Application of DDOST and SEC61A in regulation and control of hepatitis B virus antigen expression and HBV replication

By overexpressing DDOST and SEC61A1 plasmids and utilizing a proximity labeling system targeting HBsAg and HBsRNA, we screened and verified host factors that can inhibit HBsAg expression and HBV replication, solving the problem that existing drugs are difficult to inhibit hepatitis B virus surface antigen and providing a new strategy for the treatment of hepatitis B virus.

CN120624481APending Publication Date: 2025-09-12CHONGQING MATERNAL & CHILD HEALTH HOSPITAL (CHONGQING OBSTETRICS & GYNECOLOGY HOSPITAL CHONGQING INST OF GENETICS & REPRODUCTION)
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510681893.9
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-26
Publication Date
2025-09-12

AI Technical Summary

Technical Problem

Existing drugs for the treatment of hepatitis B virus (HBV) are unable to effectively inhibit the expression of hepatitis B virus surface antigen (HBsAg), resulting in a low cure rate for chronic hepatitis B and a lack of in-depth understanding and effective strategies for regulating HBsAg expression.

Method used

Using DDOST and SEC61A1 as host factors, a proximity labeling system targeting HBsAg and HBsRNA was constructed to screen out novel host factors that can inhibit HBsAg expression and HBV replication. Overexpression plasmids of DDOST and SEC61A1 were used, and protein labeling was performed using TurboID biotin ligase and HiBiT-LgBiT affinity molecules. RNA labeling was combined with dPspCas13b and crRNA system to identify and verify their inhibitory effects.

Benefits of technology

The successful inhibition of HBsAg expression and HBV replication provides a potential strategy for developing new hepatitis B virus surface antigen inhibitory drugs, which is expected to improve the cure rate of chronic hepatitis B.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005419513430000041
    Figure BDA0005419513430000041
  • Figure BDA0005419513430000051
    Figure BDA0005419513430000051
  • Figure HDA0005419513440000011
    Figure HDA0005419513440000011
Patent Text Reader

Abstract

The invention discloses an application of host factors DDOST and SEC61A in regulation and control of hepatitis B virus antigen expression and HBV replication. A series of novel host factors for regulating and controlling HBsAg expression are identified, and by screening the host factors, DDOST and SEC61A1 show a strong inhibition effect on hepatitis B virus surface antigens in cell and mouse models, and are expected to be used for developing novel therapeutic drugs and therapeutic strategies for inhibiting the hepatitis B virus surface antigens.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of biopharmaceuticals, and in particular to an application of DDOST and SEC61A in regulating hepatitis B virus antigen expression and HBV replication. Background Art

[0002] Hepatitis B virus (HBV) infection is prevalent worldwide. According to reports, there were approximately 254 million chronic HBV-infected people in the world in 2022, with approximately 1.5 million new infections each year, and approximately 820,000 people died from liver failure, cirrhosis, or hepatocellular carcinoma and other related diseases caused by HBV infection. Although the hepatitis B vaccine has been widely administered, it can only block the spread of the virus and is ineffective for those already infected. Nucleoside (acid) analogues and long-acting interferon (IFN) are two types of drugs currently approved for the treatment of chronic hepatitis B. Nucleoside (acid) analogues are polymerase inhibitors that can effectively inhibit HBV replication, reduce the serum HBV load of most patients within a certain period of time, and improve transaminase levels and liver histological manifestations, but they cannot completely eliminate HBV, and patients often need lifelong medication. PEG-IFNα has many adverse reactions, some patients cannot tolerate it, and there are also few patients who achieve clinical cure (or functional cure) within a limited course of treatment.

[0003] HBV is an enveloped DNA virus belonging to the Hepadnaviridae family. The HBV virion is composed of a nucleocapsid and envelope proteins. The HBV genome is a 3.2 kb relaxed circular DNA (rcDNA), in which the longer strand is designated as the negative strand (-) and the shorter strand as the positive strand (+).

[0004] An important feature of HBV is its ability to secrete a large number of complete and incomplete virus particles. Complete HBV virus particles are spherical with a diameter of 42nm and the concentration in the blood of infected people can usually reach 10 9 / mL. The outer shell of the hepatitis B virus contains the surface antigen, namely HBsAg, and the core part contains the core antigen, namely HBcAg. Incomplete virus particles include genome-free virus particles, RNA-containing virus particles, naked nucleocapsids and empty subviral particles (SVP). SVP, also known as hepatitis B surface antigen (HBsAg) particles, contains tightly packed, membrane-embedded HBs, but does not contain viral DNA. They are released from infected cells or cells that have integrated HBVDNA in the form of spheres or filaments and are the main source of hepatitis B surface antigen in the patient's blood. Compared with infectious hepatitis B virus particles, SVP secretion is extremely excessive, which can exceed the former by more than 10,000-100,000 times. It is considered to be a decoy for the immune system, which can exhaust B cell and T cell responses and cause the virus to persist.

[0005] Functional cure of chronic hepatitis B is defined as the sustained disappearance of serum HBsAg, with or without anti-HBs seroconversion, while HBV DNA remains below the detection limit and liver function remains normal. Although existing drug treatments can reduce serum HBV DNA to below the detection limit in most patients and control disease progression, the proportion of patients achieving HBsAg disappearance is very low. Therefore, HBsAg clearance has become a bottleneck in the cure of chronic hepatitis B. More effective inhibition and even elimination of HBsAg are important directions for developing new strategies for the treatment of chronic hepatitis B.

[0006] The development of new strategies to inhibit HBsAg depends on a deeper understanding of the regulatory mechanisms of HBsAg expression, but currently research on the regulation of HBsAg expression is still relatively lacking.

[0007] Host factors are proteins in host cells that regulate the transcription and translation of the viral genome following HBV infection, thereby influencing viral replication. These host factors may interact with viral proteins to facilitate viral entry into host cells, the assembly, and release of progeny viral particles. Research into the role of host factors in HBV infection helps understand the relationship between the virus and the host, providing clues for the development of new antiviral strategies. Because host factors are involved in various stages of the HBV life cycle, a wide range of studies are currently underway on the interaction between HBV and host factors, including the identification of receptors for viral entry, factors that influence cccDNA synthesis, and host factors that influence cccDNA transcription. These studies often focus on the effects on viral replication, specifically the production of progeny viral DNA, with less attention paid to the effects on surface antigens. Furthermore, systematic screening of host factors associated with surface antigen expression is lacking.

[0008] The DDOST gene (Dolichyl-Diphosphooligosaccharide-Protein Glycosyltransferase Non-Catalytic Subunit) encodes a component of the oligosaccharide transferase complex, which catalyzes the transfer of high-mannose oligosaccharides to asparagine residues in nascent polypeptide chains within the lumen of the rough endoplasmic reticulum. The gene product is also involved in the processing of advanced glycation end products (AGEs), which are formed through non-enzymatic reactions between carbohydrates and proteins or lipids. These products are closely associated with hyperglycemia (DiabVascDisRes 2018) and have also been linked to tumor development (FrontGenet. 2022; Discov Oncol. 2024). However, studies on the relationship between DDOST and viruses have been limited. Yi et al. reported (PLOS PATHOGENS 2022) that upon infection with herpes simplex virus type 1 (HSV-1), the mediator of interferon regulatory factor 3 activation (MITA, also known as STING) undergoes DDOST-mediated N-glycosylation modification in the endoplasmic reticulum (ER). Selective mutation of DDOST-dependent N-glycosylation sites disrupts MITA oligomerization, leading to loss of its immune function. In addition, enhancing DDOST gene expression in the mouse brain can effectively enhance the local immune response to herpes simplex virus type 1 (HSV-1) and prolong the survival of mice with HSV encephalitis (HSE).

[0009] The SEC61A gene encodes the SEC61 translocon subunit alpha 1, a core component of the SEC61 protein complex. It forms a transport channel on the endoplasmic reticulum membrane, mediating the translocation of nascent polypeptide chains across the membrane and the processing of secretory proteins. This subunit is crucial for protein synthesis, endoplasmic reticulum homeostasis, and the cellular secretory pathway. Its dysfunction is associated with various genetic diseases and cancers (Signal Transduct Target Ther. 2017). Regarding its relationship to viral replication, Debasis et al. conducted a genome-wide RNA interference screen using a Drosophila cell model and identified 94 genes that affect Sindbis virus (SINV) infection. Among them, SEC61A and VCP have been shown to promote SINV entry in both insects and mammals (Cell Reports 2014). Ayaka et al. found that Sec61A was not involved in the invasion of Ebola virus (EBOV), but its interaction with VP24 enhanced the ability of VP24 to inhibit EBOV genome transcription and reduced the activity of EBOV polymerase (J Infect Dis. 2011). Summary of the Invention

[0010] The purpose of the present invention is to address the above problems and provide an application of DDOST and SEC61A in regulating hepatitis B virus antigen expression and HBV replication.

[0011] In order to achieve its purpose, the present invention adopts the following technical solutions:

[0012] The first aspect of the present invention provides use of a host factor or a gene encoding the host factor in regulating hepatitis B virus replication in a host cell, wherein the host factor is DDOST or SEC61A1.

[0013] The host factor DDOST or SEC61A1 reduces the HBsRNA level and inhibits the replication of HBV DNA.

[0014] The second aspect of the present invention provides the use of a host factor or a gene encoding the host factor in regulating the expression level of hepatitis B virus antigen in a host cell, wherein the host factor is DDOST or SEC61A1.

[0015] The hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg;

[0016] The host factor inhibits the expression level of hepatitis B virus antigen in host cells.

[0017] The third aspect of the present invention provides use of a host factor or an expression promoter thereof in the preparation of a drug for resisting hepatitis B virus or inhibiting hepatitis B virus antigen, wherein the host factor is DDOST or SEC61A1.

[0018] The expression promoter is an overexpression virus or overexpression plasmid of DDOST or SEC61A1; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg.

[0019] The fourth aspect of the present invention provides the use of a host factor or a gene encoding the same as a drug target in screening drugs for resisting hepatitis B virus or inhibiting hepatitis B virus antigens, wherein the host factor is DDOST or SEC61A1.

[0020] The drug promotes the expression of DDOST or SEC61A1, thereby inhibiting the expression level of hepatitis B virus antigens and the replication of HBV DNA in host cells; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg.

[0021] A fifth aspect of the present invention provides a product, the active ingredient of which is DDOST or SEC61A1 protein, and the function of the product is any one of the following:

[0022] (1) Reduce HBs RNA levels;

[0023] (2) Inhibit HBV DNA replication;

[0024] (3) inhibiting the expression level of hepatitis B virus antigens in host cells; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg;

[0025] (4) Prevent or treat HBV infection and inhibit HBV invasion;

[0026] Preferably the product is a pharmaceutical.

[0027] The nucleotide sequence of the gene encoding DDOST is shown in SEQ ID NO.61, and the nucleotide sequence of the gene encoding SEC61A1 is shown in SEQ ID NO.62.

[0028] The beneficial effects of the present invention are:

[0029] This study utilizes TurboID biotin ligase in combination with the HiBiT-LgBiT affinity molecule pair to construct a proximity labeling system targeting HBsAg. Furthermore, using TurboID and BioID2 biotin ligases in combination with dPspCas13b and the HBs crRNA system, a proximity labeling system targeting HBs RNA was constructed, successfully biotinylating HBsAg and proteins adjacent to HBsRNA. This system was used to identify a series of novel host factors that regulate HBsAg expression. Screening of these host factors revealed that DDOST and SEC61A1 exhibited strong inhibitory effects on HBsAg in cell and mouse models, suggesting potential applications in the development of novel therapeutic agents and strategies for inhibiting HBsAg. BRIEF DESCRIPTION OF THE DRAWINGS

[0030] Figure 1 This is the result of screening for host factors that inhibit HBsAg expression.

[0031] Figure 2 These are the results of screening for anti-HBsAg activity of ten candidate genes.

[0032] Figure 3 Overexpression of DDOST and SEC61A1 inhibited HBsAg expression by HBV1.3.

[0033] Figure 4The effects of low-concentration gradient overexpression of DDOST and SEC61A1 on HBsAg levels are shown.

[0034] Figure 5 The figure shows that overexpression of DDOST and SEC61A1 inhibits HBV replication in a cell model. In the figure, ssDNA refers to single-stranded DNA, that is, HBV DNA that has not been fully synthesized.

[0035] Figure 6 It was shown that DDOST and SEC61A1 inhibited HBsAg and HBeAg expression in mouse cell lines.

[0036] Figure 7 It was shown that DDOST and SEC61A1 inhibited HBsAg expression and HBV replication in mice.

[0037] Figure 8 It was shown that DDOST suppressed HBsAg and HBeAg levels in AAV-HBV1.2 mice. DETAILED DESCRIPTION

[0038] The present invention will be further described below with reference to the embodiments, but the present invention is not limited thereto.

[0039] The experimental methods in the following examples are conventional methods unless otherwise specified.

[0040] The main sources of reagents used in the examples of the present invention are as follows: :

[0041] 2× PrimeSTAR Max Premix: Takara, Japan; Gel Extraction Kit, Plasmid Miniprep Kit: Magen, China; T4 Ligase Buffer: New England Biolabs, USA; T4 Polynucleotide Kinase: New England Biolabs, USA; Nano GloHiBiTLytic Detection System: Promega, USA; BsmBI, BsaⅠ, Tangobuffer, DTT: Thermo Scientific, USA; ATP, T7 DNA Ligase: New England Biolabs, USA. Ⅲ1st Strand cDNA Synthesis SuperMix: Yisheng Biotechnology Co., Ltd., China; ChamQ Universal SYBR qPCR MasterMix: Nanjing Novozymes Biotechnology Co., Ltd., China; HBV surface antigen and E antigen detection kits: Shanghai Kehua Bioengineering Co., Ltd., China; DH5α: Solarbio, China; Lipo8000 transfection reagent: Beyotime, China; trypsin, DMEM medium, PBS, Opti-MEM, and penicillin-streptomycin: Gibco, USA; fetal bovine serum: Lonsera, Uruguay.

[0042] Plasmid template: pCH9 / 3091, a plasmid containing the HBV 1.1 ploid genome driven by the CMV promoter, was constructed by the Nassal laboratory at the University of Freiburg, Germany. The plasmids pPspCas13bcrRNAbackbone and pPspCas13b-ADAR2DD(E488Q), also preserved in our laboratory, were constructed by the Zhang Feng laboratory at the Massachusetts Institute of Technology.

[0043] Construction of a HiBiT model for HBs characterization (i.e., plasmid pHBs-HiBiT): Our research team has previously successfully constructed a simple and effective HBsAg characterization model. We constructed three different HBs plasmids expressing HiBiT tags: SP2-preS2-S-G4S-HiBiT (abbreviated as S-HiBiT(s)), SP2-preS2-S-3XG4S-HiBiT (abbreviated as S-HiBiT), and SP2-preS2-HiBiT-15XG4S-S (abbreviated as HiBiT-S). All three plasmids express HiBiT-tagged S proteins under the control of the HBV preS2 promoter. The HiBiT tags are located at the C-terminus or N-terminus of HBs, separated by glycine-serine (GS) linkers of varying lengths. For detailed information on the model, see Chinese patent application CN202311448773.1, publication number CN117503772A, entitled "Compounds for Inhibiting Hepatitis B Surface Antigen and Their Applications."

[0044] The DDOST overexpression adeno-associated virus (AAV) was provided by Shanghai LifeSpan Gene Technology Co., Ltd. The overexpression plasmids of SEC61A and other candidate genes were constructed by the research team of the inventors of the present invention.

[0045] The sequences of the amplification primers used in the examples of the present invention are shown in Table 1 below:

[0046] Table 1. Primer sequences used in the examples of the present invention

[0047]

[0048]

[0049] Example 1

[0050] 1 Experimental methods

[0051] 1.1 Cell culture and transfection methods

[0052] Human hepatoma cell lines HepG2 and Huh7 were cultured in DMEM medium containing 10% fetal bovine serum in a 5% CO2, 37°C incubator. TM Transfection was performed according to the instructions of the transfection reagent.

[0053] 1.2 Plasmid construction

[0054] The human DDOST gene sequence (SEQ ID NO.61) involved in the plasmid construction is as follows:

[0055] ATGGAGCCCAGCACCGCGGCCCGGGCTTGGGCCCTCTTTTGGTTGCTGCTGCCCTTGCTTGGCGC

[0056] GGTTTGCGCCAGCGGACCCCGCACCTTAGTGCTGCTGGACAACCTCAACGTGCGGGAGACTCAT

[0057] TCGCTTTTCTTCCGGAGCCTGAAGGACCGGGGCTTTGAGCTCACATTCAAGACCGCTGATGACCC

[0058] CAGCCTGTCTCTCATAAAGTATGGGGAATTCCTCTATGACAATCTCATCATTTTCTCCCCTTCGGTA

[0059] GAAGATTTTGGAGGCAACATCAACGTGGAGACATCAGTGCCTTTATTGACGGCGGAGGCAGTG

[0060] TGCTGGTAGCTGCCAGCTCCGACATTGGTGACCCTCTTCGAGAGCTGGGCAGTGAGTGCGGGATT

[0061] GAGTTTGACGAGGAGAAAACGGCTGTCATTGACCATCACAACTATGACATCTCAGACCTTGGCCA

[0062] GCATACGCTCATCGTGGCTGACACTGAGAACCTGCTGAAGGCCCCAACCATCGTTGGGAAATCAT

[0063] CTCTAAATCCCATCCTCTTTCGAGGTGTTGGGATGGTGGCCGATCCTGATAACCCTTTGGTGCTGG

[0064] ACATCCTGACGGGCTCTTCCACCTCTTACTCCTTCTTCCCGGACAAGCCTATCACCCAGTATCCAC

[0065] ATGCGGTGGGGAAGAACACCCTCCTCATTGCTGGGCTCCAGGCCAGGAACAATGCCCGCGTCAT

[0066] CTTCAGCGGCTCCCTCGACTTCTTCAGCGACTCCTTCTTCAACTCAGCAGTGCAGAAGGCGGCGC

[0067] CCGGCTCCCAGAGGTATTCCCAGACAGGCAACTATGAACTAGCTGTGGCCCTCTCCCGCTGGGTG

[0068] TTCAAGGAGGAGGGTGTCCTCCGTGTGGGGCCTGTGTCCCATCATCGGGTGGGCGAGACAGCCC

[0069] CACCCAATGCCTACACTGTCACTGACCTAGTGGAGTATAGCATCGTGATCCAGCAGCTCTCAAAT

[0070] GGCAAATGGGTCCCCTTTGATGGCGATGACATTCAGCTGGAGTTTGTCCGCATTGATCCTTTTGTG

[0071] AGGACCTTCCTGAAGAAGAAAGGTGGCAAATACAGTGTTCAGTTCAAGTTGCCCGACGTGTATG

[0072] GTGTATTCCAGTTTAAAGTGGATTACAACCGGCTAGGCTACACACACCTGTACTCTTCCACTCAGG

[0073] TATCCGTGCGGCCACTCCAGCACACGCAGTATGAGCGCTTCATCCCCTCGGCCTACCCCTACTACG

[0074] CCAGCGCCTTCTCCATGATGCTGGGGCTCTTCATCTTCAGCATCGTCTTCTTGCACATGAAGGAGAAGGAGAAGTCCGACTGA。

[0075] The human SEC61A gene sequence (SEQ ID NO.62) involved in plasmid construction is as follows:

[0076] ATGGCAATCAAATTTCTGGAAGTCATCAAGCCCTTCTGTGTCATCCTGCCGGAAATTCAGAAGCC

[0077] AGAGAGGAAGATTCAGTTTAAGGAGAAAGTGCTGTGGACCGCTATCACCCTCTTTATCTTCTTAG

[0078] TGTGCTGCCAGATTCCCCTGTTTGGGATCATGTCTTCAGATTCAGCTGACCCTTTCTATTGGATGA

[0079] GAGTGATTCTAGCCTCTAACAGAGGCACATTGATGGAGCTAGGGATCTCTCCTATTGTCACGTCTG

[0080] GCCTTATAATGCAACTCTTGGCTGGCGCCAAGATAATTGAAGTTGGTGACACCCCAAAAGACCGA

[0081] GCTCTCTTCAACGGAGCCCAAAAGTTATTTGGCATGATCATTACTATCGGCCAGTCTATCGTGTATG

[0082] TGATGACCGGGATGTATGGGGACCCTTCTGAAATGGGTGCTGGAATTTGCCTGCTAATCACCATTC

[0083] AGCTCTTTGTTGCTGGCTTAATTGTCCTACTTTTGGATGAACTCCTGCAAAAAGGATATGGCCTTG

[0084] GCTCTGGTATTTCTCTCTTCATTGCAACTAACATCTGTGAAACCATCGTATGGAAGGCATTCAGCC

[0085] CCACTACTGTCAACACTGGCCGAGGAATGGAATTTGAAGGTGCTATCATCGCACTTTTCCATCTGC

[0086] TGGCCACACGCACAGACAAGGTCCGAGCCCTTCGGGAGGCGTTCTACCGCCAGAATCTTCCCAA

[0087] CCTCATGAATCTCATCGCCACCATCTTTGTCTTTGCAGTGGTCATCTATTTCCAGGGCTTCCGAGTG

[0088] GACCTGCCAATCAAGTCGGCCCGCTACCGTGGCCAGTACAACACCTATCCCATCAAGCTCTTCTAT

[0089] ACGTCCAACATCCCCATCATCCTGCAGTCTGCCCTGGTGTCCAACCTTTATGTCATCTCCCAAATG

[0090] CTCTCAGCTCGCTTCAGTGGCAACTTGCTGGTCAGCCTGCTGGGCACCTGGTCGGACACGTCTTC

[0091] TGGGGGCCCAGCACGTGCTTATCCAGTTGGTGGCCTTTGCTATTACCTGTCCCCTCCAGAATCTTT

[0092] TGGCTCCGTGTTAGAAGACCCGGTCCATGCAGTTGTATACATAGTGTTCATGCTGGGCTCCTGTGC

[0093] ATTCTTCTCCAAAACGTGGATTGAGGTCTCAGGTTCCTCTGCCAAAGATGTTGCAAAGCAGCTGA

[0094] AGGAGCAGAGATGGTGATGAGAGGCCACCGAGAGACCTCCATGGTCCATGAACTCAACCGGTA

[0095] CATCCCCACAGCCGCGGCCTTTGGTGGGCTGTGCATCGGGGCCCTCTCGGTCCTGGCTGACTTCC

[0096] TAGGCGCCATTGGGTCTGGAACCGGGATCCTGCTCGCAGTCACAATCATCTACCAGTACTTTGAGATCTTCGTTAAGGAGCAAAGCGAGGTTGGCAGCATGGGGGCCCTGCTCTTCTGA.

[0097] (1) Construction of plasmid pDDOST-HA:

[0098] This plasmid is designed to express the HA-tagged DDOST gene. Using the pCH9 / 3091 plasmid as a template, primers Famp + R HA-VECT were used to amplify fragment 1, and primers Ramp + F VECT were used to amplify fragment 2. Using HepG2 cell cDNA as a template, primers F DDOST + R DDOST were used to amplify fragment 3. Fragment 4 was phosphorylated and annealed using primers F15GS oli + R 15GS oli, and fragment 5 was phosphorylated and annealed using primers F 3×HA oli + R 3×HA oli. Fragments 1, 2, 3, 4, and 5 were digested and ligated using Golden Gate cloning. The resulting plasmid was named pDDOST-HA.

[0099] (2) Construction of plasmid pSEC61A-HA:

[0100] This plasmid is designed to express the HA-tagged SEC61A gene. Using the pDDOST-HA plasmid as a template, primers Famp + R HA-VECT were used to amplify fragment 6, and primers Ramp + F HA-VECT were used to amplify fragment 7. Using HepG2 cell cDNA as a template, primers F SEC61A1 + R SEC61A1 were used to amplify fragment 8. Fragments 6, 7, and 8 were digested and ligated using Golden Gate cloning. The resulting plasmid was named pSEC61A1-HA.

[0101] (3) Construction of plasmid pTurboID-LgBiT

[0102] This plasmid is used to express TurboID fused to LgBiT. TurboID is a biotin ligase used to efficiently label interacting proteins or neighboring molecules surrounding a target protein in living cells. Labeled biotinylated proteins can be efficiently enriched using streptavidin magnetic beads, and combined with mass spectrometry analysis, the target protein's interaction network can be systematically identified. LgBiT is used to recruit TurboID to HBs-HiBiT (due to the high affinity between LgBiT and HiBiT), thereby achieving labeling of HBs-adjacent proteins.

[0103] Using the SmBiT-LgBiT plasmid (preliminarily constructed by this research team, see Chinese patent application CN202110016645.4, publication number CN112694535A, invention name: Multifunctional protein molecular switch for antibody detection) as a template, primers F15GS+R amp were used to amplify fragment 9, and plasmid pTurboID (synthesized and cloned by Beijing Qingke Biotechnology Co., Ltd., TurboID gene sequence see: Ting et al., Efficient proximity labeling in living cells and organisms with TurboID. Nature Biotechnology, 2018) was used as a template, primers F amp+R TurboID were used to amplify fragment 10. Fragments 9 and 10 were enzyme-digested and ligated using the Golden Gate cloning method. The resulting plasmid was named plasmid pTurboID-LgBiT.

[0104] (4) Construction of plasmid pHBs-SmBiT

[0105] This plasmid is used to express HBs fused with SmBiT. SmBiT has a low affinity for LgBiT, resulting in minimal binding between HBs-SmBiT and TurboID-LgBiT. This plasmid serves as a negative control for proximity labeling of the HBs protein.

[0106] Using the pHBs-HiBiT plasmid as a template, primers F amp + R 15GS were used to amplify fragment 11, and primers F polyA + R amp were used to amplify fragment 12. Fragment 13 was phosphorylated and annealed using primers F Sm oli + R Sm oli. Fragments 11, 12, and 13 were digested and ligated using the GoldenGate cloning method, and the resulting plasmid was named pHBs-SmBiT.

[0107] (5) Construction of plasmid pPspCas13b cr 6 / 8 / 15 / 22 / NT

[0108] This plasmid is used to express four crRNAs targeting HBs RNA (cr 6 / 8 / 15 / 22) and one negative control crRNA (cr NT) that does not target any sequence. CrRNA is a guide RNA with a sequence complementary to the target RNA. Here, it can guide the PspCas13b protein to bind to HBs RNA.

[0109] Using the pPspCas13b crRNAbackbone plasmid as a template, primers F crrna2422+R crrna2422 were used to amplify fragment 14. Fragment 14 was digested using the Golden Gate cloning method, and the single fragments were connected end to end. The resulting plasmid was named plasmid pPspCas13b crRNA. Using pPspCas13b crRNA as a template, primers F crRNA + R crRNA were used to amplify fragment 15, and primers F cr6 oli + R cr6 oli were used for phosphorylation and annealing to obtain fragment 16. Primers F cr8 oli + R cr8oli were used for phosphorylation and annealing to obtain fragment 17. Primers F cr15oli + R cr15 oli were used for phosphorylation and annealing to obtain fragment 18. Primers F cr22 oli + R cr22 oli were used for phosphorylation and annealing to obtain fragment 19. Primers F crNT oli + R crNT oli were used for phosphorylation and annealing to obtain fragment 20. Fragment 15 was digested and ligated with fragments 16, 17, 18, 19, and 20, respectively, using the Golden Gate cloning method. The resulting plasmid was named plasmid pPspCas13b cr 6 / 8 / 15 / 22 / NT.

[0110] (6) Construction of plasmid pdPspCas13b-NES

[0111] This plasmid is used to express the dPspCas13b protein with an NES sequence fused to its C-terminus. dPspCas13b loses its cleavage enzyme activity but retains its binding enzyme activity, allowing it to bind to target RNA under the guidance of crRNA. The nuclear export signal (NES) is an amino acid sequence on the protein containing four hydrophobic groups that is responsible for transporting the protein from the nucleus to the cytoplasm through the nuclear pore. The fused NES sequence allows the dPspCas13b protein to be localized in the cytoplasm.

[0112] Using the pPspCas13b-ADAR2DD (E488Q) plasmid as a template, primers F amp + R Psp133H were used to amplify fragment 21, primers F Psp133H + R Psp1058H were used to amplify fragment 22, primers F Psp1058H + R GS-NES were used to amplify fragment 23, and primers F TAA + R Ramp were used to amplify fragment 24. Fragments 21, 22, 23, and 24 were digested and connected using the Golden Gate cloning method. The resulting plasmid was named plasmid pdPspCas13b-NES.

[0113] (7) Construction of plasmids pdPspCas13b-TurboID-NES and pdPspCas13b-BioID2-NES

[0114] These two plasmids express dPspCas13b proteins fused with TurboID or BioID2, respectively. Both TurboID and BioID2 are biotin ligases used for proximity labeling. After fusion expression with the dPspCas13b protein, proteins adjacent to the target RNA bound to the dPspCas13b protein can be biotinylated.

[0115] Using the pdPspCas13b-NES plasmid as a template, primers F amp+R PspCas13b were used to amplify fragment 25, primers F GS-NES+R amp were used to amplify fragment 26, and primers F TurboID-2+R TurboID-2 were used to amplify fragment 27. Plasmid pBioID2 (synthesized and cloned by Beijing Qingke Biotechnology Co., Ltd., BioID2 gene sequence see: Roux et al., An improved smaller biotin ligase for BioID proximity labeling. Molecular Biology of the Cell, 2016) was used as a template, and primers F BioID2+R BioID2 were used to amplify fragment 28. Fragments 25, 26, and 27 were digested and connected using the Golden Gate cloning method. The resulting plasmid was named plasmid pdPspCas13b-TurboID-NES. Fragments 25, 26, and 28 were digested and ligated using the Gate cloning method, and the resulting plasmid was named plasmid pdPspCas13b-BioID2-NES.

[0116] (8) Construction of plasmids pNES-dPspCas13b-TurboID-NES and pNES-dPspCas13b-BioID2-NES

[0117] Based on pdPspCas13b-TurboID-NES and pdPspCas13b-BioID2-NES, these two plasmids fused NES sequences at the N-terminus to further enhance the cytoplasmic localization of dPspCas13b-TurboID and dPspCas13b-BioID2 proteins.

[0118] Using the pdPspCas13b-TurboID-NES plasmid as a template, primers F amp+R PspATG were used to amplify fragment 29, primers F Psp13b+R amp were used to amplify pdPspCas13b-TurboID-NES to obtain fragment 30, primers F Psp13b+Ramp were used to amplify pdPspCas13b-BioID2-NES to obtain fragment 31, and primers F NES oli+RNES oli were used to phosphorylate and anneal to obtain fragment 32. Fragments 29, 30, and 32 were digested and ligated using the Golden Gate cloning method. The resulting plasmid was named plasmid pNES-dPspCas13b-BioID2-NES. Fragments 29, 31, and 32 were digested and ligated using the Golden Gate cloning method. The resulting plasmid was named plasmid pNES-dPspCas13b-TurboID-NES.

[0119] (9) Construction of plasmids pNLS-dPspCas13b-TurboID-NLS and pNLS-dPspCas13b-BioID2-NLS

[0120] Both plasmids fuse NLS sequences at the N- and C-termini of the dPspCas13b-TurboID and dPspCas13b-BioID2 proteins. The nuclear localization signal (NLS) interacts with the nuclear import vector, enabling the protein to be transported into the cell nucleus and achieving nuclear localization of the dPspCas13b-TurboID and dPspCas13b-BioID2 proteins.

[0121] Using the pNES-dPspCas13b-BioID2-NES plasmid as a template, fragment 33 was amplified with primers F amp + R Psp ATG, fragment 34 was obtained by phosphorylation annealing with primers F NLS oli + RNLS oli, fragment 35 was obtained by amplification with primers F Psp13b-2 + R GS-Psp13b-2, fragment 36 was obtained by phosphorylation annealing with primers F nuNLS oli + R nuNLS oli, and fragment 37 was obtained by amplification with primers F BioID2-2 + R BioID2-4. Using the pNES-dPspCas13b-TurboID-NES plasmid as a template, primers F TurboID-3+R TurboID-3 were used to amplify fragment 38, and primers F GS-NLS+R GS-NLS were used to amplify fragment 39. Fragments 33, 34, 35, 36, 37, and 39 were digested and connected using the Golden Gate cloning method. The resulting plasmid was named plasmid pNLS-dPspCas13b-BioID2-NLS. Fragments 33, 34, 35, 36, 38, and 39 were digested and connected using the Golden Gate cloning method. The resulting plasmid was named plasmid pNLS-dPspCas13b-TurboID-NLS.

[0122] The PCR reaction system consisted of 10 ng of template plasmid, 0.4 μL each of primers F (10 μM) and R (10 μM), 10 μL of 2× PrimeSTAR Max Premix, and sterile ultrapure water to a volume of 20 μL. Reaction conditions included pre-denaturation at 98°C for 2 min, followed by 35 cycles of 98°C for 15 s, 55°C for 15 s, and 72°C for 30 s. Amplified fragments were recovered using a gel recovery kit and their concentrations were measured.

[0123] The phosphorylation annealing system consisted of 1 μL each of oligonucleotide primers F (100 μM) and R (100 μM), 1 μL of 10× T4 ligase buffer, and 0.5 μL of T4 polynucleotide kinase. The volume was brought to 20 μL with sterile ultrapure water. Reaction conditions were: 37°C for 30 min, 95°C for 5 min, followed by a cooling cycle of 1°C per cycle (15 s). The reaction was terminated after 70 cycles of cooling to 25°C. A 1 μL aliquot of the reaction product was diluted with 199 μL of sterile ultrapure water, and 1 μL of the diluted product was then used for the Golden Gate ligation reaction.

[0124] The Golden Gate ligation reaction system consists of 1 μL of Tango buffer, 1 μL of DTT, 1 μL of ATP, 0.75 μL of BsmBI enzyme (specifically, Bsa I enzyme is used when constructing the pPspCas13b cr 6 / 8 / 15 / 22 / NT series of plasmids), 0.25 μL of T7 DNA ligase, and each fragment to be ligated. The amount of each fragment to be added is calculated based on the concentration (ng / μL) of the Kb*20 / Gel recovery reaction, and the total volume is made up to 10 μL with sterile ultrapure water. Reaction conditions: 37°C for 5 minutes, 20°C for 5 minutes, 25 cycles, and inactivation at 80°C for 20 minutes. The Golden Gate ligation product is transformed into DH5α competent bacteria, plated, and a single colony is picked for culture. The bacterial culture is sequenced and verified. A small aliquot of the culture containing the correct sequence is then extracted to obtain the target plasmid.

[0125] 1.3 Detection of HBsAg and HBeAg

[0126] The protein levels of HBsAg and HBeAg in the cell culture supernatant were detected according to the instructions of the enzyme-linked immunosorbent assay kit (Kehua).

[0127] 1.4 Detection of HiBiT luciferase

[0128] according to The fluorescence value in the cell lysate was detected according to the operating instructions of HiBiT Lytic Detection System (Promega, USA).

[0129] 1.5 Western blot detection

[0130] 72 hours after transfection, cells were washed twice with PBS. 50 μl of RIPA lysis buffer supplemented with protease inhibitors was added to each well (using a 24-well plate as an example) and lysed on ice for 30 minutes. Total cell protein was extracted and protein concentration was determined by the BCA assay. Equal amounts of total cell protein were denatured at 100°C for 10 minutes. Proteins were separated by 12.5% ​​SDS-PAGE, transferred to the membrane, blocked with skim milk for 1 hour, then replaced with the primary antibody and incubated on a shaker at 4°C overnight. The next day, the membrane was washed three times with TBS-T (10 minutes each). Secondary antibody was then added and incubated on a shaker at room temperature for 1 hour. After washing three times with TBS-T, the membrane was visualized by ECL.

[0131] 1.7 RNA extraction and real-time fluorescence quantitative PCR

[0132] Taking 12-well plate cells as an example, wash the cells twice with PBS, add 1 ml of Trizol lysis buffer, lyse at room temperature for 10 minutes, add 200 μl of chloroform, shake thoroughly and mix, carefully pipette the supernatant into a new EP tube, add an equal volume of isopropanol, shake thoroughly and mix, centrifuge at 4°C, 13,000 g for 10 minutes, discard the supernatant, add 500 μl of 75% ethanol to wash the precipitate, centrifuge at 4°C, 13,000 g for 10 minutes, discard the supernatant and dry the RNA precipitate, add 20 μl of water to dissolve it, measure the concentration and use Yisheng Company cDNA was synthesized by reverse transcription of RNA using the 1st Strand cDNA Synthesis SuperMix. Next, qPCR was performed, and relative expression levels were calculated using the 2-ΔΔCt method.

[0133] 2 Experimental results

[0134] 2.1 Screening and identification of host factors involved in HBsAg production and secretion using protein proximity markers and RNA proximity markers

[0135] 2.1.1 Labeling System Targeting HBs Protein: HepG2 cells were transfected with the following plasmids: pTurboID-LgBiT + pHBs-HiBiT for the experimental group and pTurboID-LgBiT + pHBs-SmBiT for the control group. Each group was transfected in triplicate. 36 hours after transfection, the three experimental groups were treated with 10 μM, 50 μM, and 500 μM biotin for 1 hour, respectively. The three control groups were treated identically. Different concentrations of biotin labeling can yield complementary results. For example, low concentrations are suitable for highly abundant target proteins, medium concentrations balance labeling efficiency with cell viability, and high concentrations can capture transient interactions. After treatment, cellular proteins were extracted, and biotinylated proteins were captured using streptavidin magnetic beads and identified by mass spectrometry. The final mass spectrometry results showed that proteins labeled with the control group were eliminated from the experimental group in the 10 μM, 50 μM, and 500 μM groups, yielding a total of 49 proteins.

[0136] 2.1.2 Labeling system targeting HBs RNA: pNES-dPspCas13b-TurboID / pNES-dPspCas13b-BioID2 / pNLS-dPspCas13b-TurboID / pNLS-dPspCas13b-BioID2+pHBs+cr 6 / 8 / 15 / 22 (positive group) or cr NT (negative group) were transfected into HepG2 and MHCC-97H liver cancer cells, and pNES-dPspCas13b-TurboID / pNLS-dPspCas13b-BioID2+pHBs+cr 6 / 8 / 15 / 22 (positive group) or cr NT (negative group) were transfected into PLC / PRF / 5 and Huh1 liver cancer cells.

[0137] pNES-dPspCas13b-TurboID / pNES-dPspCas13b-BioID2 / pNLS-dPspCas13b-TurboID / pNLS-dPspCas13b-BioID2+cr 6 / 8 / 15 / 22 (experimental group) or crNT (control group). Unlike HepG2 and MHCC-97H, which require exogenous transfection with the pHBs plasmid, PLC / PRF / 5 and Huh1 liver cancer cell lines have HBs gene sequences integrated into their genomes, allowing them to endogenously transcribe HBs RNA, more consistent with clinical HBV DNA integration in patients. Nineteen hours after transfection, the BioID2 experimental and control groups were treated with 50 μM biotin for 18 hours. Thirty-six hours after transfection, the TurboID2 experimental and control groups were treated with 500 μM biotin for 1 hour. After treatment, cellular proteins were extracted, and biotinylated proteins were captured using streptavidin magnetic beads and identified by mass spectrometry. The final mass spectrometry results showed that the four labeling systems of the four cell lines eliminated the same proteins labeled by the control group from their experimental groups, and a total of 198 proteins were obtained.

[0138] There were 24 duplicates of proteins obtained by protein proximity tagging and RNA proximity tagging, resulting in a total of 223 different proteins. To test the effect of the labeled proteins on HBsAg expression, we co-transfected HepG2 cells with the pHBs-HiBiT plasmid into the 185 genes successfully cloned. HiBiT luciferase activity can be used to indirectly quantify HBsAg expression levels. The results are shown in Figure 1 : Compared with the empty control group, host factors such as EPHX1, DDOST, RPN1, SEC61A1, LMAN1, RETREG3, RTN3, SLC25A6, DDX46, and U2AF2 can reduce HBsAg to below 10%. Therefore, we selected these 10 genes for subsequent antiviral effect verification.

[0139] 2.2 Testing the activity of ten candidate genes in inhibiting HBsAg expression

[0140] We used a gradient of transfection to evaluate the dose effect of gene expression in inhibiting HBs-HiBiT. HepG2 cells were co-transfected with HBs-HiBiT using a gradient of 0, 50ng, 100ng, 200ng, and 400ng of candidate gene overexpression plasmids. Luciferase assays showed that each gene expression plasmid could dose-dependently reduce HBs-HiBiT expression levels ( Figure 2 A). Among them, DDOST and SEC61A1 had the best effect. When the transfection dose exceeded 100 ng / well, HBs-HiBiT was almost undetectable by Western blot ( Figure 2Next, we co-transfected HepG2 cells with the HBV1.3 plasmid to evaluate their effects on HBsAg and HBeAg secretion levels. The results showed that these genes could inhibit HBsAg and HBeAg levels to varying degrees, with DDOST and SEC61A1 having the strongest effects ( Figure 2 D, E).

[0141] 2.3DDOST and SEC61A inhibit HBsAg expression in cultured cells

[0142] HepG2 cells were gradiently transfected with DDOST and SEC61A1 overexpression plasmids to observe their inhibitory effects on HBV1.3. ELISA test results showed that DDOST and SEC61A1 could strongly inhibit the levels of HBsAg and HBeAg in the cell culture supernatant ( Figure 3 Western blot results showed that the intracellular HBsAg level could also be significantly inhibited. When the transfection doses of DDOST and SEC61A were 50 ng / well and 100 ng / well, respectively, HBsAg was suppressed to near the detection limit ( Figure 3 C, D). Similar effects were observed in another liver cancer cell line, Huh7 ( Figure 3 EH).

[0143] 2.4DDOST and SEC61A inhibit HBsAg expression in a dose-dependent manner at low transfection doses

[0144] In the above experiments, since DDOST and SEC61A1 already achieved strong inhibitory effects at low concentrations, we used a lower concentration gradient to observe whether there was a dose-dependent inhibitory effect. HepG2 and Huh7 cells were co-transfected with HBV1.3 using 0, 5ng, 10ng, 20ng, and 50ng of DDOST or SEC61A1 overexpression plasmids. ELISA and Western blot results showed that DDOST and SEC61A1 could dose-dependently reduce the levels of HBsAg and HBeAg in the supernatant and lysate at low concentrations ( Figure 4 AF).

[0145] 2.5 Overexpression of DDOST and SEC61A inhibits HBV replication

[0146] Furthermore, we co-transfected HepG2 cells with DDOST and SEC61A1 overexpression plasmids and HBV1.3 plasmids to observe their effects on HBV DNA. Southern blot results showed that both DDOST and SEC61A1 overexpression could significantly reduce HBV DNA replication levels ( Figure 5 ).

[0147] 2.6DDOST and SEC61A inhibit HBsAg expression in AML cells

[0148] The constructed pAAV-CMV-DDOST / SEC61A1 and pAAV-HBV1.2 plasmids were co-transfected into the mouse liver cell line AML12 and mouse liver cancer cell line Hepa1-6. The supernatant ELISA results showed that, consistent with the experimental results in human hepatocytes in vitro, DDOST and SEC61A1 could significantly inhibit the expression levels of HBsAg and HBeAg ( Figure 6 A, B).

[0149] 2.7DDOST and SEC61A inhibit HBsAg expression and HBV replication in a high-pressure hydrodynamic mouse model

[0150] C57BL / 6 mice aged 6-8 weeks and weighing 17-22 g were selected and randomly divided into 3 groups, namely Vector, DDOST, and SEC61A1 groups, each group containing 3 males and 3 females. Each mouse was injected with 10 μg Vector / DDOST or Vector / SEC61A1+5 μg AAV-HBV1.2 through the tail vein using high-pressure hydrodynamics, and the injection volume (mL) was 10% of the mouse body weight. On the 1st, 3rd, and 7th day after injection, orbital blood was collected to detect HBsAg and HBeAg levels, and on the 7th day, liver tissue pathological sections were taken for HE staining, HBsAg and HBcAg immunohistochemical staining, and HBV DNA and HBs RNA in the liver tissue were detected. The results showed that in the hydrodynamic HBV replication model in mice, overexpression of DDOST and SEC61A1 can still significantly reduce the levels of HBsAg and HBeAg in peripheral blood ( Figure 7 A, B), and can also inhibit the replication of HBV DNA ( Figure 7 C). On the 7th day, the liver tissues of mice in each group were dissected and no significant differences or lesions were found in the gross observation. Figure 7 D). Compared with the Vector control group, DDOST or SEC61A1 overexpression treatment can significantly reduce the content of HBsAg and HBcAg in liver tissue, as well as the levels of HBs RNA and HBV DNA ( Figure 7 EG).

[0151] 2.8DDOST inhibits HBsAg and HBeAg levels in AAV-HBV1.2 infected mouse model

[0152] Because the high-pressure hydrodynamic HBV mouse model easily activates the immune response, leading to HBV clearance, it is difficult to maintain stable viremia over the long term, limiting research on the chronic infection process. The AAV-HBV1.2 model, delivered via recombinant adeno-associated virus, can achieve long-term infection with a single injection, making it a more suitable tool for establishing chronic HBV infection.

[0153] To specifically drive DDOST gene expression in hepatocytes and minimize effects on non-target tissues, an AAV vector containing the TBG promoter was selected. AAV-TBG-Vector and AAV-TBG-DDOST plasmids were constructed, and recombinant viruses were prepared.

[0154] C57BL / 6 mice aged 6-8 weeks and weighing 17-22g were selected and randomly divided into two groups, namely Vector and DDOST groups, each containing 6 males and 6 females. Each mouse was injected with 250μL of AAV virus with a total volume of 10^11v.g. through the tail vein. The dosage of Vector / DDOST and HBV1.2 virus in each group was 2:1. Starting from the third week after injection, orbital blood was collected every week to test HBsAg and HBeAg. The results showed that DDOST-AAV can continuously and significantly reduce HBsAg in mice ( Figure 8 A), HBeAg( Figure 8 B) Expression levels.

Claims

1. Use of a host factor or a gene encoding the same in regulating hepatitis B virus replication in a host cell, wherein the host factor is DDOST or SEC61A1.

2. The use according to claim 1, characterized in that: The host factor DDOST or SEC61A1 reduces the HBsRNA level and inhibits the replication of HBV DNA.

3. Use of a host factor or a gene encoding the same in regulating the expression level of hepatitis B virus antigen in host cells, wherein the host factor is DDOST or SEC61A1.

4. The use according to claim 3, characterized in that: The hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg; The host factor inhibits the expression level of hepatitis B virus antigen in host cells.

5. Use of a host factor or an expression promoter thereof in the preparation of a drug for resisting hepatitis B virus or inhibiting hepatitis B virus antigen, wherein the host factor is DDOST or SEC61A1.

6. The use according to claim 5, characterized in that: The expression promoter is an overexpression virus or overexpression plasmid of DDOST or SEC61A1; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg.

7. Use of a host factor or a gene encoding the same as a drug target in screening drugs for resisting hepatitis B virus or inhibiting hepatitis B virus antigens, wherein the host factor is DDOST or SEC61A1.

8. The use according to claim 7, characterized in that: The drug promotes the expression of DDOST or SEC61A1, thereby inhibiting the expression level of hepatitis B virus antigens and the replication of HBV DNA in host cells; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg.

9. A product, the active ingredient of which is DDOST or SEC61A1 protein, wherein the function of the product is any of the following: (1) Reduce HBs RNA levels; (2) Inhibit HBV DNA replication; (3) inhibiting the expression level of hepatitis B virus antigens in host cells; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg; (4) Prevent or treat HBV infection and inhibit HBV invasion; Preferably the product is a pharmaceutical.

10. The use according to any one of claims 1 to 8 or the product according to claim 9, characterized in that: The nucleotide sequence of the gene encoding DDOST is shown in SEQ ID NO.61, and the nucleotide sequence of the gene encoding SEC61A1 is shown in SEQ ID NO.62.

Citation Information

Patent Citations

  • Multifunctional protein molecule switch used for antibody detection

    CN112694535A

  • Multifunctional protein molecular switch for antibody detection

    CN112694535B

  • Compound for inhibiting hepatitis B surface antigen and application thereof

    CN117503772A