Molecular marker of alveolar rhabdomyosarcoma and application thereof

Abstract

The present application relates to the technical field of biological medicine, and in particular to a molecular marker of alveolar rhabdomyosarcoma and application thereof, wherein the molecular marker is circFOXO1R-loop site, and a DNA-RNA hybridization region thereof is located at chr13:41133915-41134263 of a human genome. In the present application, the circFOXO1R-loop site is verified by CUT&Tag-qPCR and DRIP-qPCR, and it is found that the circFOXO1R-loop can promote the combination of FOXO1 gene and RNAPol II and DNA damage, and it has important clinical application value for developing a reagent or kit for diagnosing alveolar rhabdomyosarcoma, a drug or a gene therapy strategy for preventing and / or treating alveolar rhabdomyosarcoma aiming at the target.

Description

TECHNICAL FIELD

[0001] The application relates to the technical field of biological medicine, and in particular to a molecular marker of alveolar rhabdomyosarcoma and application thereof. BACKGROUND

[0002] Rhabdomyosarcoma (RMS) is the most common soft tissue malignancy of mesenchymal origin in children and adolescents. According to the 2020 version of WHO, RMS is divided into four subtypes, alveolar (Alveolar RMS, ARMS), embryonic (Embryonal RMS, ERMS), spindling cell (Spindling cell RMS, SRMS) and pleomorphic (Pleomorphic RMS, PRMS), according to clinical manifestations, pathological morphology and molecular genetic characteristics. The occurrence of rhabdomyosarcoma is closely related to chromosomal abnormalities. ARMS has specific chromosomal translocations t(2;13)(q35;q14) and t(1;13)(q36;q14), forming PAX3 / 7-FOXO1, PAX3-NCOA1 / 2 and PAX3-FOXO4 fusion genes. Studies have confirmed that the occurrence and development of ARMS are closely related to PAX3-FOXO1 fusion gene and its protein product. These unique biomacromolecules block the cell cycle, inhibit cell muscle differentiation, increase cell proliferation, invasion and migration ability, enhance the expression of downstream target genes and specific miRNAs, and promote the occurrence and development of ARMS. Therefore, clarifying the molecular mechanism of fusion gene formation is a key problem that needs to be solved at present.

[0003] FOXO1 (Forkhead Box O1) is a core member of the FOXO transcription factor family, which also plays a key role in regulating biological processes such as apoptosis, metabolism, oxidative stress response and cell cycle. In tumors, phosphorylation of AKT / PKB often leads to nuclear export of FOXO1, ubiquitination of FOXO1 promoted by SKP2 and thus promotes tumor progression; SIRIT1 deacetylation activates FOXO1, which is also related to life extension. At present, small molecule inhibitors targeting FOXO1 are being studied for diabetes, lung cancer and osteoarthritis, and FOXO1 protein has become a potential target for anti-aging product development. However, in alveolar rhabdomyosarcoma, there is no report on early diagnosis and treatment strategies targeting FOXO1 gene.

[0004] R-loops are three-stranded nucleic acid structures consisting of RNA-DNA hybrids and free DNA single strands. circR-loop is a special circular R-loop structure formed when circRNA base pairs replace single-stranded DNA (ssDNA) at its homologous genomic DNA site. Exposed single-stranded DNA is a site of genomic instability and prone to mutation, which can manifest as double-stranded DNA breakage caused by base excision repair and can be involved in the formation of fusion genes.

[0005] At present, the effect of circR-loop on chromosome structure stability and the formation of alveolar rhabdomyosarcoma driving gene PAX3-FOXO1 has not been confirmed, so screening circFOXO1 R-loops in alveolar rhabdomyosarcoma and exploring their effect on parent gene FOXO1 are conducive to early diagnosis and treatment of alveolar rhabdomyosarcoma.

[0006] In view of this, the present application is proposed. SUMMARY

[0007] In order to make up for the shortcomings of the prior art, the purpose of the present application is to provide a molecular marker of alveolar rhabdomyosarcoma, which can be used as a biomarker for diagnosis and / or prevention and treatment of alveolar rhabdomyosarcoma.

[0008] In a first aspect of the present application, a molecular marker of alveolar rhabdomyosarcoma is provided, and the molecular marker is circFOXO1 R-loop site, and the DNA-RNA hybridization region thereof is located at chr13:41133915-41134263 of human genome (hg19).

[0009] Specifically, the circFOXO1 R-loop site is cross-analyzed by CUT&Tag, circRNA sequencing data, and compared with the chromosome sequence, so as to determine that the specific sequence position is chr13:41133915-41134263, and the length is about 349bp.

[0010] Specifically, the molecular marker is formed by hybridization of circFOXO1 (has_circ_0030042) and FOXO1 gene.

[0011] Preferably, the detection of the circFOXO1 R-loop site is performed by designing primers of SEQ ID NO:1 and SEQ ID NO:2 by referring to the FOXO1 gene sequence of human genome hg19, and by any one of the following methods a)-b):

[0012] a) CUT&Tag combined with RNase R enzyme digestion, using S9.6 antibody binding purification, and then using primer set SEQ ID NO: 1 and SEQ ID NO: 2 for detection.

[0013] Specifically, circFOXO1 R-loop sites are identified by CUT&TAG-qPCR. On the basis of the original experiment, the newly added restriction exonuclease RNase R treatment in the pre-antibody S9.6 overnight incubation before cell lysis is used to degrade linear R-loop, so as to directly immunoprecipitate circR-loop.

[0014] b) DRIP combined with RNase R enzyme digestion, using S9.6 antibody binding purification, and then using primer set SEQ ID NO: 1 and SEQ ID NO: 2 for detection.

[0015] Specifically, circFOXO1 R-loop sites are identified by DRIP-qPCR. On the basis of the original experiment, the newly added restriction exonuclease RNase R treatment before the pre-antibody S9.6 overnight incubation after cell lysis is used to degrade linear R-loop, so as to directly immunoprecipitate circR-loop.

[0016] The second aspect of the present application provides a primer set for detecting the molecular marker of the alveolar rhabdomyosarcoma described above, and the sequence of the primer set is shown as SEQ ID NO: 1 and SEQ ID NO: 2.

[0017] The third aspect of the present application provides a primer set for specifically detecting circFOXO1 (has_circ_0030042), which is used for amplifying circFOXO1 junction, and the sequence of the primer set is shown as SEQ ID NO: 3 and SEQ ID NO: 4.

[0018] The fourth aspect of the present application provides a probe for specifically detecting circFOXO1 (has_circ_0030042), which is used for RNAFISH labeling circFOXO. By designing a biotin indicator probe carrying Cy3, the distribution of circFOXO1 (has_circ_0030042) in cells is detected, and the sequence of the probe is shown as SEQ ID NO: 5.

[0019] The fifth aspect of the present application provides the application of the molecular marker of the alveolar rhabdomyosarcoma described above, and the application of the molecular marker in preparing a product for diagnosing and / or preventing and treating alveolar rhabdomyosarcoma.

[0020] Preferably, the molecular marker is used for preparing a product related to DNA damage and RNA polymerase II regulation in alveolar rhabdomyosarcoma.

[0021] Preferably, the product is a reagent or kit for diagnosing alveolar rhabdomyosarcoma.

[0022] Preferably, the product is a drug for preventing and / or treating alveolar rhabdomyosarcoma; more preferably, the drug is siRNA, vector, biological inhibitor, etc.

[0023] Specifically, the drug works by the following mechanisms:

[0024] a) inhibiting the circularization of circFOXO1 (such as siRNA targeting the reverse splicing site);

[0025] b) degrading the circR-loop structure (such as RNase H1 overexpression vector);

[0026] c) blocking the circR-loop mediated DNA damage (such as biological inhibitor).

[0027] In a sixth aspect of the present application, a kit for diagnosing alveolar rhabdomyosarcoma is provided, comprising a primer set for detecting the molecular marker of alveolar rhabdomyosarcoma described above, and the sequence of the primer set is shown in SEQ ID NO: 1 and SEQ ID NO: 2.

[0028] Specifically, the kit further comprises positive control, negative control, reagent, etc.

[0029] In a seventh aspect of the present application, a drug screening system is provided, comprising: an ARMS cell line stably expressing circFOXO1, a primer set for detecting the molecular marker of alveolar rhabdomyosarcoma, a γH2AX detection kit, and a reagent for evaluating the effect of a candidate compound on the level of R-loop.

[0030] In an eighth aspect of the present application, the application of the above-mentioned molecular marker of alveolar rhabdomyosarcoma is provided, and the molecular marker is used for screening a drug for preventing and / or treating alveolar rhabdomyosarcoma.

[0031] In a ninth aspect of the present application, a method for detecting the circFOXO1 R-loop site for non-diagnostic purposes is provided, comprising the following steps:

[0032] In the CUT&Tag or DRIP experiment, the sample is treated with RNase R to degrade linear RNA for the purpose of directly detecting circR-loop;

[0033] qPCR quantification is performed using the above primer set for detecting the molecular marker of alveolar rhabdomyosarcoma;

[0034] The DNA damage function of circFOXO1 R-loop is verified by comet assay and gamma H2AX immunofluorescence;

[0035] The stalling of RNA polymerase II at the FOXO1 gene site is detected by ChIP-qPCR.

[0036] In the present application, the circFOXO1 R-loop mainly causes DNA damage through comet assay, immunofluorescence, western blot marking DNA damage marker gamma H2Ax, and ChIP-qPCR to determine the damage site of the parent gene FOXO1. The FOXO1 damage site is detected by designing primers for the Exon1, Intron1, Exon2, Intron2, and Exon3 regions of the FOXO1 gene. The Intron1 sequence is relatively long, and four pairs of primers are designed. The specific sequences are shown in Table 6.

[0037] Preferably, the sample types include tumor tissue biopsy samples, peripheral blood circulating tumor DNA / RNA, primary cultured ARMS cells, and the like.

[0038] The present application has at least the following beneficial effects:

[0039] The present application finds a target point related to the formation of the alveolar rhabdomyosarcoma FOXO1 fusion gene: the R-loop site where circFOXO1 (has_circ_0030042) hybridizes with FOXO1. In the present application, CUT&TAG-seq and circRNA sequencing find that circFOXO1 R-loop exists in alveolar rhabdomyosarcoma cells, and further find that this structure can promote FOXO1 gene breakage and RNA pol II stalling. It has important clinical application value for developing reagents or kits for diagnosing alveolar rhabdomyosarcoma, and preventing and / or treating alveolar rhabdomyosarcoma. BRIEF DESCRIPTION OF DRAWINGS

[0040] In order to more clearly illustrate the specific embodiments of the present application or the technical solutions in the prior art, the drawings needed in the specific embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are some embodiments of the present application, and those skilled in the art can obtain other drawings according to these drawings without creative labor.

[0041] Figure 1Gene distribution and chromosomal localization map of 29457 R-loops in alveolar rhabdomyosarcoma cells detected by CUT&TAG-seq; Wherein, A is the length distribution map of CUT&TAG products; B is the distribution pie chart of different gene regions of 29457 R-loop peaks in RH30 cells; C is the read distribution map of CUT&TAG products in gene start region (TSS) and end region (TES); D is the gene distribution map of 29457 R-loop peaks in 23 chromosomes.

[0042] Figure 2 13067 circRNAs in alveolar rhabdomyosarcoma cells detected by circRNA sequencing; Wherein, A represents the circos plot of circRNA distribution in the genome range in RH30 and RD, the outermost track represents different chromosomes, and the inner track shows the expression level of circRNA (red / blue), wherein red represents circRNA highly expressed in embryonic rhabdomyosarcoma, and blue represents circRNA lowly expressed in embryonic rhabdomyosarcoma; B shows the metagene plot of circRNA in the genomic region of RH30 cells; C is a heat map of the relative expression level of circRNA in different genomic regions in RH30 samples; D shows the gene location map of circRNA in 23 chromosomes.

[0043] Figure 3 Determine circFOXO1 R-loop sites by cross analysis of CUT&TAG and circRNA sequencing; Wherein, A shows the signal distribution map of R-loop in the FOXO1 gene region (chr13:41,129,804-41,240,778), and the relevant regions of R-loop are marked in the figure; B is the RT-PCR result of circFOXO1 (has_circ_030042) (left) and circFOXO1 (has_circ_0000476) (right), which verifies the existence of circFOXO1 in alveolar rhabdomyosarcoma cells; C is a circFOXO1 R-loop diagram, wherein the gene location of circFOXO1 (has_circ0030042) is marked.

[0044] Figure 4Identification and circularization and stability of circFOXOl; Wherein, A is the circFOXOl RT-PCR and Sanger sequencing map, and the yellow arrow is the junction site of circFOXOl; B is the FISH result map of circFOXOl, and 18S rRNA is the cytoplasmic control; C is the cytoplasmic and nuclear separation experiment, which shows that circFOXOl is mainly located in the cytoplasm and a small part is located in the nucleus of RH30 cells; D is the actinomycin D treatment of RH30 cell RNA, and the expression of circFOXOl is more stable than that of FOXOl mRNA; E shows that circFOXOl still maintains high expression after RNase R treatment, indicating that circFOXOl has a circular structure.

[0045] Figure 5 One-step RT-PCR to amplify the expression of circFOXOl in ARMS paraffin tissues. RNase R enzyme is used to digest linear RNA molecules, and the amplification product is subjected to Sanger sequencing to identify that the product contains the junction site of circFOXOl.

[0046] Figure 6 CUT&Tag-qPCR and DRIP-qPCR to identify the formation of circR-loops near FOXOl; Wherein, A is the schematic diagram of R-loop and circR-loop structure and the degradation of R-loop and circR-loop after RNase H and RNase R digestion; B is the DRIP-qPCR result statistical chart; Figure C is the CUT&Tag-qPCR result statistical chart.

[0047] Figure 7 circFOXOl promotes the formation of R-loops; Wherein, A is the successful construction of embryonal rhabdomyosarcoma (RD) cells overexpressing circFOXOl; B is the successful overexpression of circFOXOl in human embryonic kidney (HEK293T) cells; C is that overexpression of circFOXOl promotes the formation of R-loops in RD cells, and the structure is more stable; D is that overexpression of circFOXOl promotes the formation of R-loops in 293T cells, and the structure is more stable.

[0048] Figure 8 circFOXOl R-loop promotes the binding of RNA pol II and FOXOl Exon2, Intron 1 fragments, and the position is consistent with the circFOXOl R-loop site.

[0049] Figure 9To promote the occurrence of FOXOl gene damage and breakage of circFOXOl R-loop; wherein, A is a comet experiment showing that the overexpression of circFOXOl cells has a higher frequency of DSB; B is an immunofluorescence detection of the overexpression of circFOXOl cells, which shows that the expression of DSB marker γH2Ax protein is increased; C shows that the western blot detection of the overexpression of circFOXOl shows that the expression of γH2Ax protein is increased; D is ChIP-qPCR detection of circFOXOl R-loop, which can promote the occurrence of DNA damage in the front part of the first intron and the second intron of FOXOl gene. DETAILED DESCRIPTION

[0050] It should be noted that the following detailed description is illustrative only and is intended to provide further description of the present application. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the present application pertains.

[0051] It should be noted that the terms used herein are only intended to describe specific embodiments, and are not intended to limit the exemplary embodiments according to the present application. As used herein, the singular form also includes the plural form unless the context clearly indicates otherwise, and furthermore, it should be understood that when the terms "comprise" and / or "include" are used in the specification, there is a feature, step, operation, device, component and / or combination thereof.

[0052] The technical solutions of the present application will be described below in conjunction with the embodiments. Obviously, the described embodiments are part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative labor are within the scope of protection of the present application.

[0053] Example 1: Screening of R-loops at 29457 in alveolar rhabdomyosarcoma cells using CUT&Tag-seq technology

[0054] Given the important role of circR-loop in regulating genome stability and participating in transcription, this study investigated the potential mechanism by which circFOXO1 R-loop may be involved in the formation of FOXO1 fusion genes (PAX3 / 7-FOXO1, etc.) in alveolar rhabdomyosarcoma and screened circFOXO1 R-loop sites. To this end, this study first analyzed R-loops formed in alveolar rhabdomyosarcoma cells (RH30) using CUT&Tag combined with high-throughput sequencing. Utilizing the specific binding property of the S9.6 antibody to the DNA:RNA hybrid strand in the R-loop structure, fragments forming R-loops throughout the RH30 cell genome were immunoprecipitated using CUT&Tag experiments. DNA fragments from the RNA:DNA hybrid strand were extracted, library constructed, and sequenced. The extracted DNA fragments were mainly 0–400 bp in length. Figure 1 Sequencing revealed that 47.18% of the regions in RH30 cells that form R-loops were located in gene promoter regions, 32.31% in gene coding regions, and 20.51% in intergenic regions. Figure 1 (B) ; A heatmap of gene regions forming R-loops was created, revealing that they are mainly distributed in the transcription start site (TSS) (B). Figure 1 (C in the text); A total of 16,732 genes were detected in RH30 cells, forming 29,457 R-loops. These genes are distributed on all 23 human chromosomes. Figure 1 (D in the middle).

[0055] Example 2: Sequencing detected 13,067 circRNAs in alveolar rhabdomyosarcoma cells.

[0056] Based on the screening of R-loop sites in alveolar rhabdomyosarcoma cells in Example 1 above, this example further sequenced circRNA in alveolar rhabdomyosarcoma cells. Total RNA was extracted from RH30 cells and embryonic rhabdomyosarcoma cells (RD, PAX3-FOXO1 negative) using the Trizol method. After the samples passed quality control, linear RNA was first removed by RNase R digestion, and then the KAPA RNA HyperPrep Kit with RiboErase (HMR) was used for... The library construction kit was used to construct the library. The designed DNA probes were hybridized to the RNA sample to remove rRNA from the RNA. The RNA was then fragmented to synthesize the first strand of cDNA. A strand-specific method was used to incorporate dUTPs for labeling during the synthesis of the second strand of cDNA, and end repair was also performed at this step. Next, A-tailing, adapter ligation, purification of the ligation product, fragment size sorting, and library amplification were performed. After amplification, the circRNA-Seq library was purified and recovered using magnetic beads. After library construction, preliminary quantification was performed using Qubit 3.0, followed by detection of the library size range using an Agilent 2100 Bioanalyzer. Once the inserted target fragment size met expectations, the effective concentration of the library was accurately quantified using q-PCR (effective concentration > 3 nM) to ensure library quality. Backsplice junction reads were calculated using CIRCexplorer2 to quantify circRNA expression.

[0057] A total of 13,067 circRNAs were detected in RH30 cells and 21,048 circRNAs were detected in RD cells. Differential analysis of circRNAs between the two groups revealed 2,014 upregulated circRNAs and 1,983 downregulated circRNAs. Figure 2 In RH30, circRNAs are mainly distributed in the gene region between the TSS and the transcription end site (TES). Figure 2 (B in the text); A heatmap of the relative expression levels of circRNAs in different gene regions of RH30 cells showed that the expression level of circRNAs formed in the TSS region was higher (B in the text). Figure 2 (C in the text); circRNAs in RH30 cells are scattered across 23 chromosomes ( Figure 2 (D in the middle).

[0058] Example 3: Cross-analysis of CUT & Tag and circRNA sequencing revealed the formation of one circFOXO1 site near the FOXO1 gene in alveolar rhabdomyosarcoma cells.

[0059] Based on the above, the R-loop structure is enriched in alveolar rhabdomyosarcoma cells and contains 13067 circRNAs, which have been explored in Example 1 and Example 2. This embodiment further explores the potential circR-loops related to the FOXO1 gene in alveolar rhabdomyosarcoma cells. First, the R-loop formed near the FOXO1 gene in the CUT&Tag data was analyzed, and the R-loop signal in the CUT&Tag sequencing was visualized by the Integrative Genomics Viewer. As shown in Table 1, three significant R-loop peaks were observed near the FOXO1 gene (A) in Example 1; further analysis of circFOXO1 screened from RH30 circRNA sequencing was performed, as shown in Table 2, two circFOXO1 variants were detected, one of which was a full exon type circFOXO1 (has_circ_0030042), and the other was a full intron type circFOXO1 (has_circ_00000476). The primers for the junction sites of the two circFOXO1 were designed (see Table 3), and the existence of the two circFOXO1 was verified in RH30 cells by one-step RT-PCR (B) in Example 2. Figure 3 Figure 3

[0060] Table 1 R-loop information table near FOXO1 gene

[0061] R-loops position Length Gene feature Fold change log10(pvalue) chr13:41133915-41134263 349 gene_body 4.77863 2.37145 chr13:41136794-41137791 998 gene_body 7.18604 2.75082 chr13:41240791-41241165 375 gene_body 6.77343 3.46466

[0062] Table 2 circRNA information table related to FOXO1 gene

[0063] circRNA position circbaseID Region Splice length chr13_41133645_41134997 hsa_circ_0030042 Exon2 1352 chr13_41207283_41219635 hsa_circ_0000476 Intron1 12352

[0064] Table 3 circFOXO1 PCR primer sequence table

[0065]

[0066] The sequence position of the R-loop near FOXO1 was compared with the sequence position of circFOXO1, and one possible circFOXO1 R-loop region near FOXO1 gene was screened, i.e. chr13:41133915-41134263, with a length of 349 bp, and the sequence is:

[0067] ​​GCTCTCACAGCAATGATGACTTTGATAACTGGAGTACATTTCGCCCTCGAACTAGCTCAAATGCTAGTACTATTAGTGGGAGACTCTCACCCATTATGACCGAACAGGATGATCTTGGAGAAGGGGATGTGCATTCTATGGTGTACCCGCCATCTGCCGCAAAGATGGCCTCTACTTTACCCAGTCTGTCTGAGATAAGCAATCCCGAAAACATGGAAAATCTTTTGGATAATCTCAACCTTCTCTCATCACCAACATCATTAACTGTTTCGACCCAGTCCTCACCTGGCACCATGATGCAGCAGACGCCGTGCTACTCGTTTGCGCCACCAAACACCAGTTTGAATTC (SEQ ID NO: 8).

[0068] Example 4 Successful verification of circFOXO1 R-loop in alveolar rhabdomyosarcoma cells

[0069] The circFOXO1 R-loop site has been screened in Example 3 above, and the circFOXO1 that hybridizes with FOXO1 to form a circR-loop is has_circ_0030042 (C in Figure 3 Figure 4 The total RNA of RH30 cells was extracted by Trizol method, and has_circ_0030042 of human genome hg19 was amplified by one-step RT-PCR, and the product was sequenced by Sanger method, and the junction site of circFOXO1 (A in Figure 4 Figure 4 The probe was designed according to the junction site of circFOXO1 (see Table 4), and RNA FISH was performed to detect the distribution of the circRNA in RH30 cells, and 18s rRNA was used as a cytoplasmic positive control, and the results showed that circFOXO1 was mainly distributed in the cytoplasm, and a small part was distributed in the nucleus (B in Figure 4

[0070] Table 4 RNA FISH probe sequence information table

[0071]

[0072] The nuclear and cytoplasmic proteins of RH30 cells were separated using the Beyotime nuclear protein and cytoplasmic protein extraction kit (P0027). α-tublin and actin were used as positive controls for the cytoplasm, and LaminB and U6 were used as positive controls for the nucleus. This further confirmed that circFOXO1 is mainly distributed in the cytoplasm, with a small portion distributed in the nucleus. Figure 4 (C) Further experiments were conducted to investigate the circular structure and stability of circFOXO1. RH30 cells were treated with actinomycin D, and RNA was extracted at 4h, 8h, 12h, and 24h. qPCR amplification of circFOXO1 and FOXO1 was performed to detect their expression. The results showed that circFOXO1 was less prone to degradation and its expression was more stable than that of FOXO1. Figure 4 (D in the original text); After degrading linear RNA with the restriction exonuclease RNase R, qPCR was performed, successfully verifying the circular structure of circFOXO1. Figure 4 (E in the text)

[0073] Four ARMS tissue samples were selected, and RNA was extracted from paraffin-embedded tissues and subjected to RT-PCR to detect the expression of circPAX3 and circFOXO1 in ARMS tissues. Linear RNA molecules were removed by RNase R digestion. The results showed that circFOXO1 was successfully amplified in all four ARMS tissue samples. Sanger sequencing revealed the junction sites of circFOXO1, with R34 and R35 still showing detectable expression of circFOXO1 after RNase R treatment. Figure 5 ).

[0074] R-loops and circR-loops have natural structural differences. The restriction endonuclease RNase H can specifically degrade the DNA:RNA hybrid chain, while RNase R degrades only R-loops by degrading linear RNA and has no effect on circR-loops. Figure 6 In step A), DRIP and CUT&Tag experiments were performed. Both techniques involved immunoprecipitation of the DNA:RNA hybrid strands with S9.6 antibody, followed by extraction of single-stranded DNA from the hybrid strands. RNase H and RNase R were added during the experiments. Primers for the relevant FOXO1 gene were designed based on the circFOXO1 R-loop sequence (see Table 5). qPCR was performed on the DRIP and CUT&Tag products, successfully confirming that this region of the FOXO1 gene can form circR-loops. Figure 6 (BC in the middle).

[0075] Table 5. FOXO1 R-loop PCR Primer Sequence List

[0076]

[0077] To explore the potential mechanism of circFOXOl R-loop on FOXOl fusion gene formation, circFOXOl overexpression lentivirus plasmid and empty control plasmid were constructed. The circular plasmid carries an RFP tag, and the overexpression plasmid contains a circFOXOl junction site, and the full-length sequence is:

[0078]

[0079] Lentiviral plasmids were transfected into PAX3-FOXO1 fusion gene-negative RD cells and human embryonic kidney 293T cells, respectively. 72 hours after transfection, the transfection efficiency of the circFOXO1-overexpressing lentivirus was observed to be over 95% under a fluorescence microscope. qPCR was used to detect circFOXO1 expression in the overexpression group and the control group. The results showed that RD cells overexpressing circFOXO1 were successfully constructed. Figure 7 A) and 293T cells overexpressing circFOXO1 ( Figure 7 (B) Genomic DNA was extracted from the above four cell lines, and dot blot experiments were performed using S9.6 antibody to detect the effect of circFOXO1 overexpression on intracellular R-loop formation. The results showed that circFOXO1 significantly promoted the formation of R-loop structures in RD cells and 293T cells. Since high salt can destroy RNA-DNA hybridization structures and accelerate their dissociation, different concentrations of NaCl treatment groups were added in this experiment. The results showed that circFOXO1 overexpression increased the stability of R-loop structures. Figure 7 (CD in the middle).

[0080] Example 5: circFOXO1 R-loop promotes RNA polymerase arrest and DSB formation in alveolar rhabdomyosarcoma cells.

[0081] To determine the role of the circFOXO1 R-loop in gene transcription and genome stability, this embodiment conducted a series of experiments in overexpression cell lines to investigate its effects on RNA polymerase II (RNAPol II) and DSB.

[0082] In cell lines overexpressing circFOXO1, ChIP experiments were performed using an RNA Pol II-specific antibody to pull down DNA fragments that bind to RNA Pol II. Primers were designed near exon1, intron1, exon2, and exon3 of the FOXO1 gene, based on the location of the circFOXO1 R-loop (Exon2) (see Table 6), and the DNA products obtained from ChIP were amplified by qPCR. The results showed that in the 293T and RD cell lines, circFOXO1 promoted the binding of RNA Pol II to FOXO1 intron1 and exon2, with the highest binding concentration in the circFOXO1 R-loop region. Figure 8 ).

[0083] Table 6. PCR primer sequence list for different regions of the FOXO1 gene.

[0084]

[0085] Comet assay is commonly used to detect single cell DNA damage, especially DNA double-strand break (DSB), and the degree of DNA damage can be evaluated by observing the migration of DNA fragments in the nucleus. Comet assay was performed on RD and 293T cells overexpressing circFOXOl, and the results showed that most cells in the overexpression group exhibited obvious comet tails, and the tails were long, indicating that circFOXOl promoted the occurrence of DSB in cells (A in FIG. 6); Figure 9 γH2AX (phosphorylated H2AX, a marker molecule for DSB occurrence to study DNA damage, repair and genome stability) DSBS occurrence, subsequent experiments were performed by labeling γH2AX to detect the effect of circFOXOl on DNA breakage. Cell immunofluorescence experiments showed that the expression of γH2AX in the nucleus of cells overexpressing circFOXOl was significantly increased, indicating that the DNA damage was more (B in FIG. 6); Figure 9 Western Blot to detect the expression of γH2AX in the two groups of cells, the results showed that the expression of γH2AX protein in the cells overexpressing circFOXOl was significantly higher than that in the control group (C in FIG. 6); Figure 9 Based on the fact that γH2AX can mark the location of DNA breakage, Chip experiments were performed using the antibody of this protein to explore the effect of circFOXOl R-loop on DSB occurrence. The DNA fragments combined with γH2AX were pulled down, and qRT-PCR was performed to amplify the DNA products obtained by Chip experiment on different introns, exons and circR-loop regions of FOXOl gene. The results showed that circFOXOl overexpression promoted the combination of γH2AX near intron 1, intron 2 and exon 3 of FOXOl, and DNA damage was mainly distributed before and after circFOXOl R-loop (D in FIG. 6). Figure 9

[0086] ​In summary, the present application provides the site of circFOXO1 R-loop in alveolar rhabdomyosarcoma and its influence on RNAPol II and DSB. A reagent or kit for diagnosing alveolar rhabdomyosarcoma can be prepared for the site, and a drug for preventing and / or treating alveolar rhabdomyosarcoma, such as siRNA targeting reverse splicing site, can inhibit the circularization of circFOXO1, RNase H1 overexpression vector can degrade circR-loop structure, and biological inhibitors can block circR-loop mediated DNA damage. In addition, a drug screening system can also be constructed for the site, including: ARMS cell line stably expressing circFOXO1, primer set for detecting molecular markers of alveolar rhabdomyosarcoma, gamma H2AX detection kit, reagent for evaluating the influence of candidate compounds on R-loop level, etc., which has important clinical application value.

[0087] Finally, it should be noted that: the above embodiments are only used to illustrate the technical solutions of the present application, and not to limit them; although the present application has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that: it can still modify the technical solutions recorded in the foregoing embodiments, or make equivalent replacement for part or all of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the scope of the technical solutions of the embodiments of the present application.

Claims

1. A three-stranded nucleic acid structure associated with alveolar rhabdomyosarcoma, characterized in that, The triple-stranded nucleic acid structure is circFOXO1 R-loop, which is formed by the hybridization of circular RNA circFOXO1 (has_circ_0030042) with its homologous FOXO1 gene. Its DNA-RNA hybridization region is located at chr13:41133915-41134263 of the human genome hg19, and a triple-stranded nucleic acid structure containing DNA-RNA hybrid strands and free single-stranded DNA is formed in this region. The specific sequence is shown in SEQ ID NO:

8.

2. The three-stranded nucleic acid structure associated with alveolar rhabdomyosarcoma according to claim 1, characterized in that, The circFOXO1 originates from the second exon region of the FOXO1 gene and forms a stable circular RNA molecule through back splicing.

3. The three-stranded nucleic acid structure associated with alveolar rhabdomyosarcoma according to claim 1, characterized in that, The circFOXO1 R-loop can cause RNA polymerase II to stop in the region corresponding to the FOXO1 gene and induce DNA double-strand breaks; the DNA double-strand breaks promote or participate in chromosomal rearrangement between the FOXO1 gene and the PAX3 gene, thereby forming the PAX3-FOXO1 fusion gene.

4. The application of the three-stranded nucleic acid structure related to alveolar rhabdomyosarcoma as described in any one of claims 1-3, characterized in that, The application of the triplet nucleic acid structure in the preparation of products for evaluating, predicting or studying the mechanism of PAX3-FOXO1 fusion in alveolar rhabdomyosarcoma.

5. The application according to claim 4, characterized in that, The product is a reagent or kit.

6. A method for detecting circFOXO1 R-loop for non-diagnostic purposes, characterized in that, Includes the following steps: In CUT&Tag or DRIP experiments, samples are treated with RNase R to degrade linear RNA and the DNA-RNA hybrid structure formed by linear RNA, so as to directly detect circR-loop. DNA-RNA hybrid structures were enriched using S9.6 antibody; qPCR quantification was performed using a primer set; the sequences of the primer set are shown in SEQ ID NO:1 and SEQ ID NO:

2. The DNA-damaging function of circFOXO1 R-loop was verified by comet assay and γH2AX immunofluorescence. The arrest of RNA polymerase II at the FOXO1 gene site was detected by ChIP-qPCR.

Images