9 gene editing system.

[0085] Example 2. Effect of fusion expression of GRF5-GIF1-GRF5 on regeneration efficiency of Brassica oleracea

[0086] The vector used in the genetic system experiments was a modified pCAMBIA1301 vector (purchased from Addgene). TM The empty vector pBWA(V)BS-Empty replaces the Hyg resistance in the original vector with Basta resistance.

[0087] The experimental material was the cabbage inbred line 'M1'.

[0088] Studies have found that overexpression of certain plant growth regulators can significantly improve plant regeneration efficiency in transgenic tissue culture (Debernardi et al., 2020).

[0089] Through bioinformatics analysis, the research team of this invention identified 19 growth regulatory factor (GRF) proteins and 1 GRF interaction factor (GIF) protein in the cabbage genome.

[0090] Further studies were conducted on two GRF5 proteins, two GRF4 proteins, and one GIF1 protein. Two GRF5 proteins (Seq ID No. 33 and Seq ID No. 34) and two GRF4 proteins (Seq ID No. 35 and Seq ID No. 36) were fused with GIF1 protein (Seq ID No. 37) through a four-alanine residue linking to express GRF5-GIF1-GRF5 (Seq ID No. 38 or Seq ID No. 39) and GRF4-GIF1-GRF4 (Seq ID No. 40), respectively.

[0091] The effects of four proteins (GRF5-GIF1-GRF5, GRF4-GIF1-GRF4, GRF5, and GIF1) and a blank control on the regeneration efficiency of cabbage were tested, see [link to study]. Figure 4The nucleotide sequences (Seq ID No. 41-44) encoding four proteins were constructed into the expression vector pBWA(V)BS-Empty and introduced into the wild-type cabbage variety M1 via Agrobacterium-mediated genetic transformation.

[0092] The genetic transformation operation is the same as S2 in Example 1.

[0093] The results showed that the average regeneration efficiency of the cabbage transformant expressing GRF5-GIF1-GRF5 was increased by 55.2%. Figure 4 .

[0094] Table 5 shows the nucleotide or amino acid sequences involved in the examples.

[0095]

[0096]

[0097]

[0098]

[0099] Example 3: Discovery and cloning of the gene BoBPM6, and construction of the gene editing vector.

[0100] The inventors discovered a new differentially expressed gene in cabbage, BTB / POZ (Broad complex, Tramtrack, Bric-a-brac / Pox virus and Zinc finger)-MATH 6 (BPM6). Studies have reported that this gene is induced by wilt and black rot, and the inventors speculate that it may be a susceptibility gene that induces the occurrence of various diseases.

[0101] Previous studies have confirmed that DMR6 is a conserved susceptibility (S) gene, and inactivation of the tomato DMR6 gene can give it broad-spectrum disease resistance (Thomazella et al., 2021); the inventors speculate that inactivation or expression inhibition of DMR6 in cabbage may also give it broad-spectrum disease resistance.

[0102] To test whether the BPM6 and DMR6 genes in cabbage could be used to generate broad-spectrum disease resistance in cabbage, the inventors constructed a gene-editing vector to knock them out.

[0103] By designing primers (Table 6)

[0104] Table 6

[0105]

[0106] Using DNA from wild-type M1 cabbage as a template, the BPM6 and DMR6 genomic fragments from cabbage were obtained. BoBPM6 is 3526 bp in length (Seq ID No. 49), with a coding region consisting of 2326 bp (Seq ID No. 50). BoDMR6 is 6757 bp in length (Seq ID No. 51), with a coding region consisting of 1026 bases (Seq ID No. 52). The sequences are shown in Table 7.

[0107] i. Constructing the CRISPR / Cas9 editing platform for BoBPM6:

[0108] (1) pYLCRISPR / Cas9-35S-B was selected as the gene editing vector framework;

[0109] (2) 5'-'NGGT'-3' was selected as the PAM sequence for the BPM6 editing vector of cabbage;

[0110] (3) Subsequently, the following sgRNAs and their adapter primers were designed for the BoDMR6 and BoBPM6 genes.

[0111] BoDMR6 sgRNA:ACCG TCCACGTCTCTCCCAAGTTT Seq ID No. 53, see Figure 5

[0112] BD6-F:cagtGGTCTCatgca TCCACGTCTCTCCCAAGTTT gttttaga, Seq ID No. 54

[0113] BD6-R:cagtGGTCTCaaaac AAACTTGGGAGAGACGTGGA CGGT, Seq ID No. 55

[0114] BoBPM6 sgRNA: CTCCAAGTCCGTGACGCAGA CGG, Seq ID No. 56, see Figure 6

[0115] BB6-F:cagtGGTCTCatgca CTCCAAGTCCGTGACGCAGAG ttttaga, Seq ID No. 57

[0116] BB6-R:cagtGGTCTCaaaac TCTGCGTCACGGACTTGGAG Seq ID No. 58

[0117] After the synthesized adapter primers were annealed into double strands, they were digested and ligated into the pYLCRISPR / Cas9-35S-B vector to obtain the BoDMR6 gene editing vector and the BoBPM6 gene editing vector.

[0118] Example 4. BoBPM6 gene editing in cabbage materials

[0119] The BPM6 gene editing vector constructed in Example 3, together with the expression vector of the GRF5-GIF1-GRF5 fusion protein (Seq ID No. 38) constructed in Example 2, were co-transformed into the wild-type cabbage variety M1 via Agrobacterium-mediated genetic transformation.

[0120] Transform Agrobacterium according to standard procedure: Add 1 μg of plasmid to 100 μl of competent Agrobacterium cells, mix well, and then incubate on ice, in liquid nitrogen, at 37°C, and on ice for 5 min each time. Add 800 μl of LB liquid medium (antibiotic-free) and incubate at 200 rpm and 28°C with shaking for 3 hours. Centrifuge at 5000 rpm for 1 minute, discard part of the supernatant, gently aspirate the remaining supernatant to mix the cells, and spread it onto LB solid medium containing kanamycin and rifampin. Incubate upside down at 28°C for 2-3 days.

[0121] The genetic transformation method is the same as S2 in Example 1.

[0122] The selected T0 generation positive plants were subjected to first-generation sequencing. The genetic transformation efficiencies of bobpm6 and bodmr6 were 5.5% and 8.2%, respectively; the editing efficiencies were 62.0% and 62.5%, respectively.

[0123] Wherein, transformation efficiency = number of positive plants / number of infected explants; editing efficiency = number of edited plants / number of positive plants.

[0124] The conversion efficiency was significantly higher than the 1% cabbage conversion efficiency and 12.9% editing efficiency reported in existing literature.

[0125] T1 generation seeds were obtained through self-pollination and seed saving. First-generation sequencing was performed on randomly selected seeds: bodmr6 and bobpm6 yielded 4 and 3 edit types, respectively. Figure 5 and Figure 6 );

[0126] Example 5. Disease resistance test of BoBPM6 gene-edited materials

[0127] The T1 generation of cabbage obtained in Example 4 was inoculated with Fusarium wilt, black rot, and clubroot pathogens (the three main diseases of cabbage).

[0128] Black rot is treated by artificial inoculation using a spray method:

[0129] (1) Preparation of bacterial culture: The preserved black rot pathogen (Xanthomonas campestris pv. Campestris) was streaked to activate it. The activated black rot pathogen was then added to liquid PSA medium in the form of a bacterial clump using an inoculation loop. The medium was incubated in the dark for 16 h at 28 °C and 200 rpm in a shaker. The OD was adjusted with sterile water. 600 Once the value is 0.2, prepare for vaccination.

[0130] (2) Inoculation process: Once the seedlings have grown to 4-5 true leaves, they can be prepared for inoculation. One day before inoculation, move the seedlings to the inoculation site, thoroughly water the seedling substrate, and spray the leaves with water using a sprayer. Cover with a film to maintain moisture until inoculation, ensuring that the film contains more than 90% moisture so that the water pores on the leaf edges are open before inoculation. Use a sprayer to evenly spray the bacterial solution onto the leaves until the leaves are completely covered with the bacterial solution. Control the temperature at around 28℃.

[0131] (3) Resistance survey and resistance level classification: Resistance evaluation criteria: Grade 0, no symptoms on inoculated leaves; Grade 1, less than 5% of leaf area; Grade 3, 5-15% of leaf area; Grade 5, 15-30% of leaf area; Grade 7, 30-50% of leaf area; Grade 9, greater than 50% of leaf area. DI = Σ(number of diseased leaves × extreme value of the disease) / (total number of investigated leaves × highest disease grade) × 100. Highly resistant (HR), 0 < DI ≤ 10; resistant (R), 10 < DI ≤ 30; moderately resistant (MR), 30 < DI ≤ 50; susceptible (S), 50 < DI ≤ 70; highly susceptible (HS), DI > 70.

[0132] Fusarium wilt pathogens were artificially inoculated using the root-dipping method.

[0133] (1) Preparation of bacterial culture: The preserved Fusarium oxysporum f.sp. Conglutinans pathogen was added to liquid CM medium and cultured in a shaker at 28°C under darkness for 3 days. The mycelium was filtered through gauze, and the remaining spores were adjusted to 1x10⁻⁶. 6 After achieving a concentration of / mL, prepare for inoculation.

[0134] (2) Inoculation process: After the seedlings have grown to 3 true leaves, they can be inoculated. Before inoculation, pull the seedlings out of the seedling tray substrate and wash the roots. Soak the roots completely in the bacterial solution. After 15 minutes, take out the seedlings, transplant them into seedling bowls filled with soil and move them to a temperature-controlled greenhouse. The temperature is controlled at 23-29℃.

[0135] (3) Resistance investigation and resistance level classification: Resistance evaluation criteria: Grade 0, asymptomatic; Grade 1, 1 leaf slightly yellowed; Grade 2, 1 - 2 leaves moderately yellowed; Grade 3, half of the leaves severely yellowed or wilted; Grade 4, all leaves severely yellowed or wilted except the heart leaf; Grade 5, all leaves of the whole plant severely yellowed or the plant died. Investigate the disease spot level of the inoculated leaves of the investigated materials, calculate the average disease index (Disease index, DI), and classify the resistance level according to the disease index. DI = [Σ (each disease grade × the number of diseased plants at the corresponding level) / (total number of investigated plants × the highest disease grade)] × 100. Highly resistant (HR), 0 < DI ≤ 10; Resistant (R), 10 < DI ≤ 30; Moderately resistant (MR), 30 < DI ≤ 50; Susceptible (S), 50 < DI ≤ 70; Highly susceptible (HS), DI > 70.

[0136] Artificial inoculation of clubroot disease was carried out by root irrigation method:

[0137] (1) Preparation of bacterial solution: The clubroot of cabbage stored in a -20°C refrigerator was pre-activated at room temperature for 12 h, added with three times the volume of sterile water, and then thoroughly crushed using a juicer. The filtrate was filtered using gauze and collected in a 50 ml centrifuge tube, centrifuged at 600 rpm for 10 min, and the supernatant was collected. Then, it was centrifuged at 3500 rpm for 10 min to collect the bacteria, which were resuspended with sterile water. The spore concentration was adjusted to 2x10 7 cfu / mL under a microscope.

[0138] (2) Inoculation process: Inoculation was carried out when the cabbage seedlings grew to 2 true leaves. After scratching the roots of each plant with a small knife twice, 2 mL of the bacterial solution was aspirated using a pipette and injected into the roots of the seedlings, and the seedlings were moved to a temperature-controlled greenhouse with the temperature controlled at 18 - 25°C.

[0139] (3) Resistance investigation and resistance level classification: Resistance evaluation criteria: Grade 0 = no symptoms on the roots; Grade 1 = no symptoms on the main root, small nodules on the lateral roots; Grade 2 = slightly enlarged main root, larger tumors on the lateral roots; Grade 3 = severely enlarged main root, obvious lateral roots; Grade 4 = extremely severely enlarged main root, almost no lateral roots. DI = ∑ (number of diseased plants at each level × corresponding disease level) / (total number of investigated plants × highest disease level) × 100. Resistance evaluation criteria: Immune (I): DI = 0; Highly resistant (HR): 0 < DI ≤ 5; Resistant (R): 5 < DI ≤ 20; Moderately resistant (MR): 20 < DI ≤ 30; Susceptible (S): 30 < DI ≤ 60; Highly susceptible (HS): DI > 60.

[0140] The investigation results showed that:

[0141] Compared with wild-type cabbage, the disease indices of bodmr6 plants inoculated with Fusarium wilt, black rot, and clubroot decreased from 79.0 to 78.4, from 79.3 to 55.1 (significant), and from 90.7 to 57.6 (significant), respectively. Figure 7 );

[0142] Compared with wild-type cabbage, the disease indices of bobpm6 plants inoculated with Fusarium wilt, black rot, and clubroot decreased from 79.0 to 78.4, from 79.3 to 55.1 (significant), and from 90.7 to 57.6 (significant), respectively. Figure 8 );

[0143] The above experimental results demonstrate that the BoDMR6 and BoBPM6 genes are sensitive genes that induce various cabbage diseases. Knocking out or inhibiting the expression of these genes can yield new germplasm with broad-spectrum disease resistance. Combined with the optimized gene editing and genetic transformation system provided by this invention, it offers strong technical support for disease-resistant cabbage breeding.

[0144] Table 7

[0145]

[0146]

[0147]

[0148]

Claims

1. A method for efficient genetic transformation and gene editing of cabbage, characterized in that, (1) Introduce the CRISPR / Cas9 gene editing vector into the callus tissue of the target cabbage material. (2) Select cabbage callus tissues that have been successfully introduced into the CRISPR / Cas9 gene editing vector and perform regeneration culture on them; (3) Screening for T0 generation transgenic cabbage that has undergone gene editing; The CRISPR / Cas9 gene editing vector contains the sgRNA of the target editing gene, and its PAM sequence is 5'-'NGGT'-3', where N is one of A, C, or G; It also includes introducing an expression vector for the fusion protein GRF5-GIF1-GRF5 before or after introducing the CRISPR / Cas9 gene editing vector into the target cabbage material; The amino acid sequence of the fusion protein GRF5-GIF1-GRF5 is shown in Seq ID No.

38.

2. The method according to claim 1, wherein the CRISPR / Cas9 gene editing vector is introduced via Agrobacterium-mediated genetic transformation; the expression vector for the fusion protein GRF5-GIF1-GRF5 is also introduced via Agrobacterium-mediated genetic transformation.

3. A fusion protein of cabbage growth regulator, characterized in that, Its structure is represented as GRF5-GIF1-GRF5, and its amino acid sequence is shown in Seq ID No.

38.

4. A nucleotide molecule encoding the cabbage growth regulator fusion protein of claim 3.

5. The nucleotide molecule according to claim 4, as shown in Seq ID No.

41.

6. An expression vector for expressing the cabbage growth regulator fusion protein of claim 3, wherein the vector is loaded with the nucleotide molecule of claim 4 or 5.

7. A kit for improving the efficiency of genetic transformation and gene editing in cabbage, characterized in that, It comprises a CRISPR / Cas9 gene editing vector and the expression vector of claim 6, wherein the PAM sequence of the gene editing vector is 5'-'NGGT'-3', where N is one of A, C, or G.

Citation Information

Patent Citations

  • Wild cabbage BoMS1 gene and application thereof to preparation of sterile materials

    CN109161551A

  • Novel pro-stromal sequence proximity motif sequences and methods for modifying target nucleic acids in cellular genomes using same

    CN114555803A

  • Crispr-cas enzymes with enhanced on-target activity

    US20210261932A1