GRNA (guide Ribonucleic Acid) of targeted kallikrein, recombinant vector, RNA delivery system, gene editing system, recombinant cell and application of gRNA

By targeting the KLKB1 gene with a gRNA and recombinant vector system and using CRISPR/Cas9 for gene editing, the problems of repeated medication and severe side effects in HAE treatment were solved, and the therapeutic effects of reducing vascular permeability and cardiovascular and cerebrovascular diseases were achieved.

CN120624447APending Publication Date: 2025-09-12WEST CHINA HOSPITAL SICHUAN UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510776200.4
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-06-11
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

Existing HAE treatments require repeated medication, and long-term medication has significant side effects. Gene editing technology may cause DNA double-strand breaks and gene fragment insertions and deletions when knocking out the KLKB1 gene, affecting the treatment effect.

Method used

A gRNA targeting the KLKB1 gene was designed, combined with a recombinant vector and RNA delivery system, and gene editing was performed using the CRISPR/Cas9 system. The gRNA was introduced into cells through delivery systems such as lipid nanoparticles to silence KLKB1 gene expression and reduce the level of prekallikrein. Recombinant adeno-associated virus vectors were used for gene editing.

Benefits of technology

It effectively reduces vascular permeability, treats hereditary angioedema, prevents and treats cardiovascular and cerebrovascular diseases, has good biosafety and therapeutic effects, and does not require frequent medication.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120624447A_ABST
    Figure CN120624447A_ABST
Patent Text Reader

Abstract

The invention discloses gRNA of targeted kallikrein, a recombinant vector, an RNA delivery system, a gene editing system, a recombinant cell and application of the gRNA, and relates to the technical field of gene editing. The gRNA targeting the kallikrein is designed and screened out, the gRNA has high gene editing efficiency, through gene editing, the level of the kallikrein in cells, tissues, organs and blood can be effectively reduced, and the mRNA level of the coding gene of the kallikrein is reduced. The invention also provides a recombinant vector and a virus particle, and animal experiments prove that the virus particle can reduce vascular permeability and treat hereditary angioedema. The compound has a good effect of preventing and / or treating cardiovascular and cerebrovascular diseases, and has good biological safety, so that the compound has a good application prospect in conveniently treating the cardiovascular and cerebrovascular diseases.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of gene editing technology, and specifically to a gRNA targeting prekallikrein, a recombinant vector, an RNA delivery system, a gene editing system, a recombinant cell, and applications thereof. Technical Background

[0002] Hereditary angioedema (HAE) is a rare autosomal dominant genetic disease. The global prevalence of HAE is estimated to be approximately 1.1 to 1.6 per 100,000 individuals, primarily based on Western cohorts. HAE is primarily caused by mutations in the SERPING1 gene located on chromosome 11q12-q13, which results in decreased levels and dysfunction of the protein C1 inhibitor (C1-INH), which is synthesized in the liver. Typical clinical symptoms of HAE are recurrent, self-limited skin and mucosal edema. Skin edema primarily occurs on the face (including the lips, cheeks, and periorbital areas), limbs, and genitalia. When edema involves the gastrointestinal mucosa, severe abdominal pain, nausea, vomiting, diarrhea, and other symptoms resembling acute abdomens can occur. The most severe symptom is laryngeal edema, which occurs at least once in over 50% of patients. Once it occurs, the mortality rate is 11%-40% if timely treatment is not provided. Because the symptoms occur irregularly and the causes are unknown, they cause anxiety and depression, affecting normal life and work.

[0003] Based on the mutated gene and C1-INH levels, HAE can be divided into C1-INH-deficient HAE (C1-INH-HAE) and non-C1-INH-deficient HAE (nC1-INH-HAE). The pathogenesis of C1-INH-HAE is due to reduced C1-INH levels or functional defects caused by mutations in the SERPING1 gene. Clinically, it is divided into two types. Type I, which accounts for approximately 85% of patients, is characterized by both reduced C1-INH levels and function. In most patients, C1-INH levels are only 30% or less of the normal value. Type II, which accounts for approximately 15%, is characterized by normal or elevated C1-INH levels but reduced function. In these patients, C1-INH is functionally deficient, preventing it from forming a complex with the protease, resulting in a prolonged half-life and, consequently, elevated C1-INH levels. The SERPING1 gene consists of eight exons and nine introns.

[0004] In 1976, Gelfand JA reported that an androgen could alleviate symptoms in HAE patients, reduce edema episodes, and tend to restore C1-INH levels. Before the discovery of attenuated androgens as effective treatments for HAE, up to one-third of patients died from laryngeal edema and asphyxiation. However, long-term oral androgen use can cause significant side effects, including obesity, hyperlipidemia, liver dysfunction, and, in women, hirsutism, menstrual changes, and voice changes. As research into the molecular pathogenic mechanisms of HAE deepens, it has been discovered that HAE involves three primary pathways. The first is the complement pathway: decreased C1-INH leads to overactivation of C1 and excessive consumption and decline of C2 and C4. The second is the bradykinin production pathway: high-molecular-weight kininogen exists in peripheral blood as a complex with prekallikrein (PK), which has intrinsic enzymatic activity and is regulated by C1-INH. Decreased C1-INH activates prekallikrein to kallikrein (KK), which cleaves high-molecular-weight kininogen to produce excessive amounts of the inflammatory mediator bradykinin. Bradykinin binds to endothelial B2 receptors, increasing endothelial cell permeability through multiple mechanisms, including enhanced phosphorylation and inactivation of vascular endothelial cadherin and upregulation of vascular permeability factor expression, leading to skin and mucosal edema. The third is the coagulation and fibrinolysis pathway: KK activates FXII to FXIIa. Simultaneously, FXIIa positively feedbacks PK to KK, leading to excessive bradykinin production.

[0005] The elucidation of the molecular pathogenic mechanisms of HAE has prompted researchers to focus drug development efforts on three key targets: C1-INH, PK, and bradykinin. Currently, FDA-approved drugs include plasma-derived C1-INH and recombinant C1-INH, both administered intravenously every 3-4 days. In addition, there is a subcutaneous formulation of C1-INH, administered every two weeks. Kallikrein inhibitors include subcutaneous lanariumab and ecallantide, administered every two weeks; the oral agent berotralstat, taken once daily; and drugs that inhibit bradykinin binding to the B2 receptor during acute HAE attacks, such as icatiban acetate. Compared to androgens, these targeted drugs offer superior efficacy and fewer side effects. Other drugs currently undergoing clinical trials include garadacimab, a monoclonal antibody against coagulation factor FXIIa; and IONIS-PKKRx, an antisense oligonucleotide that blocks prekallikrein mRNA, a representative small molecule nucleic acid therapy. Because the above-mentioned drugs were all developed by foreign research institutions and pharmaceutical companies, it was not until December 4, 2020 that Japan's Takeda's innovative drug Dazeyou (lanariumab injection) was officially approved by the National Medical Products Administration for marketing in China for the prevention of attacks of hereditary angioedema in patients aged 12 years and above. On April 8, 2021, Takeda's other innovative drug, Fezeyou (icatibant acetate injection), was officially approved by the National Medical Products Administration for the treatment of acute attacks of hereditary angioedema in adults, adolescents and children aged ≥2 years. It fills the gap in the long-term lack of targeted treatment for hereditary angioedema in China. The above-mentioned targeted drugs face the same difficulty, that is, they need to be used repeatedly, with intervals as short as 3-4 days and as long as 2 weeks.

[0006] With the innovation and development of biomedical technology, gene therapy is currently considered the most promising strategy for treating genetic diseases. Based on the molecular mechanisms of genetic diseases, existing gene therapy strategies are mainly divided into three categories: gene replacement, gene suppression, and gene editing.

[0007] The therapeutic target of HAE is prekallikrein (PK), and the PK protein is encoded by the KLKB1 gene. A research team used LNP to introduce the CRISPR / Cas9 system into HAE model animals to knock out the KLKB1 gene to reduce PK expression in the body to treat HAE, but this method induces double-strand breaks in DNA, which may cause gene fragment insertions and deletions (indels) and bring adverse effects. Some scholars also used AAV to introduce the coding sequence of anti-PK antibodies into the model animals to achieve therapeutic effects by directly antagonizing PK in the body. Although the loss-of-function mutation of KLKB1 resulted in a significant prolongation of the activated partial thromboplastin time (aPTT), the patient did not experience any bleeding symptoms. Other studies have confirmed that knocking down PK can improve the prognosis of a mouse model of severe pneumonia and sepsis.

[0008] Studies have found that PK affects cholesterol metabolism by binding to the low-density lipoprotein receptor (LDLR) and inducing lysosomal degradation. Inhibiting PK can significantly reduce low-density lipoprotein (LDL-C) levels by stabilizing LDLR and slowing the progression of atherosclerosis. Other studies have found that inhibiting PK function can improve the efficiency of HDL in clearing cholesterol. This improvement may be manifested as HDL being more efficient in transporting cholesterol through ABCA1, ABCG1 or SR-BI, thereby enhancing its anti-atherosclerotic effect. Through genomic data analysis, KLKB1 is considered to be a potential drug target related to stroke. The protein encoded by KLKB1 is related to the coagulation mechanism and is involved in thrombosis. PK inhibitors can be used to reduce thrombosis, thereby reducing the risk of stroke and myocardial infarction.

[0009] In view of this, the present invention is proposed. Summary of the Invention

[0010] The object of the present invention is to provide a gRNA targeting prekallikrein, a recombinant vector, an RNA delivery system, a gene editing system, a recombinant cell and their applications to solve the above-mentioned technical problems.

[0011] The present invention is achieved in that:

[0012] In a first aspect, the present invention provides a gRNA targeting prekallikrein, wherein the gRNA targets any one of exons 2 to 15 of the KLKB1 gene or its splice acceptor or splice donor.

[0013] In a second aspect, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the aforementioned gRNA targeting prekallikrein.

[0014] In a third aspect, the present invention provides an RNA delivery system, which is a lipid nanoparticle (LNP), a cationic lipid complex (LPX), a lipid polyplex (LPP), a polymer nanoparticle (PNP), an inorganic nanoparticle (INP) or a cationic nanoemulsion (CNE), and the RNA delivery system also includes the above-mentioned nucleic acid molecule of the gRNA targeting prekallikrein.

[0015] In a fourth aspect, the present invention provides a gene editing system, which includes a nucleic acid molecule encoding the above-mentioned gRNA targeting prekallikrein or the above-mentioned recombinant vector, a Cas protein and a gene editor.

[0016] In a fifth aspect, the present invention provides a recombinant cell comprising the above-mentioned recombinant vector or the above-mentioned gene editing system.

[0017] In a sixth aspect, the present invention provides a virus particle comprising the above-mentioned gRNA or recombinant vector targeting prekallikrein and a capsid.

[0018] In a seventh aspect, the present invention provides a pharmaceutical composition comprising: the above-mentioned recombinant vector, the above-mentioned RNA delivery system, the above-mentioned gene editing system, the above-mentioned recombinant cell or the above-mentioned viral particle.

[0019] In an eighth aspect, the present invention provides the use of gRNA, recombinant vectors, RNA delivery systems, gene editing systems, recombinant cells, or viral particles targeting prekallikrein for the preparation of a drug for preventing and / or treating hereditary angioedema, cardiovascular and cerebrovascular diseases, or hypercholesterolemia. These drugs can reduce vascular permeability and treat hereditary angioedema. They also exhibit good efficacy in preventing and / or treating cardiovascular and cerebrovascular diseases and possess good biosafety.

[0020] The present invention has the following beneficial effects:

[0021] The present invention designs and screens gRNA targeting prekallikrein, which has a high gene editing efficiency. After gene editing, it can effectively reduce the level of prekallikrein in cells, tissues, organs and blood, reduce the mRNA level of the gene encoding prekallikrein (KLKB1 gene), and reduce vascular permeability. The present invention also provides recombinant vectors and viral particles, which are proved by animal experiments to prove that the recombinant vectors and viral particles can reduce vascular permeability and treat hereditary angioedema. And good prevention and / or treatment of cardiovascular and cerebrovascular diseases, and has good biosafety.

[0022] The gRNA provided by the present invention can be delivered through a variety of RNA delivery systems, such as lipid nanoparticles, cationic lipid complexes, lipid polymer complexes, polymer nanoparticles, inorganic nanoparticles or cationic nanoemulsions. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments. It should be understood that the following drawings only illustrate certain embodiments of the present invention and therefore should not be regarded as limiting the scope. For ordinary technicians in this field, other relevant drawings can be obtained based on these drawings without paying any creative work.

[0024] Figure 1 Serping1 + / - Schematic diagram of PCR identification of Serping1 gene knockout in mice;

[0025] Figure 2 Serping1 + / - Figure 1 shows the results of Western blot quantitative analysis of mouse C1-INH expression;

[0026] Figure 3 Figure 1 shows the statistical results of target site editing efficiency in mouse hepatocytes after gene therapy using AAV as a delivery vector (A), the statistical results of KLKB1 gene expression levels in hepatocytes (B), and the statistical results of peripheral blood PK concentration (C).

[0027] Figure 4 Schematic diagram of LNP as a delivery vector for gene therapy (A), statistical graph of target site editing efficiency in mouse hepatocytes after treatment (B), statistical results of KLKB1 gene expression levels in hepatocytes (C), and peripheral blood PK concentration results (D);

[0028] Figure 5 This is a photo of the mouse hind paw after EB dye treatment in the in vivo vascular permeability measurement experiment;

[0029] Figure 6This is the quantitative result of EB dye in the in vivo vascular permeability measurement experiment;

[0030] Figure 7 This is a statistical result chart of liver and kidney function of the treatment group after drug administration;

[0031] Figure 8 This is a statistical result diagram of the gene editing efficiency of different human sgRNAs;

[0032] Figure 9 The editing efficiency of human sgRNA SEQ ID NO: 6 was verified by first-generation sequencing in 293T cells;

[0033] Figure 10 This is a map showing the location of Ldlr gene knockout in hyperlipidemia model animals;

[0034] Figure 11 This is a statistical graph showing the concentrations of LDL-C, triglycerides, and cholesterol in hyperlipidemia model animals after treatment;

[0035] Figure 12 This is a statistical result graph of the gene editing efficiency after combining the gRNA target sequences shown in SEQ ID NO: 1-4 with base editors;

[0036] Figure 13 This is the result of genotype identification of hyperlipidemia model animals. DETAILED DESCRIPTION

[0037] To make the purpose, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention are described clearly and completely below. Where specific conditions are not specified in the embodiments, conventional conditions or conditions recommended by the manufacturer are used. Where the manufacturer of the reagents or instruments is not specified, all are conventional products that can be purchased commercially.

[0038] As used herein, the term "guide RNA (gRNA)" refers to CRISPR RNA (crRNA). "Guide RNA" can be used interchangeably with "guide". CrRNA and trRNA can be associated as a single RNA molecule (single guide RNA, sgRNA) or in two separate RNA molecules (dual guide RNA, dgRNA). The "guide RNA" of this application is referred to as "gRNA". trRNA can be a naturally occurring sequence, or the trRNA sequence can have modifications or variations compared to the naturally occurring sequence.

[0039] As used herein, "gRNA" refers to a sequence within a guide RNA that is complementary to a target sequence and is used to guide the guide RNA to the target sequence for binding or modification (e.g., cutting) by an RNA-guided DNA binder. "Guide RNA" may also be referred to as a "guide region," "targeting sequence," "spacer sequence," or "protospacer sequence." The length of the gRNA may be about 20 base pairs, for example, in the case of Streptococcus pyogenes (i.e., SpyCas9) and related Cas9 homologs / orthologs. Shorter or longer sequences may also be used as gRNA, for example, with a length of 14, 15, 16, 17, 18, 19, 21, or 22 nucleotides. In some embodiments, the gRNA and the targeting sequence may be 100% complementary or identical to each other in sequence. In other embodiments, the gRNA and the targeting sequence may contain at least one mismatch. For example, the gRNA and the targeting sequence can contain 1, 2, 3, 4, 5, or 6 mismatches, wherein the total length of the targeting sequence is at least 15, 16, 17, 18, 19, 20, 21, or more base pairs. In some embodiments, the gRNA and the targeting sequence can contain 1-4 mismatches, wherein the gRNA contains at least 17, 18, 19, 20, or more nucleotides. In some embodiments, the gRNA and the targeting sequence can contain 1, 2, 3, or 4 mismatches, wherein the gRNA contains at least 19 or 20 nucleotides.

[0040] As used herein, the "target sequence" or "targeting sequence" of a gRNA comprises both strands of genomic DNA, i.e., the target sequence and the complement of the target sequence.

[0041] In a first aspect, the present invention provides a gRNA targeting prekallikrein, wherein the gRNA targets any one of exons 2 to 15 of the KLKB1 gene or its splice acceptor or splice donor;

[0042] In a preferred embodiment of the present invention, the gRNA targets exon 2, exon 6, exon 7, exon 10, exon 11, exon 12, exon 13 or exon 15 of the KLKB1 gene or its splice acceptor or splice donor;

[0043] In a preferred embodiment of the present invention, the gRNA targets the exon 2 splice donor, exon 6 splice donor, exon 10 splice donor, exon 11 splice donor, exon 11 splice acceptor, exon 12 splice donor, exon 13 splice donor, exon 15 splice acceptor, exon 15 splice acceptor, exon 11 or exon 7 splice acceptor of the KLKB1 gene;

[0044] In a preferred embodiment of the present invention, the gRNA targets the splice donor of exon 2 of the KLKB1 gene;

[0045] In a preferred embodiment of the present invention, the target sequence of the gRNA comprises: a. a nucleotide sequence as shown in any one of SEQ ID NO: 1, SEQ ID NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, and 84; b. at least 15, 16, 17, 18, 19, 20, or 21 consecutive nucleotides selected from the sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, and 84; c. or a sequence identical to SEQ ID NO: 1, SEQ ID NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, and 84. A sequence that is at least 85% identical to the sequence shown in any one of NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, 84; for example, a sequence that is at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical.

[0046] In a preferred embodiment of the present invention, the target sequence of the gRNA comprises: a. a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 6; b. at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides selected from the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6; c. or a sequence that is at least 85% identical to the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6, such as at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% identical.

[0047] SEQ ID NOs: 1-4 target prekallikrein of murine origin.

[0048] Among them, the sequence shown in SEQ ID NO: 1 has a higher gene editing efficiency than other sequences, and the editing efficiency of the target site exceeds 60% from 2 weeks to 6 months after treatment.

[0049] The gRNA provided by the present invention can silence the KLKB1 gene, effectively reduce the level of prekallikrein in cells, tissues, organs and blood, reduce the mRNA level of the gene encoding prekallikrein (KLKB1 gene), reduce vascular permeability, and restore normal liver function. The present invention also provides recombinant vectors and viral particles, which have been shown through animal experiments to have good uses in preventing and / or treating cardiovascular and cerebrovascular diseases, and have good biosafety, and have good application prospects in treating cardiovascular and cerebrovascular diseases.

[0050] In a second aspect, the present invention provides a recombinant vector comprising a nucleic acid molecule encoding the aforementioned gRNA targeting prekallikrein.

[0051] In a preferred embodiment of the present invention, the recombinant vector is a recombinant adeno-associated virus vector, a recombinant lentivirus vector, an adenovirus vector or a poxvirus vector.

[0052] In a preferred embodiment of the present invention, the recombinant vector further comprises a gene regulatory sequence, and the gene regulatory sequence comprises a promoter and a terminator.

[0053] In a preferred embodiment of the present invention, the vector further comprises a sequence for expressing a gene editor, for example, a vector comprising a coding sequence of a partially active Cas nuclease (Cas nickase) or cytidine deaminase fused to an inactive dCas9.

[0054] In some embodiments, the Cas nuclease is a Class 2 Cas nuclease. In some embodiments, the Cas nuclease is Cas9, Cpf1, C2cl, C2c2, and C2c3, or a modified protein thereof. In some embodiments, the Cas nuclease is from a Type II CRISPR / Cas system.

[0055] In a preferred embodiment of the present invention, the Cas nuclease is selected from the NG-SpCas9 protein, and the PAM motif of NG-SpCas9 is 5'-NG-3' (N represents any nucleotide).

[0056] In a preferred embodiment of the present invention, the promoter is selected from a constitutive promoter, an inducible promoter, a ubiquitous promoter, a tissue-specific promoter, a cell type-specific promoter, or a developmental stage-specific promoter.

[0057] In a preferred embodiment of the present invention, the promoter is a type II promoter or a type III promoter.

[0058] In a preferred embodiment of the present invention, the promoter is selected from at least one of the EF promoter and the human U6 promoter.

[0059] The AAV nucleic acid sequence of the recombinant adeno-associated virus is derived from AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, or a combination thereof.

[0060] The terms AAV vector, AAV particle, AAV vector particle, recombinant AAV particle, recombinant AAV vector particle, and rAAV are used interchangeably and, as used herein, refer to AAV capsids with or without a DNA genome comprising ITRs produced by producer cells or packaging cells, respectively.

[0061] In a third aspect, the present invention provides an RNA delivery system, which is a lipid nanoparticle (LNP), a cationic lipid complex (LPX), a lipid polyplex (LPP), a polymer nanoparticle (PNP), an inorganic nanoparticle (INP) or a cationic nanoemulsion (CNE), and the RNA delivery system also includes the above-mentioned nucleic acid molecule of the gRNA targeting prekallikrein.

[0062] In a fourth aspect, the present invention provides a gene editing system, which includes a nucleic acid molecule encoding the above-mentioned gRNA targeting prekallikrein or the above-mentioned recombinant vector, a Cas protein and a gene editor.

[0063] In a preferred embodiment of the present invention, the gene editor is selected from an adenine base editor, a cytosine base editor or a dual base editor;

[0064] In a preferred embodiment of the present invention, the base editor is NG-ABE8e, BE4max-NG, A3ABE4max, eA3ABE4max, hyBE4max, hyA3ABE4max or hyeA3ABE4max;

[0065] In a preferred embodiment of the present invention, the base editor is NG-ABE8e (Addgene: 138491) or CBE4max-NG (Addgene: 152992).

[0066] The gene editing system includes a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 6 or an expression vector including the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6, as well as an expression vector for the Cas protein and an expression vector for the ABE gene editor.

[0067] The gene editing system comprising the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6 and a gene editor has a higher gene editing efficiency. In particular, the gene editing system comprising the nucleotide sequence shown in SEQ ID NO: 1 and a gene editor has a gene editing efficiency exceeding 90%, and can efficiently silence the target gene KLKB1, thereby reducing the transcription level and protein expression level of KLKB1.

[0068] The nucleotide sequence shown in SEQ ID NO: 6 and the gene editing system of the gene editor have an editing efficiency of over 80% for the target gene KLKB1.

[0069] In a fifth aspect, the present invention provides a recombinant cell comprising the above-mentioned recombinant vector or the above-mentioned gene editing system.

[0070] In a preferred embodiment of the present invention, recombinant cells include but are not limited to bacteria, fungi, or 293 cells, 293T cells, 293FT cells, CHO cells, COS cells, Per6 cells, 293 series cells, Per6 cells, and CHO cells.

[0071] In a preferred embodiment of the present invention, the bacteria include at least one of Agrobacterium, Mycobacterium, Streptomyces, Escherichia coli and Bacillus subtilis.

[0072] In a preferred embodiment of the present invention, the fungus comprises at least one of Trichoderma reesei and yeast.

[0073] The host cells include transformants and transformed cells, which include the primary transformed cell and its progeny, regardless of the number of passages. The progeny may not be completely identical to the parent cell in terms of nucleic acid content, but may contain mutations.

[0074] The recombinant cells are prepared by transforming a recombinant expression vector into a host cell (e.g., a microorganism) using conventional methods in the art. The host microorganism can be any of a variety of conventional host microorganisms in the art, as long as the recombinant expression vector can stably replicate and the exogenous gene carried by it can be effectively expressed. Host microorganisms include bacteria or fungi.

[0075] In a sixth aspect, the present invention provides a virus particle comprising the above-mentioned gRNA or recombinant vector targeting prekallikrein, and a capsid.

[0076] In a seventh aspect, the present invention provides a pharmaceutical composition comprising: the above-mentioned recombinant vector, the RNA delivery system, the above-mentioned gene editing system, the above-mentioned recombinant cell or the above-mentioned viral particle.

[0077] In an eighth aspect, the present invention provides the use of gRNA, recombinant vectors, RNA delivery systems, gene editing systems, recombinant cells or viral particles targeting prekallikrein in drugs for the treatment of hereditary angioedema, cardiovascular and cerebrovascular diseases or hypercholesterolemia.

[0078] In an alternative embodiment, adeno-associated viruses are used to deliver selected gRNA and CRISPR base editors into host cells (such as mouse liver cells) to induce a sustained decrease in plasma kallikrein levels by introducing a precise single-nucleotide loss-of-function mutation in KLKB1.

[0079] In a preferred embodiment of the present invention, the cardiovascular and cerebrovascular diseases are selected from thromboembolic diseases.

[0080] Thromboembolic disorders include, but are not limited to, hereditary angioedema, advanced diabetic macular edema, myocardial infarction, angina pectoris, reocclusion and restenosis after angioplasty or aortocoronary bypass surgery, disseminated intravascular coagulation, stroke, transient ischemic attack, peripheral arterial occlusive disease, pulmonary embolism, or deep vein thrombosis;

[0081] In a preferred embodiment of the present invention, the cardiovascular and cerebrovascular diseases are selected from coronary heart disease, atherosclerosis, atrial fibrillation, heart failure or hyperlipidemia.

[0082] In a preferred embodiment of the present invention, the drug is administered by injection.

[0083] In a preferred embodiment of the present invention, the drug further comprises a pharmaceutically acceptable carrier, which is selected from at least one of a protective agent, an excipient, a binder, a disintegrant, a lubricant, a fragrance, a preservative, a stabilizer, a suspending agent, a dispersant and a diluent.

[0084] Examples include: excipients such as sucrose, starch, mannitol, sorbitol, lactose, glucose, cellulose, talc, calcium phosphate, calcium carbonate; binders such as cellulose, methylcellulose, hydroxypropyl cellulose, polypropylpyrrolidone, gelatin, gum arabic, polyethylene glycol, sucrose, starch; disintegrants such as starch, hydrolyzed starch, carboxymethyl cellulose, carboxymethyl cellulose calcium salt, hydroxypropyl starch, sodium starch glycolate, sodium bicarbonate, calcium phosphate, calcium citrate; lubricants such as magnesium stearate, talc, sodium lauryl sulfate; flavorings such as citric acid, menthol, glycine , orange powder; preservatives such as sodium benzoate, sodium bisulfite, parabens (such as methyl paraben, ethyl paraben, propyl paraben, butyl paraben); stabilizers such as citric acid, sodium citrate, acetic acid and polycarboxylic acids from the titriplex series, such as diethylenetriaminepentaacetic acid (DTPA); suspending agents such as methylcellulose, polyvinylpyrrolidone, aluminum stearate; dispersants; diluents such as water, organic solvents; waxes, fats and oils such as beeswax, cocoa butter; polyethylene glycol; white petrolatum, etc.

[0085] The features and performance of the present invention are further described in detail below with reference to the embodiments.

[0086] Example 1

[0087] Screening of mouse genomic KLKB1 gRNA.

[0088] 1. Cell experiments

[0089] The gRNA was designed at the junction of intron and exon of mouse KLKB1 gene as follows:

[0090] Mouse gRNA targeting sequence Mouse gRNA targeting sequence Targeting KLKB1 gene location SEQ ID NO: 1 gRNA1 TACTTACCACAGGAGACGGT Exon 2 splice donor SEQ ID NO: 2 gRNA2 ACACCCTGTGATTTAAAAGT Exon 3 splice acceptor SEQ ID NO: 3 gRNA3 AAACAGGTTTGGTTGCTTCA Exon 4 splice acceptor SEQ ID NO: 4 gRNA4 CATCTTACCACTTATTTGAT Exon 4 splice donor

[0091] The sequences of the four gRNAs corresponding to the above mouse gRNA targeting sequences 1-4 are as follows:

[0092] gRNA1:ACCGUCUCCUGUGGUAAGUA;

[0093] gRNA2:ACUUUUAAAUCACAGGGUGU;

[0094] gRNA3: UGAAGCAACCAAACCUGUUU;

[0095] gRNA4: AUCAAAUAAGUGGUAAGAUG.

[0096] The designed gRNAs were combined with different ABEs and CBEs that met the PAM sequence requirements. gRNA screening was performed on the Hepa1-6 cell line to select the combination with the highest editing efficiency.

[0097] ABE and CBE plasmids were obtained from Addgene. The specific steps are as follows:

[0098] 1. Hepa1-6 cells were cultured in 10% FBS + DMEM. Cells at passage 3-6 were selected and plated in 24-well plates. The cell density at the time of plating was about 70%, and the culture medium was adjusted to 5% FBS + DMEM.

[0099] 2. Plasmid transfection was performed 12-18 hours after plating, with a total amount of 1ug per well, a mass ratio of BE to gRNA of 3:1, and the transfection reagent lipo3000.

[0100] 3. 6 hours after transfection, change the medium to 10% FBS + DMEM medium.

[0101] 4. 48 hours after transfection, transfer the cells to a 12-well plate, culture and add culture medium with a BSD concentration of 20 μg / ml.

[0102] 5. After 48 hours of screening, the culture medium was replaced with 10% FBS + DMEM without BSD.

[0103] 6. After 24-48 hours of incubation, remove the culture medium. Wash three times with PBS and lyse the cells by adding 200 μl of lysis buffer (10 mM Tris-HCl (pH 7.5), 0.05% SDS, and 0.1% freshly added proteinase K) to each well. Incubate the lysate at 37°C for 60 minutes, then heat at 95°C for 10 minutes.

[0104] 7. Design PCR primers upstream and downstream of gRNA, and perform first-generation sequencing after PCR amplification with Vazyme pk511 enzyme.

[0105] PCR primer list

[0106]

[0107] After screening, it was found that the gRNA target sequences shown in SEQ ID NO: 1-4 have good gene editing efficiency ( Figure 12 ). The target sequence of the gRNA shown in SEQ ID NO: 1 with the highest editing efficiency was selected for subsequent animal experiments.

[0108] 2. Animal Experiments

[0109] 1. Model Animal Preparation

[0110] Serping1 knockout (KO) mice (C57BL / 6J) were purchased from Cyagen Biosciences (Guangzhou, China). They were generated by CRISPR-Cas9-mediated targeted gene excision, with gRNA targeting introns 2 and 3, resulting in a 1857-base pair deletion including exon 3. Figure 1 shown.

[0111] Extract Serping1 + / - Serping1 genotype identification was performed on DNA samples from Het mice, wild type (WT) mice, and homozygous (Homo) mice. Figure 1 As shown in the results, it can be seen that Serping1 gene knockout (KO) mice were successfully constructed.

[0112] Acquisition of Serping1 + / - The venous blood of rats and wild-type (WT) mice was centrifuged at 3000 rpm for 15 minutes after standing for 4 hours to obtain serum. PBS was then added to the sample for dilution, and loading buffer was added in proportion and mixed. The dilution multiples were 200 times and 400 times, respectively. 10 μL of sample was loaded, and protein standards were used as controls. Electrophoresis was performed at 80V for 30 minutes, and then at 120V for 60 minutes. The unstained SDS-PAGE gel was transferred to the PVDF membrane at 350 mA for 60 minutes to transfer the proteins on the SDS-PAGE gel to the PVDF membrane. The PVDF membrane was blocked with 5% skim milk powder at room temperature for 1 hour. C1-INH antibody (Proteintech) was used as the primary antibody and incubated overnight. HRP-labeled goat anti-rabbit IgG antibody was used as the secondary antibody. After incubation at room temperature for 90 minutes, it was placed in an imaging system for photography. Figure 2 As shown. ImajeJ performed semi-quantitative analysis of the bands and the results confirmed that Serping1 + / - The expression of C1-INH in mice was decreased to about 30% of that in WT mice.

[0113] 2. Recombinant Adeno-associated Virus Packaging

[0114] Given the 4.7kb packaging limit of a single AAV vector and the fact that the full-length ABE8e (Addgene: 138491) sequence exceeds this capacity, the base editor was strategically split into N-terminal and C-terminal fragments for AAV packaging. In vitro assembly confirmed that the split fragments could be recombined into functional and structurally complete proteins. The combination with the highest editing efficiency (gRNA1+ABE) was selected. The screened base editing tools and corresponding gRNAs were packaged using AAV8 capsids, and the virus packaging was produced by PackGene Biotech (Guangzhou, China). The vector was purified using iodixanol gradient ultracentrifugation and titrated by SYBR Green quantitative PCR (qPCR). The packaged virus is AAV8-Klkb1-KO, including the N-terminus and C-terminus. Serping1 provided in step 1 + / - 5-week-old mice (Serping1 + / - Mice) were injected with AAV8-Klkb1-KO via tail vein, with a total of 8×10 11 Viral copy number (viral load), where the N-terminal and C-terminal components are 4×10 11 Viral copy number.

[0115] 3.LNP packaging

[0116] The mRNA forms of ABE8e and gRNA1 (gRNA1 corresponding to SEQ ID NO: 1) were packaged using MC3, DOPE, Chol, and DMG-PEG2000. The specific ratios were as follows: MC3:DOPE:Chol:DMG-PEG2000=47:10:41:2, N / P=6, sgRNA:mRNA, 1:3. + / - 5-week-old mice (Serping1 + / - The drug was injected into the tail vein of rats (2 mg / kg).

[0117] Figure 4 Figure A is a schematic diagram of LNP as a delivery vector for gene therapy. Figure 4 Figure B is a statistical diagram of the editing efficiency of the target site in mouse liver cells after treatment. The results show that the editing efficiency of the target site in mouse liver cells remains at a high level after treatment. After gene therapy, the expression level of the KLKB1 gene in liver cells decreased significantly ( Figure 4 Figure C in the figure), the concentration of peripheral blood PK decreased significantly ( Figure 4 Figure D in the figure).

[0118] 4. Efficacy Evaluation

[0119] ① Isolation of primary liver cells

[0120] Mice (Serping1 injected with AAV8-Klkb1-KO in step 3) were anesthetized with Zoletil and Dexmedetomidine. + / - Mice). Subsequently, a cannula is inserted into the inferior vena cava, and then the portal vein is cut, and the liver is perfused with normal saline through the cannula. Perfusion continues until the color of the liver changes from red to yellow, indicating that the perfusion is complete. One liver lobe is removed for fixation. The remaining liver is then digested with collagenase NB4 at a concentration of 1.5 mg / ml. The moderately digested liver is removed and placed in pre-cooled 5% FBS culture medium, ground with a 5 ml empty needle, and the suspension is filtered through a 100-μm filter to obtain a single cell suspension. Centrifuge at 500 g, increase the speed by 9, decrease the speed by 3, and the reagent for 5 minutes. After repeating 3 times, the supernatant becomes clear. The cell pellet is primary hepatocytes for DNA or RNA extraction.

[0121] ②Genomic DNA extraction and next-generation sequencing

[0122] Hepatocytes were lysed using 200 μl of lysis buffer containing 10 mM Tris-HCl (pH 7.5), 0.05% SDS, and 0.1% freshly added proteinase K. The lysates were incubated at 37°C for 60 minutes and then heated at 95°C for 10 minutes to facilitate genomic DNA extraction. For genomic DNA extraction from various organs, including heart, spleen, kidney, pancreas, brain, muscle, intestine, and lung, an animal genomic DNA rapid extraction kit (Beyotime, D0065S) was used.

[0123] Next-generation sequencing (NGS) was used to detect the most accurate editing efficiency. For library construction, Phanta Flash Super-Fidelity DNA polymerase (Vazyme) was used to ensure high-fidelity amplification. The initial PCR contained a barcode, and the amplified product was gel-purified and used as a template for subsequent PCR rounds to introduce an index. After a second round of gel purification, the product was ready for sequencing using xplus PE150. After quality control of the sequencing data, the results were split according to the barcode. Figure 3 As shown in Figure A, the efficiency of editing the target site in hepatocytes was approximately 60%-70% from 2 weeks to 6 months after treatment.

[0124] ③RNA extraction and RT-qPCR quantitative analysis of the changes in KLKB1 mRNA expression in hepatocytes.

[0125] Primary hepatocytes were lysed using Trizol, and RNA was separated from protein and DNA using chloroform. RNA was precipitated with isopropanol, followed by a purification step using 75% ethanol washes, and finally the ethanol was removed. The purified RNA was reverse transcribed into cDNA using the PrimeScript FastReverse Transcriptase Kit (Takara). Subsequently, quantitative real-time PCR (qPCR) was performed using TB Green qPCR MasterMix (Takara) with primers: Klkb1, TGATTTTATTCAACCGAGTGGGT (forward) and CATCTTCTGACAGTACTGGGC (reverse); reference gene Gapdh, CTCATGACCACAGTCCATGC (forward) and CACAGTGGGGTAGGAACAC (reverse). qPCR data were analyzed using the QuantStudio 5 Real-Time PCR System (Thermo Fisher Scientific). Comparison was performed using ΔΔ The CT method determines the quantitative fold change of gene expression and accurately evaluates the expression level of the target gene. The mRNA of the correctly spliced ​​KLKB1 gene in hepatocytes decreased by more than 90% from 2 weeks to 6 months after treatment. Figure 3 Figure B in the figure).

[0126] ④ Changes in peripheral blood PK concentration

[0127] Plasma kallikrein (PK) concentrations were measured using a commercially available enzyme-linked immunosorbent assay (ELISA) kit, and the appropriate dilution factor for serum samples was determined in preliminary experiments. Serum PK levels decreased by 85% after 2 weeks of treatment, 93.1% after 4 weeks, and 95.4% after 8 weeks. Even after 24 weeks of treatment, the decrease remained at around 95%. Figure 3 Figure C in the figure).

[0128] ⑤ In vivo vascular permeability assay

[0129] To analyze changes in vascular permeability, mice were intravenously injected with 2.5 mg / kg of captopril (MCE) to induce increased vascular permeability. Five minutes later, 100 μl of Evans blue dye (solarbio) at a dose of 30 mg / kg was injected through the tail vein. Photos were taken thirty minutes later. After sacrifice by cervical dislocation, the colon and feet were removed, weighed and placed in 1.5-mL tubes. 500 μL of formamide (Sangon Biotech) was added to each tube and incubated overnight at 55°C to extract the Evans blue dye. EB dye was quantified photometrically at 620 nm using a LAMBDA 1050+UV / Vis / NIR system, and formamide was used as a blank control.

[0130] The color of the hind paws of captopril-induced mice was darker than that of the uninduced mice. The color depth of the hind paws of the treated captopril-induced mice was not significantly different from that of the uninduced group. Figure 5 , dye quantitative results are shown in Figure 6 The results showed that the recombinant adeno-associated virus could reduce vascular permeability and lighten the color of captopril-induced mice after treatment.

[0131] Example 2

[0132] This example conducts a safety assessment on the recombinant adeno-associated virus provided in Example 1.

[0133] Liver and kidney function assessment:

[0134] Serum aspartate aminotransferase (AST) and alanine aminotransferase (ALT) increased temporarily at 3 days and 3 weeks after administration, respectively, and by 3 weeks and 2 months, the elevated levels had returned to normal. Given that the editing efficiency in mouse hearts is approximately 20%, the levels of CK-MB, LDH, and α-HBDH in the blood were monitored to assess the responsiveness of the myocardium after administration. The levels of CK-MB, LDH, and α-HBDH increased three weeks after administration. CK-MB returned to normal levels after two months, while LDH and α-HBDH returned to normal after six months. Markers of renal function, such as creatine kinase (CK) and creatinine and urea levels, remained consistent with those of the control group after administration. The levels of creatine kinase, creatinine, and uric acid in the treatment group remained consistent with those of the control group after administration. The above results are shown in Figure 7 .

[0135] Example 3

[0136] This example screens gRNAs targeting KLKB1 in the human genome.

[0137] According to the human genome KLKB1 gene sequence, human gRNA is shown in the following table

[0138]

[0139]

[0140]

[0141] The screening method for human gRNA is as follows:

[0142] 1. Materials and Methods

[0143] 1. Construction of RT-plenti-mCherry-U6-sgRNA lentiviral backbone plasmid

[0144] In this study, a two-step method was used to construct the -plenti-mCherry-U6-sgRNA lentiviral expression plasmid through homologous recombination.

[0145] 1.1 PCR amplification of lentiviral backbone and U6+scaffold fragments

[0146] Co-amplification of two DNA fragments:

[0147] Lentiviral backbone fragment (8242 bp): amplified using the RT-plenti-mCherry plasmid as a template using primers Plenti-clone-F1 (5′-ATTAGTCATCGCTATTACCATGGT-3′) and Plenti-clone-R1 (5′-ACGTAGATGTACTGCCAAGTAG-3′).

[0148] U6+scaffold fragment (461bp): using plasmid 47511 as template and primer U6-scaffold-F1

[0149] (5′-ACTTGGCAGTACATCTACGTaattcagtcgactggatccg-3′)

[0150] and U6-scaffold-R1

[0151] (5′-TGGTAATAGCGATGACTAATtagagaggtacctcgagcg-3′) amplification.

[0152] 1.2 PCR product processing

[0153] All PCR products were digested with DpnI to remove residual template plasmid. Amplified products were separated by 1.2% agarose gel electrophoresis, excised, and purified using an imported gel recovery kit.

[0154] 1.3 Homologous recombination cloning (double fragment ligation)

[0155] use Plus One Step PCR Cloning Kit (NR005) for double fragment ligation:

[0156]

[0157] Reaction conditions: 50°C for 10 minutes

[0158] 1.4 Competent cell transformation and clone selection

[0159] Thaw competent Trans5α cells on ice, add 10 μL of the ligation product, and incubate on ice for 30 minutes. Heat shock in a 42°C water bath for 45 seconds, then immediately incubate on ice for 2 minutes. Add 500 μL of SOC solution and incubate on a shaker at 37°C for 1 hour. Centrifuge at 5000 rpm for 3 minutes, discard the supernatant, and plate onto LB plates containing antibiotics. The next day, isolate a single colony and perform sequencing verification.

[0160] 1.5 Second round of plasmid library construction

[0161] Lentiviral backbone and sgRNA library fragments were amplified using primers KLD-RV and plent-library-F and sg-library-F / R. The synthesized sgRNA library was double-stranded and ligated at 50°C for 30 minutes. The ligation products were transformed into Trans5α competent cells. Single clones were selected from the ABE-1 and CBE-1 groups and sequenced using the hU6-F primer.

[0162] 1.6 Virus packaging and cell infection

[0163] After extracting the correct recombinant plasmid, a three-plasmid system was used for viral packaging. Cells were infected with lentivirus, screened for Puro resistance, and then transfected with ABE and CBE editors. After drug screening, genomic DNA was extracted for NGS sequencing and editing efficiency analysis.

[0164] The editing efficiency results are shown in the table below and Figure 8 The results showed that the human gRNAs shown in SEQ ID NOs: 6, 15, 25, 28, 37, 40, 44, 50, 51, 73, and 84 had higher gene editing efficiency.

[0165]

[0166]

[0167]

[0168] 1.7 The editing efficiency of human sgRNA SEQ ID NO: 6 was verified on 293T cells. 293T cells were seeded in 24-well cell culture plates for transfection. 12-16 hours after seeding (when the cell confluence was about 70%), 750 ng of base editor plasmid and 250 ng of sgRNA (SEQ ID NO: 6) plasmid (Addgene No. 47511) were transfected using 1.5 μl Lipofectamine 3000 (Thermo Fisher Scientific). 48 hours after transfection, the cells were transferred to a 12-well plate and cultured. DNA was extracted 96 hours after transfection and first-generation sequencing was performed after PCR ( Figure 9). It was confirmed that the editing efficiency of the human sgRNA SEQ ID NO: 6 target was approximately 80%.

[0169] Example 4

[0170] Treatment of hyperlipidemia model animals.

[0171] 1. Hyperlipidemia model animals were C57BL / 6JGpt background mice purchased from Jicui Company with Ldlr gene knockout. The knockout method was to use CrisprCas9 to knock out exon 4 of the Ldlr gene, see Figure 10 .

[0172] The primers for genotyping are as follows:

[0173] The primer sequences are as follows: F: 5'-CTCCCAGGATGACTTCCGAT-3'; R: 5'-CGCAGTGCTCCTCATCTGAC-3'.

[0174] Target gene knockout: 289 bp;

[0175] Target gene not knocked out: 371bp;

[0176] Homozygous: only KO band; WT: only WT band; Heterozygous: one KO band and one WT band. Figure 13 shown.

[0177] 2. Breeding to obtain Ldlr + / - At 5 weeks of age, a total of 8 × 10 AAV8-Klkb1-KO cells were injected 11 Viral load, N-terminal and C-terminal components were 4×10 11 Three weeks after the injection, blood samples were collected to evaluate the changes in blood lipid levels in the treatment group and the control group. The patients were fasted for 13 hours before the blood samples were collected. Figure 11 The concentrations of LDL-C, triglycerides, and cholesterol in the treatment group were lower than those in the control group.

[0178] The foregoing description is merely a preferred embodiment of the present invention and is not intended to limit the present invention. Those skilled in the art will readily appreciate that various modifications and variations of the present invention are possible. Any modifications, equivalent substitutions, or improvements made within the spirit and principles of the present invention are intended to be within the scope of protection of the present invention.

Claims

1. A gRNA targeting prekallikrein, characterized in that The gRNA targets any one of exons 2-15 of the KLKB1 gene or its splice acceptor or splice donor; Preferably, the gRNA targets exon 2, exon 6, exon 7, exon 10, exon 11, exon 12, exon 13 or exon 15 of the KLKB1 gene or its splice acceptor or splice donor; Preferably, the gRNA targets exon 2 splice donor, exon 6 splice donor, exon 10 splice donor, exon 11 splice donor, exon 11 splice acceptor, exon 12 splice donor, exon 13 splice donor, exon 15 splice acceptor, exon 15 splice acceptor, exon 11 or exon 7 splice acceptor of the KLKB1 gene; Preferably, the gRNA targets the splicing donor of exon 2 of the KLKB1 gene; Preferably, the target sequence of the gRNA comprises: a. a nucleotide sequence as shown in any one of SEQ ID NO: 1, SEQ ID NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, 84; b. at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides selected from the sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, 84; c. or a sequence that is at least 85% identical to the sequence shown in any one of SEQ ID NO: 1, SEQ ID NO: 6, 15, 24, 25, 27, 28, 37, 39, 40, 44, 50, 51, 73, 84; Preferably, the target sequence of the gRNA comprises: a. a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 6; b. at least 15, 16, 17, 18, 19, 20 or 21 consecutive nucleotides selected from the sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6; c. or a sequence that is at least 85% identical to the sequence shown in SEQ ID NO: 1 or SEQ ID NO:

6.

2. A recombinant vector, characterized in that: It includes a nucleic acid molecule encoding the gRNA targeting prekallikrein according to claim 1; Preferably, the recombinant vector is a recombinant adeno-associated virus vector, a recombinant lentivirus vector, an adenovirus vector or a poxvirus vector; Preferably, the recombinant vector further comprises a gene regulatory sequence, and the gene regulatory sequence comprises a promoter and a terminator.

3. An RNA delivery system, characterized in that The RNA delivery system is a lipid nanoparticle (LNP), a cationic lipid complex (LPX), a lipid polyplex (LPP), a polymer nanoparticle (PNP), an inorganic nanoparticle (INP) or a cationic nanoemulsion (CNE), and the RNA delivery system further comprises a nucleic acid molecule of the gRNA targeting prekallikrein according to claim 1.

4. A gene editing system, characterized in that: It includes a nucleic acid molecule encoding the gRNA targeting prekallikrein according to claim 1 or the recombinant vector, Cas protein and gene editor according to claim 2.

5. The gene editing system according to claim 4, characterized in that The gene editor is selected from an adenine base editor, a cytosine base editor, or a dual base editor; Preferably, the base editor is NG-ABE8e, BE4max-NG, A3ABE4max, eA3ABE4max, hyBE4max, hyA3ABE4max or hyeA3ABE4max; Preferably, the base editor is NG-ABE8e (Addgene: 138491) or BE4max-NG (Addgene: 152992).

6. The gene editing system according to claim 5, characterized in that The gene editing system includes a nucleotide sequence as shown in SEQ ID NO: 1 or SEQ ID NO: 6 or an expression vector including the nucleotide sequence shown in SEQ ID NO: 1 or SEQ ID NO: 6, as well as an expression vector for the Cas protein and an expression vector for the ABE gene editor.

7. A recombinant cell, characterized in that It includes the recombinant vector according to claim 2 or the gene editing system according to claim 4.

8. A virus particle, characterized in that It comprises the gRNA targeting prekallikrein according to claim 1 or the recombinant vector according to claim 2, and a capsid.

9. A pharmaceutical composition, characterized in that It includes: The recombinant vector of claim 2, the RNA delivery system of claim 3, the gene editing system of any one of claims 4 to 6, the recombinant cell of claim 7, or the viral particle of claim 8.

10. Use of the gRNA targeting prekallikrein according to claim 1, the recombinant vector according to claim 2, the RNA delivery system according to claim 3, the gene editing system according to any one of claims 4 to 6, the recombinant cell according to claim 7, or the viral particle according to claim 8 in the preparation of a medicament for preventing and / or treating hereditary angioedema, cardiovascular and cerebrovascular diseases, or hypercholesterolemia; Preferably, the cardiovascular and cerebrovascular diseases are selected from thromboembolic diseases; The thromboembolic disease is selected from the group consisting of advanced diabetic macular edema, myocardial infarction, angina pectoris, reocclusion and restenosis after angioplasty or aortocoronary bypass surgery, disseminated intravascular coagulation, stroke, transient ischemic attack, peripheral arterial occlusive disease, pulmonary embolism, or deep vein thrombosis; Preferably, the cardiovascular and cerebrovascular disease is selected from coronary heart disease, atherosclerosis, atrial fibrillation, heart failure or hyperlipidemia; Preferably, the drug is administered by injection.