A glycosyltransferase mutant and its application in synthesis of steviol glycosides

Abstract

The application belongs to the technical field of bioengineering, and discloses a glycosyltransferase mutant and application thereof in synthesis of steviol glycoside. The glycosyltransferase mutant is obtained by making at least one point mutation in an amino acid sequence such as SEQ ID NO. 1. The mutated genes are respectively cloned into pETDuet-1 and pCDFDuet-1 carrier plasmids containing sucrose synthase to obtain carrier plasmid A and carrier plasmid B, and then transformed into E. coli for expression. The obtained enzyme can be applied to the production of steviol glycoside D. Meanwhile, carrier plasmid C containing glycosyltransferase UGT76G4 and sucrose synthase and carrier plasmid D containing glycosyltransferase NtUGT-M8 and sucrose synthase are prepared. Carrier plasmid A and carrier plasmid C are simultaneously transformed into E. coli for the production of steviol glycoside M. Carrier plasmid B and carrier plasmid D are simultaneously transformed into E. coli for the production of steviol glycoside M2. The recombinant bacteria obtained by the application can efficiently prepare steviol glycoside D, steviol glycoside M and steviol glycoside M2, respectively.

Description

TECHNICAL FIELD

[0001] The present application belongs to the field of bioengineering technology, and particularly relates to a glycosyltransferase mutant and application thereof in synthesis of steviol glycoside. BACKGROUND

[0002] Steviol glycoside is a natural high-potency sweetener extracted from Stevia rebaudiana, which has the advantages of safe eating, low heat and stability, and is widely used in food and pharmaceutical industries. The chemical diversity of steviol glycoside is reflected in the combination of one to three glucose groups with the C13-hydroxyl and / or C19-carboxylic acid position of the diterpene steviol backbone. Steviol glycoside (St, containing 3 beta-glycosyl) and steviol glycoside A (RebA, containing 4 beta-glycosyl) are the main components, while steviol glycoside D (RebD, containing 5 beta-glycosyl) and steviol glycoside M (RebM, containing 6 beta-glycosyl) are the secondary components. Because of the low content, it is difficult to prepare by extraction method, and the yield is low, which cannot meet the market demand.

[0003] Steviol glycoside D is a steviol glycoside with a sweetness of 200-300 times that of sucrose, but its short aftertaste affects its application and promotion in the market. Steviol glycoside M has a sweetness of about 300-400 times that of sucrose, almost no aftertaste, and has potential medical application value, so its market application is wider; there are reports on the use of glycosyltransferase coupled sucrose synthase to synthesize steviol glycoside M in the existing preparation method of steviol glycoside M, but the catalysis is usually carried out with steviol glycoside D which has poor solubility, so the efficient production of steviol glycoside M is limited.

[0004] Steviol glycoside M2 is obtained by adding a glucose group at the C-6' position of the first glucose group at the C19 position of steviol glycoside D. Compared with steviol glycoside D, the sweetness of steviol glycoside M2 increases and the aftertaste disappears. Therefore, steviol glycoside M2 has better sugar properties and more ideal taste than steviol glycoside D. Steviol glycoside M2 can be generated from steviol glycoside D by the catalytic action of glycosyltransferase, but also has the defects of low yield and easy generation of by-products. SUMMARY

[0005] The first technical problem to be solved by the present application is to provide a glycosyltransferase mutant. The glycosyltransferase mutant is obtained by single-point and combined mutation of the amino acids in the original sequence of glycosyltransferase, and the mutant is cloned into a recombinant plasmid and transformed into a recombinant bacterial body for production of steviol glycoside D.

[0006] The second technical problem to be solved by the present application is to provide an application of a glycosyltransferase mutant, which utilizes the coupling of the PgUGT mutant and sucrose synthase AtSuSy, and constructs a cascade reaction system with AtSuSy-76G4 to catalyze RebA to generate RebM.

[0007] The third technical problem to be solved by the present application is to provide an application of a glycosyltransferase mutant, which utilizes the coupling of the PgUGT mutant and sucrose synthase AtSuSy, and constructs a cascade reaction system with AtSuSy-NtUGT-M8 to catalyze RebA to generate RebM2.

[0008] To solve the above technical problems, the technical scheme of the present application is as follows:

[0009] A glycosyltransferase mutant is obtained by making four single-point mutations in the amino acid sequence of SEQ ID NO. 1 (Panax ginseng, Protein ID: AKA44579.1), wherein the single-point mutations are C41I (the middle digit 41 represents the mutation site position, and the same applies to the following site mutations) from cysteine (C) to isoleucine (I), A140S from alanine (A) to serine (S), N283P from asparagine (N) to proline (P), and A342L from alanine (A) to leucine (L).

[0010] And the mutants of C41I+N283P (double-site mutation), C41I+A140S+N283P (triple-site mutation), and C41I+A140S+N283P+A342L (quadruple-site mutation) are prepared by single-point mutation.

[0011] The mutated amino acid sequences are shown in SEQ ID NO. 2 to SEQ ID NO. 8.

[0012] A recombinant plasmid A is prepared by connecting the nucleotide sequence containing the above glycosyltransferase mutant to the pETDuet-1 vector plasmid containing the sucrose synthase gene (the original sequence of Arabidopsis thaliana sucrose synthase AtSuSy).

[0013] A recombinant plasmid B is prepared by connecting the nucleotide sequence containing the above glycosyltransferase mutant to the pCDFDuet-1 vector plasmid containing the sucrose synthase gene (the original sequence of Arabidopsis thaliana sucrose synthase AtSuSy).

[0014] A recombinant plasmid C is prepared by connecting a gene containing a glycosyltransferase UGT76G4 (see SEQ ID NO. 9, disclosed in patent CN119265154A (2024.13.10), a glycosyltransferase UGT76G4 mutant and its application) to a pRSFDuet-1 vector plasmid containing a sucrose synthase gene.

[0015] A recombinant plasmid D is prepared by connecting a gene containing a glycosyltransferase NtUGT-M8 (see SEQ ID NO. 10, disclosed in CN119220515A (2023.06.30), a glycosyltransferase mutant and a method for catalyzing synthesis of rebaudioside M2) to a pRSFDuet-1 vector plasmid containing a sucrose synthase gene.

[0016] A recombinant bacterium and its application, the recombinant plasmid A, the recombinant plasmid A and the recombinant plasmid C, the recombinant plasmid B and the recombinant plasmid D are respectively transformed into Escherichia Coli BL21 (DE3) strain, and are respectively applied to the production of catalyzing synthesis of steviol glycoside D, steviol glycoside M and steviol glycoside M2.

[0017] Due to the adoption of the above technical solutions, the beneficial effects of the present application are:

[0018] 1、The glycosyltransferase mutant constructed in the present application has a significantly improved enzyme activity, especially the enzyme activity of the multi-site combined mutant C41I+A140S+N283P+A342L is most significantly improved, and the relative enzyme activity of the pure enzyme is 2.7 times that of the original glycosyltransferase; and the thermal stability is also significantly improved, and the enzyme activity remains stable after incubation at 40℃ for 3h, and the thermal stability is significantly improved, while the enzyme activity of the original glycosyltransferase in the prior art remains only 37.69% after incubation at 40℃ for 3h.

[0019] 2, The application is prepared by connecting the glycosyltransferase mutant to the pETDuet-1 carrier plasmid containing the sucrose synthase gene to obtain recombinant plasmid A; connecting the glycosyltransferase mutant to the pCDFuet-1 carrier plasmid containing the sucrose synthase gene to obtain recombinant plasmid B; connecting the gene containing the glycosyltransferase UGT76G4 to the carrier plasmid containing the sucrose synthase gene to obtain recombinant plasmid C; connecting the gene containing the glycosyltransferase NtUGT-M8 to the carrier plasmid containing the sucrose synthase gene to obtain recombinant plasmid D; then transforming the recombinant plasmid A and the recombinant plasmid C into E. coli to express for catalyzing the generation of steviolbioside M from steviolbioside A, and transforming the recombinant plasmid B and the recombinant plasmid D into E. coli to express for catalyzing the generation of steviolbioside M2 from steviolbioside A. In this way, steviolbioside M or steviolbioside M2 can be directly synthesized from steviolbioside, the synthesis method has the advantages of mild conditions, simple operation, short time, high catalytic efficiency, high yield and good application prospect. DETAILED DESCRIPTION

[0020] The application will be further described below in combination with examples.

[0021] The primer synthesis and sequencing service in all examples are provided by Huada Gene Technology Service Co., Ltd., the PCR instrument (eppendorf), and the amino acid analyzer (sykam S433D);

[0022] The following formula of the culture medium is adopted:

[0023] The LB solid culture medium is as follows: Tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, agar 20 g / L, pH 7.0;

[0024] The LB liquid culture medium is as follows: Tryptone 10 g / L, yeast extract 5 g / L, NaCl 10 g / L, pH 7.0;

[0025] The HPLC detection conditions are as follows: Agilent EC-C18 chromatographic column (100 mm*4.5 mm), column temperature 55 DEG C, ultraviolet detection wavelength 210 nm. The mobile phase A is acetonitrile containing 0.1% formic acid, and the mobile phase B is water containing 0.1% formic acid. The mobile phase gradient elution program is as follows: 0.000 min (25% A, 75% B), 7.150 min (47% A, 53% B), 10.000 min (100% A, 0% B), 11.800 min (25% A, 75% B), 15 min (25% A, 75% B). The flow rate is 0.7 mL / min, and the injection amount is 10 µL.

[0026] Construction of recombinant strain pET-AtSuSy-PgUGT of steviol glycoside D

[0027] The gene fragment encoding PgUGT was synthesized by Nanjing Kingsriver Biotechnology Co., Ltd., and cloned into pETDuet-1 (Novagen) between Nde I and Xho I restriction sites, and the generated plasmid was named pET-PgUGT. The gene fragment of sucrose synthase AtSuSy was then synthesized by Nanjing Kingsriver Biotechnology Co., Ltd., and then cloned into pET-PgUGT between Nco I and EcoR I restriction sites to generate the plasmid pET-AtSuSy-PgUGT.

[0028] The recombinant plasmid pET-AtSuSy-PgUGT was added to E. coli BL21 (DE3) competent cells (TransGen Biotech), and the recombinant plasmid was mixed with the competent cells by flicking. After ice bath for 30 min, it was placed in a 42°C water bath for 90 s, and then ice bathed for 2 min. Then 400 µL of LB liquid medium without resistance was added, mixed by blowing and sucking, and placed in a 37°C shaker for activation for 30 min. The bacterial solution was obtained, and 70 µL of the bacterial solution was spread on an LB plate containing 50 mg / ml ampicillin resistance. After incubation in a 37°C incubator for 12 h, the recombinant strain pET-AtSuSy-PgUGT of steviol glycoside D was obtained, and this strain was used as a (original sequence) control in the following experiments and tests.

[0029] Example 2: Obtaining of glycosyltransferase unit point mutants

[0030] Using the recombinant plasmid pET-AtSuSy-PgUGT of Example 1 as a template, PCR amplification was performed using the following unit point mutant primers and PrimeSTAR DNA polymerase (TaKaRa), respectively. After agarose gel electrophoresis verification, 1 µL of Dpn I endonuclease was added to the PCR reaction product. The reaction system was then placed in a 37°C constant temperature reaction for 2 h to digest the template. The digested PCR reaction product was then transformed into E. coli BL21 (DE3) according to the method in Example 1, and the corresponding recombinant strain was obtained. Single colonies on the plate were picked and inoculated into LB liquid medium (10 g / L peptone, yeast powder 5 g / L, 10 g / L NaCl) containing 50 mg / L ampicillin, and incubated at 37°C, 200 rpm for 12 h. The plasmid was extracted, and the obtained plasmid was named pET-AtSuSy-N, where N is the mutation site. For example, the plasmid obtained by H18F site-directed mutagenesis is pET-AtSuSy-H18F.

[0031] PCR target plasmid amplification reaction system: 10 μmol / L forward primer and reverse primer 2 μL each, template plasmid 1 μL, PrimeSTAR DNA polymerase 25 μL, add sterile water ddH2O to 50 μL. PCR target plasmid amplification reaction conditions: 95°C pre-denaturation for 30 s; 30 cycles (95°C denaturation for 15 s; 65°C annealing for 15 s; 72°C extension for 7 min); 72°C thorough extension for 5 min; finally 16°C incubation. The PCR amplification product was detected by agarose gel nucleic acid electrophoresis.

[0032] The following are the mutation primers of PgUGT:

[0033] The primers for C41I site-directed mutation are:

[0034] Forward primer: 5'-TTCCTGATTTCTACTCCGATTAACCTGTCCTCT-3'

[0035] Reverse primer: 5'-GAGTAGAAATCAGGAAGACATTGCAGTTGCGCTT-3';

[0036] The primers for A140S site-directed mutation are:

[0037] Forward primer: 5'-ACCACTAGCGCGGCTTCCTCGTCAATCGGCCTG-3'

[0038] Reverse primer: 5'-AGCCGCGCTAGTGGTAAGGAAGTACACAGCCGG-3';

[0039] The primers for N283P site-directed mutation are:

[0040] Forward primer: 5'-ACCGTTCCGTTTATCTGGGCCGTGCGTCTGATC-3'

[0041] Reverse primer: 5'-CCAGATAAACGGAACGGTGCTAATCTCCAAACCAAT-3';

[0042] The primers for A342L site-directed mutation are:

[0043] Forward primer: 5'-AGCATCCTTGAGTCCATGAAGTTTGGTGTTCCGGTT-3'

[0044] Reverse primer: 5'-GGACTCAAGGATGCTGCTCCAACCACAATGGCTAAC-3';

[0045] The above method can obtain the mutant of C41 I, A140S, N283P, A342L single site mutation; the above mutant is transformed into E. coli BL21 (DE3) according to the method of Example 1 to obtain the recombinant strain of steviol glycoside D.

[0046] Example 3 Mutant of Multi-site Combined Mutation of Sugar Transferase Obtained

[0047] a. Mutate the double site mutation with the single site mutation as the template, and the method is as follows:

[0048] The recombinant plasmid pET-AtSuSy-N283P obtained in Example 2 is used as the template, and the primer of C41 I mutation site is used for PCR amplification, and then the plasmid pET-AtSuSy-C41 I+N283P of double mutation site is prepared according to the method in Example 2.

[0049] b. The double mutation site plasmid obtained in step a is used as the template to perform triple mutation site mutation. The method is as follows:

[0050] The recombinant plasmid pET-AtSuSy-C41 I+N283P is used as the template, and the primer of A140S site mutation is used for PCR amplification, and then the plasmid pET-AtSuSy-C41 I+A140S+N283P of triple mutation site is prepared according to the method in Example 2.

[0051] c. The triple mutation site plasmid obtained in step b is used as the template to perform quadruple mutation site mutation. The method is as follows:

[0052] The recombinant plasmid pET-AtSuSy-C41 I+A140S+N283P is used as the template, and the primer of A342L site mutation is used for PCR amplification, and then the plasmid pET-AtSuSy-C41 I+A140S+N283P+A342L of quadruple mutation site is prepared according to the method in Example 2.

[0053] Through the above method, the following mutants are obtained: C41 I+N283P double site mutant, C41 I+A140S+N283P triple site mutant; C41 I+A140S+N283P+A342L quadruple site mutant. The above mutant is transformed into E. coli BL21 (DE3) according to the method of Example 1 to obtain the recombinant strain of steviol glycoside D.

[0054] Example 4 Preparation of Recombinant Plasmid pCDF-AtSuSy-C41 I+A140S+N283P+A342L

[0055] PCR target plasmid amplification reaction system: 10 μmol / L forward primer and reverse primer 2 μL each, template plasmid 1 μL, Prime STAR DNA polymerase 25 μL, add sterile water ddH2O to 50 μL; PCR target plasmid amplification reaction conditions: 95℃ pre-denaturation for 30s; 30 cycles (95℃ denaturation for 15s; 65℃ annealing for 15s; 72℃ extension for 7min); 72℃ thorough extension for 5min; finally 16℃ incubation, PCR amplification product was detected by agarose gel nucleic acid electrophoresis, and the PCR product was obtained, which was the linearized vector fragment of pCDFDuet-1;

[0056] PCR target plasmid amplification reaction system: 10 μmol / L forward primer and reverse primer 2 μL each, template plasmid 1 μL, Prime STAR DNA polymerase 25 μL, add sterile water ddH2O to 50 μL; PCR target plasmid amplification reaction conditions: 95℃ pre-denaturation for 30s; 30 cycles (95℃ denaturation for 15s; 65℃ annealing for 15s; 72℃ extension for 7min); 72℃ thorough extension for 5min; finally 16℃ incubation, PCR amplification product was detected by agarose gel nucleic acid electrophoresis, and the PCR product was obtained, which was the linearized vector fragment of pCDFDuet-1;

[0057] The AtSuSy-C41I+A140S+N283P+A342L gene fragment was cloned into the pCDFDuet-1 vector under the following conditions: the AtSuSy-C41I+A140S+N283P+A342L gene fragment and the pCDFDuet-1 linearized vector were purified by gel recovery using the FastPureGel DNA Extraction Mini Kit kit, and then recombined, the recombination system: linearized vector 2 μL, AtSuSy-C41I+A140S+N283P+A342L gene fragment 2 μL, 5×CEII buffer 4 μL, ExnaseII 2 μL, recombination reaction at 37℃ for 30min, and the plasmid pCDF-PgUGT-C41I+A140S+N283P+A342L was obtained.

[0058] The above primer sequences are as follows:

[0059] pCDF-F: ACGCTCCGCGTTCGCGCCCATGGTATATCTCCTTATTAAAGTTAAA

[0060] pCDF-R: AAAAAGGACGAGCAATAATGACTCGAGTCTGGTAAAGAAACCGCTGCT;

[0061] PgUGT-F: CATGGGCGCGAACGCGGAGCGTATGATC

[0062] PgUGT-R: TTATTGCTCGTCCTTTTTCTTTTTGCAGATTTG.

[0063] Example 5 Preparation of recombinant plasmid pRSF-AtSuSy-UGT76G4

[0064] The synthesis of the sucrose synthase AtSuSy gene fragment and the glycosyltransferase UGT76G4 gene fragment was completed by Nanjing Kingsrui Biotechnology Co., Ltd., wherein the amino acid sequence of the glycosyltransferase UGT76G4 is shown in SEQ ID NO: 9 and is disclosed in the patent CN115094074A.

[0065] PCR amplification was performed using primers UGT76G4-F and UGT76G4-R and Prime STAR DNA polymerase (TaKaRa) as a template for pRSFDuet-1. The PCR target plasmid amplification reaction system was as follows: 10 μmol / L of forward and reverse primers, 2 μL each, 1 μL of template plasmid, 25 μL of Prime STAR DNA polymerase, and ddH2O to make up to 50 μL. The PCR target plasmid amplification reaction conditions were as follows: 95°C pre-denaturation for 30 s; 30 cycles of 95°C denaturation for 15 s, 65°C annealing for 15 s, and 72°C extension for 7 min; 72°C complete extension for 5 min; and finally 16°C incubation. The PCR amplification product was detected by agarose gel nucleic acid electrophoresis, and the PCR product was obtained, which was the pRSFDuet-1 linearized vector fragment.

[0066] The UGT76G4 gene fragment is cloned into the pRSFDuet-1 vector under the following conditions: The UGT76G4 gene fragment is gel-recovered and purified using the FastPure Gel DNA Extraction Mini Kit kit after recombination with the pRSFDuet-1 linearized vector, and the recombination system is: linearized vector 2 μL, UGT76G4 gene fragment 2 μL, 5×CEII buffer 4 μL, ExnaseII 2 μL, recombination reaction at 37°C for 30 min, to obtain the plasmid pRSF-UGT76G4.

[0067] The AtSuSy gene fragment is constructed into the plasmid pRSF-UGT76G4 between the NdeI and XhoI enzyme digestion sites under the following conditions:

[0068] Using pRSF-UGT76G4 as a template, PCR amplification is performed using primers At76G4-F, At76G4-R and PrimeSTAR DNA polymerase (TaKaRa), respectively, and the PCR target plasmid amplification reaction system is: 10 μmol / L forward primer and reverse primer 2 μL each, template plasmid 1 μL, PrimeSTAR DNA polymerase 25 μL, supplemented with sterile water ddH2O to 50 μL; the PCR target plasmid amplification reaction conditions are: 95°C pre-denaturation for 30 s; 30 cycles (95°C denaturation for 15 s; 65°C annealing for 15 s; 72°C extension for 7 min); 72°C complete extension for 5 min; finally 16°C incubation, and the PCR amplification product is detected by agarose gel nucleic acid electrophoresis, to obtain the PCR product, which is the pRSF-UGT76G4 linearized vector fragment.

[0069] The AtSuSy gene fragment is gel-recovered and purified using the FastPure Gel DNA Extraction Mini Kit kit after recombination with the pRSF-UGT76G4 linearized vector, and the recombination system is: linearized vector 2 μL, AtSuSy gene fragment 2 μL, 5×CEII buffer 4 μL, ExnaseII 2 μL, recombination reaction at 37°C for 30 min. The plasmid pRSF-AtSuSy-UGT76G4 is obtained.

[0070] The above primer sequences are as follows:

[0071] UGT76G4-F: GATGATGATGATGATGGCTGCTGCCCATATGTATATCTCCTTCTTATA

[0072] UGT76G4-R: TCCTATATTTCCAGCCTCTAATGACTCGAGTCTGGTAAAGAAACCG;

[0073] At76G4-F: TCCGCTGGCGCAAGACGATTAAGAATTCGAGCTCGGCGCGCCTGCAG

[0074] At76G4-R: GCTCCGCGTTCGCGCCCATGGTATATCTCCTTATTAAAGTTAA.

[0075] Example 6 Preparation of recombinant plasmid pRSF-AtSuSy-NtUGT-M8

[0076] The synthesis of the glycosyltransferase NtUGT-M8 gene fragment was completed by Nanjing Kingsrui Biotechnology Co., Ltd., wherein the amino acid sequence of the glycosyltransferase NtUGT-M8 is shown in SEQ ID NO: 10 and disclosed in the patent CN119220515A.

[0077] PCR amplification was performed using pRSF-AtSuSy-UGT76G4 as the template and primers pRSF-At-F and pRSF-At-R and PrimeSTAR DNA polymerase (TaKaRa), respectively. The PCR target plasmid amplification reaction system was as follows: 10 μmol / L of forward and reverse primers, 2 μL each, 1 μL of template plasmid, 25 μL of Prime STAR DNA polymerase, and ddH2O to make up to 50 μL. The PCR target plasmid amplification reaction conditions were as follows: 95°C pre-denaturation for 30 s; 30 cycles of 95°C denaturation for 15 s, 65°C annealing for 15 s, and 72°C extension for 7 min; 72°C complete extension for 5 min; and finally 16°C incubation. The PCR amplification product was detected by agarose gel nucleic acid electrophoresis, and the PCR product was obtained, which was the pRSF-AtSuSy linearized vector fragment.

[0078] The NtUGT-M8 gene fragment was cloned into the pRSF-AtSuSy vector under the following conditions: The NtUGT-M8 gene fragment and the pRSF-AtSuSy linearized vector were purified by gel recovery using the FastPure Gel DNA Extraction Mini Kit kit, and then recombined. The recombination system was as follows: 2 μL of linearized vector; 2 μL of NtUGT-M8 gene fragment; 4 μL of 5×CEII buffer; and 2 μL of ExnaseII. The recombination reaction was performed at 37°C for 30 min, and the plasmid pRSF-AtSuSy-NtUGT-M8 was obtained.

[0079] The sequences of the above primers are as follows:

[0080] pRSF-At-F: TGATGATGATGGCTGCTGCCCATATGTATATCTCCTTCTTATACT

[0081] pRSF-At-R: TCCAAGAACGGCAGCTTTTAATGACTCGAGTCTGGTAAAGAAACCG.

[0082] Example 7 Preparation of recombinant strain of steviol glycoside M

[0083] The recombinant plasmid pET-AtSuSy-C41I+A140S+N283P+A342L and pRSF-AtSuSy-UGT76G4 were added to E. coli BL21(DE3) competent cells (TransGen Biotech) together, the recombinant plasmid and the competent cells were mixed by flicking, ice-bath for 30 min, then heat shock in a 42°C water bath for 90 s, ice-bath for 2 min, then 400 μL of LB liquid medium without resistance was added, mixed by blowing and sucking, and placed in a 37°C shaker for activation for 30 min to obtain a bacterial solution, 70 μL of the bacterial solution was spread on an LB plate containing the corresponding resistance (50 mg / ml kanamycin resistance, 50 mg / ml ampicillin), and cultured in a 37°C incubator for 12 h to obtain a recombinant strain of steviol glycoside M.

[0084] Example 8 Preparation of recombinant strain of steviol glycoside M2

[0085] The recombinant plasmid pCDF-AtSuSy-C41I+A140S+N283P+A342L prepared in Example 4 and pRSF-AtSuSy-NtUGT-M8 were added to E. coli BL21(DE3) competent cells (TransGen Biotech) together, the recombinant plasmid and the competent cells were mixed by flicking, ice-bath for 30 min, then heat shock in a 42°C water bath for 90 s, ice-bath for 2 min, then 400 μL of LB liquid medium without resistance was added, mixed by blowing and sucking, and placed in a 37°C shaker for activation for 30 min to obtain a bacterial solution, 70 μL of the bacterial solution was spread on an LB plate containing the corresponding resistance (50 mg / ml ampicillin, 50 mg / ml streptomycin), and cultured in a 37°C incubator for 12 h to obtain a recombinant strain of steviol glycoside M2.

[0086] Example 9 Fermentation culture of recombinant strain

[0087] The recombinant strains obtained in Example 1, Example 2 and Example 3 were picked into LB liquid medium and cultured at 37°C and 200 rpm. When the optical density (OD600) reached 0.6, an inducer IPTG was added to a final concentration of 0.1 mM, and the culture was induced at 16°C for 24 h. The fermentation broth was collected and centrifuged (4°C, 8000 rpm, 5 min) in a refrigerated centrifuge, and the supernatant was discarded to obtain bacterial slurry. The bacterial slurry was washed twice with potassium phosphate buffer (pH 7.2), and then potassium phosphate buffer was added (the mass ratio of bacterial slurry to potassium phosphate buffer was 1:5). The mixture was placed in an ice-water mixture and subjected to ultrasonic disruption with an ultrasonic disruptor, with the parameters set as Ф6, 300 W, and 15 min. The bacterial solution was centrifuged again in a refrigerated centrifuge, with the parameters set as 4°C, 8000 rpm, and 20 min. The centrifugal supernatant, i.e., the crude enzyme solution, was stored in a refrigerator at 4°C for later use.

[0088] Example 10 Comparison of enzyme activities

[0089] The crude enzyme solutions of the strains obtained in Example 1 and Example 2 were subjected to enzyme activity determination, and the determination method was as follows:

[0090] 0.02 mg / mL crude enzyme was added to 1 mL of a reaction solution containing 1.2 mM RebA, 2 mM UDPG (uridine diphosphate glucose), and 100 mM potassium phosphate buffer (pH 7.2), and the reaction was carried out at 37°C for 30 min. The reaction was terminated by heating at 95°C for 5 min. Filtration was performed through a 0.24 µm microporous filter, and the concentration of steviol glycoside RebD was determined by HPLC. The glycosyltransferase activity was in units of 1 µmol RebD produced per minute of enzyme. The enzyme activity of the wild-type PgUGT of Example 1 was taken as 100% as a control, and the relative enzyme activity of the single-point mutant of Example 2 was determined. The determination results are shown in Table 1:

[0091] Table 1 Relative enzyme activities (%) of the crude enzyme solutions of the control strain of Example 1 and the single-point mutant strains of Example 2

[0092]

[0093] As can be seen from the test results in Table 1, the enzyme activities of the C41I, A140S, N283P, and A342L single-point mutants were significantly higher than that of the wild type, and the relative enzyme activity of A140S was the highest, being 302.25.

[0094] Example 11 Comparison of enzyme activities of original sequences and multi-site mutants

[0095] The crude enzyme solutions of the strains obtained in Example 1 and Example 3 were subjected to enzyme activity determination, and the determination method was as described in Example 10. The obtained results are shown in Table 2.

[0096] Table 2 Relative enzyme activity (%) of crude enzyme solution obtained from Example 1 control strain and Example 2 multi-site mutant strains

[0097]

[0098] The enzyme activity results show that the enzyme activity of the multi-point mutants is better than that of the original sequence. Among them, the relative enzyme activity of the two-point mutant C41I+N283P is 932.88, and the enzyme activity of the four-point mutant C41I+A140S+N283P+A342L is the highest, reaching 976.41.

[0099] Example 12 Thermal stability test

[0100] The thermal stability of the unit point mutants and multi-site mutants (C41I, A140S, N283P, A342L, C41I+A140S+N283P+A342L) with significantly improved relative enzyme activity in Example 10 and Example 11 was determined, and the steps were as follows:

[0101] a. Preparation of pure enzyme: the crude enzyme solution obtained from the relevant mutant recombinant strain in Example 8 was filtered with a 0.45 μm filter membrane, then separated and purified by a Ni-NTA affinity chromatography column to obtain a recombinant protein with a 6×His tag, then the protein was desalted and concentrated using a Centricon YM-10 kDa ultrafiltration tube, and eluted twice with 100 mM phosphate buffer (pH 7.2), and stored at -80℃ with the addition of glycerol at a final concentration of 20%.

[0102] b. Determination of pure enzyme activity: 0.001 mg / mL pure enzyme was added to 1 mL of reaction solution containing 1.2 mM RebA, 2 mM UDPG and 100 mM potassium phosphate buffer (pH 7.2), and incubated at 37℃ for 30 min, and then heated at 95℃ for 5 min to terminate the reaction. Filtered through a 0.24 μm microporous filter, and the concentration of steviol glycoside RebD was detected by HPLC. The UGT activity was expressed in units of enzyme producing 1 μmol of RebD per minute. The relative enzyme activity of other mutant enzymes was calculated based on the enzyme activity of the recombinant strain of Example 1 as 100%.

[0103] c. Thermal stability determination: the pure enzyme with a concentration of 1 mg / mL was placed in a 40℃ water bath. After 3h of incubation, the sample was measured for enzyme activity under the above experimental conditions. All operations were performed in triplicate. The relative enzyme activity of other mutant enzymes was calculated based on the enzyme activity of the recombinant strain of Example 1 as 100%. The results are shown in Table 3:

[0104] Table 3 Thermal stability of pure enzyme obtained from four-site mutant strains in Example 1, Example 2 and Example 3

[0105]

[0106] As can be seen from Table 3, the four-site mutant has higher enzyme activity and stability than the original sequence and the single-site mutant, and the relative enzyme activity does not change significantly after 3 hours of treatment.

[0107] Example 13 Catalytic synthesis of steviol glycoside D (RebD)

[0108] In the catalytic reaction system (5 mL), 40 g / L steviol glycoside A (RebA) was added, 240 g / L sucrose, 10 mg / mL crude enzyme solution (crude enzyme solution of each strain obtained in Example 1 and Example 3) and 100 mM potassium phosphate buffer solution (pH 7.2) were added, and incubated at 40°C; after incubation for 3 hours, it was inactivated at 95°C for 5 min, then diluted with water to 1 g / L, and detected by HPLC, and the yield of steviol glycoside D was measured as shown in Table 4:

[0109] Table 4 Yield of product catalytic synthesis of RebD by recombinant strains of Example 1 and Example 3

[0110]

[0111] The results show that the enzyme obtained by the multi-site mutant has strong catalytic effect on RebA, and the four-site mutant C41I+A140S+N283P+A342L has the highest yield of RebD produced by catalyzing RebA, which is 37.54 g / L, and the conversion rate reaches 93.9%.

[0112] Example 14 Production of steviol glycoside M

[0113] The steviol glycoside M recombinant strain obtained in Example 7 was coated on a LB solid plate containing corresponding resistance (10 g / L peptone, 5 g / L yeast extract, 10 g / L NaCl, 15 g / L agar), and incubated in a 37°C incubator for 12 h. The next day, single colonies were selected from the plate to LB medium and cultured at 37°C, 200 rpm, when the absorbance (OD600) reached 0.6-0.8. IPTG was added to the medium with a final concentration of 0.1 mM, and the glycosyltransferase was incubated at 16°C for 24 h.

[0114] The fermentation broth was collected and centrifuged at 4°C, 8000 rpm, 5 min, and the supernatant was discarded to obtain the bacterial slurry, which was washed twice with potassium phosphate buffer. Then, an appropriate amount of potassium phosphate buffer was added, and the bacterial body was broken by ultrasonic crusher in ice water mixture, with the parameters set as Ф6, 300 W, 15 min. Then, the bacterial body was centrifuged at 4°C, 8000 rpm, 20 min, and the supernatant was collected as the crude enzyme solution, which was stored in a 4°C refrigerator for standby.

[0115] In the catalytic reaction system (10 mL), 80 g / L RebA, 480 g / L sucrose, 10 mg / mL crude enzyme solution and 100 mM potassium phosphate buffer solution (pH 7.2) were added, and the reaction was carried out at 40℃ for 12 h, and then high-temperature inactivation was carried out, and the supernatant obtained by centrifugation was RebM.

[0116] Finally, at the reaction time of 12 h, the concentration of RebM was 81.34 g / L, and the yield reached 97.9%.

[0117] Result analysis:

[0118] The recombinant strain containing pET-AtSuSy-C41I+A140S+N283P+A342L and pRSF-AtSuSy-UGT76G4 double plasmids prepared in Example 7 can obtain a high yield of 91.34 g / L in only 12 hours of reaction time, and the conversion rate is as high as 97.9%. The prior art CN120098882A (2025.03.21) patent constructs an Escherichia coli recombinant strain for high-efficiency whole-cell catalytic synthesis of RebM. The strain introduces key genes such as sugar transferase mutants (UGT76G1 and UGT91C1), sucrose synthase (atSUS1), polyphosphate glucose kinase (cgPPGK), etc. The recombinant strain realizes a RebM yield of only 77.8 g / L in a 3L fermenter after 60 hours of whole-cell catalytic reaction, and the conversion rate is 97.3%. Therefore, compared with the prior art, the present application not only greatly shortens the reaction time, but also significantly improves the yield.

[0119] Example 15 Production of steviol glycoside M2

[0120] The steviol glycoside M2 recombinant strain obtained in Example 8 was spread on a LB solid plate containing corresponding resistance (10 g / L peptone, 5 g / L yeast powder, 10 g / L NaCl, 15 g / L agar) and placed in a 37℃ incubator for 12 h. The next day, single colonies were selected from the plate into LB medium and cultured at 37℃, 200 rpm. When the absorbance (OD600) reached 0.6-0.8, IPTG was added to the medium at a final concentration of 0.1 mM, and the glycosyltransferase was incubated at 16℃ for 24 h.

[0121] The fermentation broth was collected and frozen and centrifuged (4℃, 8000 rpm, 5 min), and the supernatant was discarded to obtain the bacterial slurry, which was washed twice with potassium phosphate buffer. Then, an appropriate amount of potassium phosphate buffer was added, and the bacterial slurry was placed in an ice-water mixture and broken by ultrasonic crusher, with the parameters set as Ф6, 300 W, 15 min. Then, the bacterial slurry was centrifuged by a frozen centrifuge, with the parameters set as 4℃, 8000 rpm, 20 min, and the supernatant was the crude enzyme solution, which was stored in a 4℃ refrigerator for standby.

[0122] In the catalytic reaction system (10 mL), 80 g / L RebA, 480 g / L sucrose, 10 mg / mL crude enzyme solution and 100 mM potassium phosphate buffer solution (pH 7.2) were added, and the reaction was carried out at 40℃ for 24 h, and then inactivated at high temperature, and the supernatant obtained by centrifugation was RebM2.

[0123] Finally, at 24 h of reaction, the concentration of RebM2 was 94.61 g / L, and the yield reached 88.57%.

[0124] Results analysis:

[0125] In the prior art, CN119220516A (2023.06.30) discloses a three-enzyme cascade system composed of UGTSL2 mutant (containing 19 site mutations) and NtUGT_M, AtSuSy, which catalyzes the reaction for 48 hours, with a yield of 78.8 g / L and a yield of 80%. However, it has problems such as complex enzyme system, long reaction period, need for external addition of UDP, and more by-products (such as RM21G). Therefore, the present application not only significantly shortens the reaction time, improves the catalytic efficiency, but also effectively controls the generation of by-products, and improves the yield.

[0126] It should be understood that these examples are only used to illustrate the present application and not to limit the scope of the present application. Furthermore, it should be understood that after reading the content taught by the present application, those skilled in the art can make various modifications or changes to the present application, and these equivalent forms also fall within the scope defined by the appended claims of the present application.

Claims

1. A glycosyltransferase mutant, characterized in that, The four-site C41I+A140S+N283P+A342L simultaneous mutation is obtained by mutating the amino acid sequence SEQ ID NO. 1, wherein C41I is cysteine mutated to isoleucine, A140S is alanine mutated to serine, N283P is asparagine mutated to proline, and A342L is alanine mutated to leucine.

2. A recombinant plasmid A, characterized in that, The recombinant plasmid A is obtained by ligating the nucleotide sequence containing the glycosyltransferase mutant prepared in claim 1 to the pETDuet-1 vector plasmid containing the sucrose synthase gene.

3. A recombinant plasmid B, characterized in that, The recombinant plasmid A is obtained by ligating the nucleotide sequence containing the glycosyltransferase mutant prepared in claim 1 to the pETDuet-1 vector plasmid containing the sucrose synthase gene.

4. A recombinant bacterium, characterized by: The recombinant plasmid A obtained in claim 2 is transformed into the E. coli BL21 (DE3) strain to obtain the recombinant plasmid A.

5. A recombinant bacterium, characterized in that, The recombinant plasmid C obtained by ligating the gene containing the glycosyltransferase UGT76G4 to the pRSFDuet-1 vector plasmid containing the sucrose synthase gene is co-transformed into the E. coli BL21 (DE3) strain together with the recombinant plasmid A obtained in claim 2.

Images