Use of an agent that inhibits tcf19 in the manufacture of a medicament for treating lung adenocarcinoma

Abstract

The application provides application of an agent for inhibiting TCF19 in preparation of a drug for treating lung adenocarcinoma, and belongs to the technical field of biological medicine. The application research finds that TCF19 is significantly highly expressed in lung adenocarcinoma tissues; knocking down TCF19 can inhibit lung adenocarcinoma proliferation and can enhance the chemotherapeutic effect of 5-fluorouracil; meanwhile, it is found that the upstream regulatory factor of TCF19 which is regulated and expressed to be increased by lung adenocarcinoma is BRD4, and when BRD4 is knocked down, the mRNA level of TCF19 is obviously reduced, and the protein level is also obviously reduced. TCF19 can be used as a therapeutic target of lung adenocarcinoma, and the agent for inhibiting TCF19 is used for preparing the drug for treating lung adenocarcinoma, and has very high application prospect and medical value.

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, and in particular relates to the application of reagents that inhibit TCF19 in the preparation of drugs for treating lung adenocarcinoma. Background Technology

[0002] Currently, treatment for LUAD primarily relies on targeted therapies targeting known targets such as EGFR, ALK, and ROS1. However, these targets only cover a portion of the patient population, and drug resistance is a common problem, making it difficult to sustain treatment effects. Meanwhile, while traditional chemotherapy drugs can kill tumor cells, they have serious toxic side effects and can lead to tumor cell resistance, significantly limiting their clinical application. Furthermore, immune checkpoint inhibitors have shown some efficacy in LUAD treatment, but only in a subset of patients and may trigger immune-related adverse reactions. Therefore, existing treatment methods still cannot meet the clinical needs of NSCLC patients, and there is an urgent need to find new potential tumor therapeutic targets.

[0003] In-depth research into the molecular mechanisms of LUAD development and progression has revealed numerous signaling pathways and biomolecules involved in tumor cell proliferation, invasion, metastasis, and drug resistance. Exploring new potential therapeutic targets for LUAD can not only expand the range of targets for LUAD treatment, providing more patients with precision treatment options, but also effectively overcome drug resistance issues with existing treatments by developing specific drugs or combination therapy strategies targeting new targets, achieving chemotherapy sensitization and improving treatment efficacy. Therefore, further exploration of new targets for LUAD has significant theoretical and clinical value for breaking through current treatment bottlenecks and improving patient prognosis, and is a key direction for conquering LUAD. Summary of the Invention

[0004] In view of this, the object of the present invention is to provide the use of a reagent that inhibits TCF19 in the preparation of a medicament for treating lung adenocarcinoma.

[0005] This invention provides the application of a reagent for detecting TCF19 in the preparation of a reagent for the auxiliary diagnosis of lung adenocarcinoma, wherein TCF19 is significantly highly expressed in lung adenocarcinoma tissue.

[0006] This invention provides the use of substances that inhibit TCF19 in the preparation of drugs for treating lung adenocarcinoma.

[0007] Preferably, the substance that inhibits TCF19 includes BET family inhibitors.

[0008] Preferably, the BET family inhibitor is JQ1.

[0009] Preferably, the substance that inhibits TCF19 includes TCF19 shRNA.

[0010] Preferably, the sense strand of the shRNA is shown in SEQ ID NO.1, and the antisense strand of the shRNA is shown in SEQ ID NO.2.

[0011] Preferably, the substance that inhibits TCF19 includes shRNA of BRD4, the sequence of which is shown in SEQ ID NO.3.

[0012] Preferably, the substance that inhibits TCF19 includes a reagent that overexpresses BRD4-BD1.

[0013] This invention provides the application of a substance that inhibits TCF19 in the preparation of a reagent that inhibits the proliferation of lung adenocarcinoma cells, wherein the lung adenocarcinoma cells include lung adenocarcinoma cell lines A549 or H1299.

[0014] This invention provides the use of substances that inhibit TCF19 in the preparation of 5-fluorouracil chemosensitizers.

[0015] Compared with existing technologies, this invention has the following beneficial effects: This invention found that TCF19 is significantly highly expressed in lung adenocarcinoma tissues; knocking down TCF19 can inhibit lung adenocarcinoma proliferation and enhance the chemotherapeutic effect of 5-fluorouracil; simultaneously, it was found that the upstream regulatory factor for TCF19's increased expression in lung adenocarcinoma is BRD4, and knocking down BRD4 significantly reduces both the mRNA and protein levels of TCF19. TCF19 can serve as a therapeutic target for lung adenocarcinoma, and reagents that inhibit TCF19 can be used to prepare drugs for treating lung adenocarcinoma, demonstrating very high application prospects and medical value. Attached Figure Description

[0016] Figure 1This paper presents the expression of TCF19 in lung adenocarcinoma. A shows the results of an analysis of 483 lung adenocarcinoma tissues and 347 normal lung tissues from the TCGA database, revealing high TCF19 expression in tumor tissues. B shows the protein expression in tumor tissues and adjacent normal tissues of lung adenocarcinoma patients detected by Western blotting; compared to adjacent normal tissues, TCF19 protein expression was higher in tumor tissues. C shows that quantitative protein analysis revealed elevated TCF19 protein expression levels in tumor tissues. D shows the mRNA expression levels in tumor tissues and adjacent normal tissues of lung adenocarcinoma patients detected by qPCR; the results indicate that TCF19 mRNA expression in tumor tissues is significantly higher than in adjacent normal tissues. E shows the expression level of TCF19 protein in lung tissue of an induced mouse lung cancer model and normal lung tissue detected by Western blotting, revealing that TCF19 protein was significantly highly expressed in tumor tissue; F shows that quantitative protein analysis showed that the expression level of TCF19 protein was elevated in tumor tissue; G shows the mRNA expression level of TCF19 in lung tissue of an induced mouse lung cancer model and normal lung tissue detected by qPCR, revealing that the mRNA expression of TCF19 was significantly elevated in tumor tissue; H shows the results of immunohistochemistry staining of tumor tissue and adjacent normal tissue of clinical lung adenocarcinoma patients, showing that TCF19 stained more deeply in tumor tissue compared to adjacent normal tissue.

[0017] Figure 2 To construct a stable TCF19 overexpression cell line and assess the effect of si-TCF19; A shows the overexpression of TCF19 in the H1299 lung adenocarcinoma cell line detected by Western blotting; B shows the overexpression of TCF19 in the A549 lung adenocarcinoma cell line detected by Western blotting; Flag-vector cells are cells overexpressing the empty viral vector; OV-flag-TCF19 cells are cells overexpressing TCF19; C shows the TCF19 knockdown in the H1299 lung adenocarcinoma cell line detected by Western blotting; D shows the TCF19 knockdown in the A549 lung adenocarcinoma cell line detected by Western blotting.

[0018] Figure 3 High TCF19 expression was found in clinical case tissue analysis, indicating a poor prognosis. A shows the analysis of existing lung adenocarcinoma data from the TCGA database, combining TCF19 expression intensity with patient survival time. B shows the results of TCF19 immunohistochemical staining of tumor tissue from lung adenocarcinoma patients. C shows the results of a combined analysis of the area and intensity of the stained granules with patient survival time, revealing that patients with high TCF19 expression have a poor prognosis.

[0019] Figure 4TCF19 overexpression promotes tumor cell proliferation, while TCF19 knockdown inhibits cell proliferation. A shows the results of cell proliferation detection using the CCK8 assay: cells overexpressing TCF19 proliferated faster than cells overexpressing the empty vector; cells with TCF19 knockdown proliferated slower. B shows cell cycle analysis: compared to cells overexpressing the empty vector, cells overexpressing TCF19 showed a decrease in the G0 / G1 phase and an increase in the S phase. C shows colony formation experiments using OV-flag-vector, OV-flag-TCF19, and Sh-TCF19 cells, respectively. Compared to the empty vector overexpression group, TCF19 overexpression increased the number of cell colonies formed; TCF19 knockdown decreased the number of cell colonies formed. D shows cell proliferation detection using the EDU assay: cells overexpressing TCF19 proliferated faster; TCF19 knockdown slowed down cell proliferation. E shows that, through subcutaneous tumor-bearing experiments in nude mice, tumors formed by tumor cells overexpressing TCF19 were significantly larger than those formed by cells overexpressing empty vectors. F shows that, according to immunohistochemical staining results, the expression levels of cell proliferation markers KI67 and PCNA proteins in tumors formed by OV-flag-TCF19 cells were higher than those in tumors formed by OV-flag-vector cells.

[0020] Figure 5BRD4 is a direct upstream factor regulating TCF19 transcription. A shows that, using RNA-seq sequencing, TCF19 was significantly upregulated in cells overexpressing BRD4 after detecting cells overexpressing the empty vector and those overexpressing BRD4. B shows that, using RNA-seq sequencing, TCF19 was significantly downregulated in the JQ1-treated group compared to the untreated group. C shows that after treatment with 1 μM of the BET family inhibitor JQ1 for 0 h, 12 h, 24 h, and 48 h, the protein level of TCF19 gradually decreased with increasing JQ1 treatment time, exhibiting a time-dependent effect. D shows that by setting JQ1 concentration gradients of 0 μM, 0.01 μM, 0.1 μM, and 1 μM, the protein expression level of TCF19 gradually decreased with increasing JQ1 concentration, exhibiting a concentration-dependent effect. E, F, G shows the knockdown efficiency of BRD2, BRD3, and BRD4 using qPCR technology, detecting BET family members affecting TCF19; H and I show the knockdown of BRD2 and BRD3 followed by protein analysis, with TCF19 levels remaining essentially unchanged; J shows that knockdown of BRD2, BRD3, and BRD4 resulted in a decrease in TCF19 mRNA levels only when BRD4 was knocked down; K shows overexpression analysis of the two functional motifs of BRD4, BD1 and BD2, revealing that BD1 overexpression significantly reduced TCF19 expression levels, indicating that the BD1 motif of BRD4 regulates TCF19; L shows a correlation between BRD4 and TCF19 expression levels through immunohistochemical analysis of clinical lung adenocarcinoma samples; M shows a CHIP experiment demonstrating that BRD4 can directly bind to the promoter region of TCF19.

[0021] Figure 6 This study explores downstream pathways of TCF19. A and B show that after using RNA-seq sequencing to detect cells overexpressing the empty vector and those overexpressing TCF19, Cyclin D2 was significantly upregulated in TCF19-overexpressing cells. C shows that during the analysis of other genes with altered mRNA levels, 20 genes related to the cell cycle were identified, and their specific information is provided. D shows that a correlation analysis was performed on these genes in C with TCF19, revealing that Cyclin D2 is more strongly correlated with TCF19 expression.

[0022] Figure 7TCF19 directly regulates the transcription of Cyclin D2. A shows that Cyclin D2 protein expression is significantly increased under TCF19 overexpression; B shows that Cyclin D2 protein expression is significantly decreased after TCF19 knockdown; C shows that immunofluorescence also shows that Cyclin D2 fluorescence intensity is significantly increased after TCF19 overexpression; D shows that TCF19 and Cyclin D2 staining is more intense in mouse tumor tissues using immunohistochemistry; E shows that TCF19 and Cyclin D2 staining is more intense in mouse skin tissues using immunohistochemistry. Tumor staining results from tumor formation showed that Cyclin D2 staining was more intense in tumor tissues overexpressing TCF19; F shows Western blotting of tumor-bearing tissues, indicating that the protein expression level of Cyclin D2 was significantly increased in tumor tissues overexpressing TCF19; G shows Q-PCR detection, which revealed that the mRNA expression level of Cyclin D2 in tumor tissues overexpressing TCF19 was significantly higher than that in the control group; H shows the CHIP experiment, which showed that TCF19 can directly bind to the promoter of Cyclin D2.

[0023] Figure 8 The BRD4-TCF19-CyclinD2 pathway exists in lung adenocarcinoma; where A is the Western blot result, the expression levels of TCF19 and CyclinD2 proteins were significantly reduced after treatment with 1 μM concentration of the BET family inhibitor JQ1. B shows that Q-PCR analysis indicated a significant decrease in the mRNA expression levels of TCF19 and Cyclin D2 after treatment with 1 μM of the BET family inhibitor JQ1; C shows that knockdown of BRD4 significantly decreased the protein expression levels of TCF19 and Cyclin D2; D shows that knockdown of BRD4 significantly decreased the mRNA expression levels of TCF19 and Cyclin D2; E shows that overexpression of BRD4 significantly increased the protein expression levels of TCF19 and Cyclin D2; F shows that overexpression of BRD4 significantly increased the mRNA expression levels of TCF19 and Cyclin D2; G and H show that rescue experiments indicated that BRD4 regulates Cyclin D2 expression by upregulating TCF19, and TCF19 mediates the effect of BRD4 on Cyclin D2, with TCF19 playing a mediating role.

[0024] Figure 95-Fluorouracil can regulate chemotherapy resistance in lung adenocarcinoma by inhibiting BRD4 and thus affecting the expression of TCF19 and CYCLIND2. A and B show that by setting concentration gradients of 0 μM, 0.05 μM, 0.5 μM, and 5 μM of 5-fluorouracil, and using Western blotting and qPCR, the mRNA and protein expression levels of TCF19 gradually decreased with increasing 5-fluorouracil concentration, exhibiting a concentration-dependent relationship. C and D show the effects of treatment with 5 μM 5-fluorouracil for 0 h and 12 h. After 24 and 48 hours, Western blotting and qPCR were used to detect that the mRNA and protein levels of TCF19 gradually decreased with the extension of 5-FU treatment time, showing a time-dependent effect. E shows that after 48 hours of treatment with 5 μM 5-fluorouracil, Western blotting results showed that the protein expression levels of BRD4, TCF19, and Cyclin D2 were all reduced. F shows that real-time quantitative PCR results showed that the mRNA expression levels of both TCF19 and Cyclin D2 decreased after the addition of 5-fluorouracil. G shows that after knocking down TCF19 and adding 5-fluorouracil, the cell survival rate was lower compared to the control group. Detailed Implementation

[0025] This invention provides the application of a reagent for detecting TCF19 in the preparation of a reagent for the auxiliary diagnosis of lung adenocarcinoma, wherein TCF19 is significantly highly expressed in lung adenocarcinoma tissue.

[0026] In this invention, analysis of 483 lung adenocarcinoma tissue samples and 347 normal lung tissue samples from the TCGA database revealed high expression of TCF19 in tumor tissues. Further analysis of protein expression in tumor tissues and adjacent normal tissues of lung adenocarcinoma patients showed that TCF19 protein was highly expressed in tumor tissues compared to adjacent normal tissues. Therefore, TCF19 can serve as a biomarker for preparing reagents to aid in the diagnosis of lung adenocarcinoma.

[0027] This invention also provides the use of a substance that inhibits TCF19 in the preparation of a drug for treating lung adenocarcinoma. In this invention, the substance that inhibits TCF19 preferably includes a BET family inhibitor, preferably JQ1; the BET family inhibitor inhibits TCF19 by targeting and inhibiting the expression of BRD4. In this invention, the substance that inhibits TCF19 preferably includes BRD4 shRNA, the sequence of which is shown in SEQ ID NO.3; the BRD4 shRNA inhibits TCF19 by targeting and inhibiting the expression of BRD4. In this invention, the substance that inhibits TCF19 further includes a reagent that overexpresses BRD4-BD1; the reagent that overexpresses BRD4-BD1 competitively inhibits BRD4 by overexpressing BD1, thereby inhibiting TCF19.

[0028] In this invention, the substance that inhibits TCF19 preferably also includes TCF19 shRNA, the sense strand of which is shown in SEQ ID NO.1 and the antisense strand of which is shown in SEQ ID NO.2.

[0029] This invention also provides the use of substances that inhibit TCF19 in the preparation of reagents for inhibiting the proliferation of lung adenocarcinoma cells, including lung adenocarcinoma cell lines A549 or H1299. In this invention, the substances that inhibit TCF19 include, but are not limited to, the aforementioned BET family inhibitors, BRD4 shRNA, reagents that overexpress BRD4-BD1, and TCF19 shRNA.

[0030] The present invention also provides the use of substances that inhibit TCF19 in the preparation of 5-fluorouracil chemosensitizers.

[0031] The technical solutions provided by the present invention will be described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0032] Example 1

[0033] Validating the expression level of TCF19 in lung adenocarcinoma tissues

[0034] Statistical analysis of data from the TCGA database revealed that lung adenocarcinoma patients showed significantly higher levels of TCF19 mRNA expression. Figure 1 A in the middle.

[0035] Western blot experiments were performed on tissue proteins extracted from tumor tissues and adjacent tissues of 10 lung adenocarcinoma patients collected from the Affiliated Hospital of Guangdong Medical University.

[0036] (1) Protein extraction: Accurately weigh 150 mg of tissue sample, and wash the surface with PBS to remove impurities and blood. Add 1 ml of RIPA cell lysis buffer and protease inhibitor PMSF (final concentration 1 mM, add immediately) to a grinding tube containing grinding beads and tissue, place in a cryo-homogenizer, and grind at 70 Hz for 60 seconds. Repeat this process three times. Lyse on ice for 30 min, centrifuge at 12000 rpm for 10 min at 4 °C, take 500 μL of supernatant, add 100 μL of 6x protein loading buffer, mix well by pipetting, and boil in a metal bath at 95 °C for 15 min to obtain denatured and stable tissue protein sample.

[0037] (2) Preparation of polyacrylamide gel: Before preparing the separating gel, wash and dry a 1.50 mm glass plate. After installation and fixation, add double-distilled water to test for leaks for 10 minutes. If the leak test is successful, discard the water and keep the glass plate for later use. The separating gel formula is as follows: lower gel solution: 3.50 ml, lower gel buffer: 3.50 ml, modified coagulant: 70 μL. After the separating gel is prepared, quickly add it to the glass plate and add 3 ml of deionized water for sealing. After standing for 30 minutes until the separating gel solidifies, discard the sealing water layer to prepare the stacking gel. The stacking gel formula is: upper gel solution: 1.50 ml, upper gel buffer: 1.50 ml, modified coagulant: 30 μL. Insert the sample comb, place the gel plate at room temperature until the stacking gel is completely solidified, and then remove the sample comb. After the gel is prepared, transfer it to a 4°C refrigerator for storage and place the gel in a sealed bag containing deionized water to maintain the stability and integrity of the gel.

[0038] (3) Protein loading: Fix the prepared gel in the electrophoresis apparatus, add freshly prepared electrophoresis buffer to the inner tank, and add recycled electrophoresis buffer to the outer tank. Start adding protein samples, and add protein standard molecular weight markers at the same time. Fill the sample wells with 1x protein loading buffer.

[0039] (4) Electrophoresis: After sample loading, the initial voltage is 80V. Once the sample has migrated to the separating gel area and the marker is clearly visible, adjust the voltage to 120V and continue electrophoresis. Stop electrophoresis when the sample reaches the bottom of the gel.

[0040] (5) Transfer: Place the electrodes in the following order: "positive electrode - filter paper - gel - membrane (NC membrane) - filter paper - negative electrode," ensuring no air bubbles between layers. Confirm the electrode orientation is correct (protein transfer from gel to membrane). Turn on the power supply, using constant voltage mode at 80V, for a transfer time of 90 minutes. After transfer, turn off the power supply and remove the membrane.

[0041] (6) Blocking: Add 1% Tween 20 to the PBS solution to prepare a PBST solution; use the PBST solution to prepare a blocking solution containing 7% skim milk. Immerse the NC membrane in the blocking solution and place it at room temperature, then shake it slowly on a shaker for 60 minutes.

[0042] (7) Incubation of primary antibody: After the blocking is completed, the primary antigen solution is diluted with freshly prepared milk and incubated overnight at 4°C.

[0043] (8) Washing the membrane: Recover the primary antibody and wash the NC membrane with PBST buffer for 10 min each time, repeating three times.

[0044] (9) Incubation of primary antibody: Select secondary antibody of the corresponding species and incubate at 4℃ for 1-2 hours.

[0045] (10) Second wash: After incubation, the secondary antibody was recovered and washed three times with PBST solution on a shaker.

[0046] (11) Chemiluminescence detection: After washing the membrane, solution A and solution B of the chemiluminescent substrate were mixed in a 1:1 volume ratio. The mixed substrate was then uniformly dropped onto the membrane surface, and chemiluminescence imaging was performed. The results were then saved. It was observed that the expression level of TCF19 protein was increased in tumor tissue. Figure 1 (B and E in the middle)

[0047] The mRNA level of TCF19 was verified by quantitative real-time PCR experiments on tissue mRNA extracted from the pathological tissues of the above 10 pairs of clinical patients.

[0048] (1) RNA extraction:

[0049] 1. Accurately weigh 150 mg of tissue sample, and wash away surface impurities and blood with PBS. Add 1 ml of Trizol reagent to a grinding tube containing grinding beads and tissue, place it in a cryo-homogenizer, and grind at a frequency of 70 Hz for 60 seconds. Repeat this process three times.

[0050] 2. Add 200 μl of chloroform to each tube, shake vigorously up and down, and let stand for 5 minutes. After standing, centrifuge the tubes at 13000 rpm for 15 minutes at 4°C.

[0051] 3. Gently aspirate 400 μl of the clear supernatant liquid and transfer it to a new 1.5 ml enzyme-free centrifuge tube. Add 400 μl of isopropanol, gently vortex, and let stand at room temperature for 10 min. Centrifuge at 13000 rpm for 10 min.

[0052] 4. Discard the supernatant, add 1 ml of 75% ethanol to each tube, gently blow and wash the precipitate, and then centrifuge at 13000 rpm for 5 min at 4°C.

[0053] 5. Discard the supernatant, blot the remaining liquid in the centrifuge tube with filter paper, let it air dry, add 10 μl of DEPC water to each tube to dissolve the precipitate, and finally detect the concentration of the extracted RNA.

[0054] (2) Reverse transcription:

[0055] Prepare a 20 μL reverse transcription system:

[0056] 1 μg mRNA

[0057] 5xqRT SuperMix (Novazia) 4μL

[0058] Top up the DEPC water to 20μL

[0059] PCR instrument reverse transcription, reaction procedure:

[0060] 50℃ for 15 minutes

[0061] 85℃ for 5 seconds

[0062] The reverse transcription product cDNA was obtained.

[0063] (5) Real-time PCR:

[0064] The qPCR primers for TCF19 were identified through published literature, and their sequences are as follows:

[0065] GAPDH-QPCR-F: CATGTTCGTCATGGGTGTGAACCA (SEQ ID NO.4)

[0066] GAPDH-QPCR-R: ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO.5)

[0067] TCF19-QPCR-F: GGGCGGTGATCTCTACAC (SEQ ID NO.6)

[0068] TCF19-QPCR-R: GGGAGTCGGACATTATTGACCA (SEQ ID NO.7)

[0069] GAPDH-Mouse-F:CATGTTCGTCATGGGTGTGAACCA(SEQ ID NO.8)

[0070] GAPDH-Mouse-R: TGTAGACCATGTAGTTGAGGTCA (SEQ ID NO.9)

[0071] TCF19-Mouse-F:AGTCTGGCTGCACCTATGGAT(SEQ ID NO.10)

[0072] TCF19-Mouse-R:AGTCGTCCCCTTGGAGTTCA(SEQ ID NO.11)

[0073] Prepare a 10 μL real-time PCR reaction mixture in a 96-well plate:

[0074] Primers: 0.5 μL each of forward and reverse primers

[0075] cDNA: 1 μL

[0076] 3μL of DEPC water

[0077] 2xchamQ SYBR qPCR Master Mix (Novazia) 5μL

[0078] Perform quantitative real-time PCR on the QS6P qPCR instrument. Reaction program:

[0079] 1.95℃ for 5 minutes

[0080] 2.95℃ for 20 seconds

[0081] 3.60℃ for 20 seconds

[0082] 4.72℃ 20s

[0083] Steps 2-4 are repeated 40 times.

[0084] By setting a reasonable threshold, collecting fluorescence signals, and obtaining CT values ​​during the exponential amplification phase, the relative expression level of the target gene is determined. The equation was derived. Analysis showed that the mRNA level of TCF19 was significantly elevated in tumor tissue. Figure 1 (D and G in the text).

[0085] Immunohistochemical staining was performed on cancerous and adjacent tissue microarrays from 90 pairs of lung adenocarcinoma patients. The microarrays were purchased from Shanghai Tufei Biotechnology Co., Ltd., catalog number TFLungade-01.

[0086] (1) Dewaxing and water coating: The sections were baked in a 65℃ oven for 2 hours, and then dewaxed for 10 minutes in wax dewaxing and clearing solutions 1 and 2 respectively. They were then coated with water for 5 minutes in 100% ethanol, 95% ethanol, 85% ethanol, 75% ethanol, 50% ethanol and water respectively.

[0087] (2) Heat antigen retrieval: Using 0.5mM EDTA and antigen retrieval solution containing 0.05% Tween, the slides were placed in a 95℃ water bath for heat antigen retrieval for 25min. After retrieval, the slides were taken out and cooled to room temperature naturally. They were washed 3 times with PBS solution for 5min each time.

[0088] (3) Removal of endogenous catalase: Place the tissue sections in 3% hydrogen peroxide solution (prepared with 100% methanol) for 10 min to remove endogenous catalase from the tissue sections. Then wash with PBS 3 times for 5 min each time.

[0089] (4) Blocking: Prepare 3% BSA solution using PBS solution, draw a circle around the tissue section using an immunohistochemical pen, and then add 3% BSA solution inside the circle for blocking for 10 min.

[0090] (5) Incubation with primary antibody: Discard the blocking 3% BSA, add 1:200 TCF19 primary antibody prepared with PBS to the slice, place it in a humidified box, and incubate at 4°C for 16 hours.

[0091] (6) Incubation with secondary antibody: Remove the humidified chamber from the refrigerator at 4 degrees Celsius and wait for the sections to return to room temperature. Wash with PBS 3 times for 5 minutes each time. Then add horseradish peroxidase-labeled secondary antibody (proteintech, i.e., HRP-labeled goat anti-mouse / rabbit secondary antibody) and incubate at room temperature for 30 minutes. Wash with PBS solution 3 times for 5 minutes each time.

[0092] (7) DAB staining: DAB staining solution is used for staining. The staining degree is observed under a microscope. Staining is stopped after 2 minutes.

[0093] (8) Nucleus staining: Soak in distilled water for 2 minutes, then in hematoxylin solution for 10 minutes, and rinse 3 times with tap water. Differentiate in 70% alcohol containing 1% hydrochloric acid for 3-5 seconds, and then in water for 60 minutes to return to blue. (Observe under a microscope whether the nucleus has been stained blue).

[0094] (9) Dehydration, clearing, and mounting with neutral resin mounting medium: Dehydrate for 3 minutes in 50% ethanol, 75% ethanol, 95% ethanol, 95% ethanol, and 100% ethanol respectively. Then clear for 10 minutes each in wax dewaxing and clearing solutions 1 and 2. After removing and drying, mount with neutral resin mounting medium.

[0095] (10) After mounting and allowing the mounting medium to dry, images were taken under a microscope. High expression of TCF19 was found in the tumor tissue. Figure 1 H) was then statistically scored. Figure 3 Patients with high TCF19 expression (B) were analyzed for TCF19-related survival based on their scores and tissue origin: Patients with high TCF19 expression had a poor prognosis. Figure 3 (C)

[0096] Example 2

[0097] Construction and expression validation of TCF19 overexpression and knockdown recombinant lentiviral vectors:

[0098] Construction of TCF19 overexpression recombinant lentiviral vector

[0099] (1) PCR primer design: The TCF19 coding sequence was found on the National Center for Biotechnology Information website. pLVX-EF1a-IRES-Puro was selected as the vector, purchased from Takara Bio. Using Primer Premier 5 software, FLAG-tagged protein sequences were added to the primers based on the TCF19 sequence and the vector's restriction enzyme sites to design suitable PCR primers. The primer sequences are as follows:

[0100] TCF19-EcoRI (SEQ ID NO.12):

[0101] GGAATTCATGGGAGACTACAAGGACGATGATGACAAGATGCTGCCCTGCTTCCAAC

[0102] TCF19-Not I (SEQ ID NO.13):

[0103] ATAAGAATGCGGCCGCTTAGGTCTGAATGCCAGCCC

[0104] (2) Amplification of the TCF19 fragment: Using cDNA obtained by reverse transcription of mRNA from lung adenocarcinoma cells H1299 as a template, the TCF19 fragment was amplified by PCR. A 50 μL PCR reaction system was prepared. The system is as follows:

[0105]

[0106] The PCR reaction procedure is as follows:

[0107]

[0108] Steps 2-4, 35 cycles

[0109] Further extension: 72℃ for 10 minutes.

[0110] (3) Identification and gel recovery: The PCR products were subjected to agarose gel electrophoresis, and the target DNA band of 1kb was cut out under ultraviolet light and recovered using a gel recovery kit (TIANgel).

[0111] (4) Enzyme digestion and ligation: The PCR products recovered from the gel and the lentiviral vector pLVX-EF1a-IRES-Puro were double-digested at 37°C using restriction endonucleases EcoRI and NotI, respectively. The enzyme digestion system is as follows:

[0112] PCR product enzyme digestion system:

[0113] 1 μL each of EcoRI and Not I

[0114] O buffer 2μL (10x) 2μL

[0115] 16 μL of PCR product was recovered by gel extraction.

[0116] Lentiviral vector enzyme digestion system:

[0117]

[0118] The double enzyme digestion products were purified using a universal DNA purification kit (TIANgel). The purified products were then subjected to enzyme ligation.

[0119] Enzyme ligation system:

[0120]

[0121]

[0122] Enzyme-linked for 16 hours under constant temperature conditions of 16℃ in a PCR instrument.

[0123] (5) Transformation

[0124] 1. Melt the competent DH5α cells on ice.

[0125] 2. Place 20 μl of the above ligation product into 30 μL of competent cells and gently pipette to mix.

[0126] 3. Place on ice for 30 minutes.

[0127] Heat shock in a 4.42℃ water bath for 90 seconds, then place on ice for 5 minutes.

[0128] 5. Add 500 μl of antibiotic-free LB liquid medium and incubate at 37°C with shaking at 200 rpm for 60 min.

[0129] Centrifuge at 3000 rpm for 5 min, and retain about 100 μl of liquid to mix the bacteria.

[0130] 7. Add the bacterial culture to LB agar plates, spread it evenly with a sterile spreader, and incubate upside down at 37°C for 16 hours.

[0131] (6) Identification: After recovering the plate, 50-100 colonies can be seen to grow. Using a 10μL pipette tip, pick up a single growing colony and put it into 10μL of sterile water. Gently pipette the colony and use it as a PCR template for colony PCR identification.

[0132] The PCR system is as follows:

[0133]

[0134] Colonies with positive PCR results were obtained after agarose gel electrophoresis and UV irradiation. 1 μL of the positive bacterial culture was added to 6 ml of LB broth containing antibiotics and incubated at 37°C with shaking at 200 rpm for 16 h. Plasmids were then extracted using a plasmid extraction kit (TIANgel) and identified by plasmid PCR.

[0135] The PCR system is as follows:

[0136]

[0137] Agarose gel electrophoresis was performed, and plasmids with positive PCR results were obtained after UV irradiation. These plasmids were then sent to Qingke Biotechnology Co., Ltd. for sequencing. After obtaining the results, BLAST was performed on the National Center for Biotechnology Information website to obtain the pLVX-EF1a-IRES-Puro-TCF19 plasmid with no mutations in the target fragment and a completely correct sequence.

[0138] TCF19 knockdown recombinant lentiviral vector acquisition: PLVX-shRNA2-TCF19 (constructed by Ubisoft Biotechnology), plasmid functional sequence:

[0139] shTCF19-sense (SEQ ID NO.1):

[0140] CCGGCAAGGCCACACTGATCCTAAACTCGAGTTTAGGATCAGTGTGGCCTTGT TTTTG

[0141] shTCF19-antisense(SEQ ID NO.2):

[0142] AATTCAAAAACAAGGCCACACTGATCCTAAAACTCGAGTTTAGGATCAGTGTG

[0143] GCCTTG

[0144] Construction of stable cell lines:

[0145] (1) Cell preparation: 293T cells were cultured in 10cm cell culture dishes in DMEM medium containing 10% fetal bovine serum and passaged once every 2-3 days.

[0146] (2) Cell plating: When the 293T cell density reaches 90%, cell plating is performed. The specific steps are as follows: aspirate the culture medium, add 5 ml of PBS solution for washing, aspirate the PBS, add 1 ml of trypsin containing 0.02% EDTA, react for about 1 min, add DMEM culture medium containing 10% fetal bovine serum to stop digestion, disperse the cells, collect them into centrifuge tubes, centrifuge at 1000 rpm for 3 min, aspirate the supernatant, add culture medium to resuspend the cells, and then plate them.

[0147] (3) Transfection: 12 hours after plating, when the cell density is 60%, the culture medium is changed to serum-free medium.

[0148] Preparation of the transfection system:

[0149] 1. pLVX-EF1a-IRES-Puro-TCF19 transfection system:

[0150] 200 μL of serum-free culture medium

[0151] pLVX-EF1a-IRES-Puro-TCF19 plasmid 8μg

[0152] 6 μg of VSVG packaging plasmid

[0153] DR packaging plasmid 4μg

[0154] Lipo 8000 transfection reagent 36μL

[0155] 2. PLVX-shRNA2-TCF19 system:

[0156] 200 μL of serum-free culture medium

[0157] 8 μg of PLVX-shRNA2-TCF19 plasmid

[0158] 6 μg of VSVG packaging plasmid

[0159] DR packaging plasmid 4μg

[0160] Lipo 8000 transfection reagent 36μL

[0161] After gently mixing by pipetting, incubate for 20 minutes, then add to a 293T cell culture dish and place in a 37°C incubator.

[0162] (3) Lentiviral packaging: 8 hours after transfection, the culture medium was replaced with DMEM medium containing 10% fetal bovine serum and cultured for a period of time. During this period, the culture medium was added to ensure that the color of the culture medium in the culture dish did not turn yellow and to ensure that the pH did not change too much, thus affecting the lentivirus packaging. 72 hours after transfection, the culture medium supernatant was collected and filtered with a 4.5 μm diameter sterile filter to obtain lentivirus supernatant containing pLVX-EF1a-IRES-Puro-TCF19 and PLVX-shRNA2-TCF19.

[0163] (4) Lentiviral infection and screening: Lung adenocarcinoma cells A549 and H1299 were cultured in 1640 medium containing 10% fetal bovine serum. The cells were purchased from the Cell Bank of the Chinese Academy of Sciences. When the cell density reached 90%, they were plated into 6 cm cell culture dishes. 12 hours after platening, when the cell density was 60%, 3 ml of lentivirus suspension was added, along with polybrene (final concentration 10 μg / ml to enhance infection efficiency). 48 hours after infection, puromycin (final concentration 1 μg / ml) was added for screening. Lung adenocarcinoma cells not infected with lentivirus were killed. After 72 hours of screening, the surviving cells were those infected with pLVX-EF1a-IRES-Puro-TCF19 and PLVX-shRNA2-TCF19, as well as stable cell lines.

[0164] Western blot experiments were performed on stable cell lines:

[0165] (1) Cell collection and protein extraction: Lung adenocarcinoma cells were collected from 6 cm cell culture dishes, washed with pre-cooled PBS, centrifuged at 4000 rpm, and the supernatant was discarded. The cell pellet was retained, and 400 μL of RIPA cell lysis buffer and protease inhibitor PMSF (final concentration 1 mM, added immediately) were added. The cells were lysed on ice for 30 min, centrifuged at 12000 rpm for 10 min at 4 °C, and 350 μL of supernatant was collected. 70 μL of 6x protein loading buffer was added, and the mixture was mixed by pipetting. The mixture was placed in a 95 °C metal bath for 15 min, and then aliquoted and stored at -80 °C to obtain denatured and stable cell protein samples.

[0166] (2) After protein extraction, Western blot analysis (the specific steps have been detailed above) showed that TCF19 protein expression in lung adenocarcinoma cells was significantly increased after pLVX-EF1a-IRES-Puro-TCF19 infection. Figure 2 (A and B in the text); After PLVX-shRNA2-TCF19 infection, the expression of TCF19 protein in lung adenocarcinoma cells was significantly reduced ( Figure 2 (C and D in the text).

[0167] Example 3

[0168] Validating the effect of TCF19 on proliferation in stable cell lines

[0169] Cell proliferation detection:

[0170] (1) Cell preparation: Digest, resuspend and count the cells that are in good growth condition and have a density of 80-90% and overexpress pLVX-EF1a-IRES-Puro-TCF19, PLVX-shRNA2-TCF19 and pLVX-EF1a-IRES-Puro H1299.

[0171] (2) Calculation: Based on 1000 cells per well of a 96-well plate, design 3 replicates for each experimental group and control group, and calculate the required number of cells.

[0172] (3) Preparation of single-cell suspension: Take 10 ml of complete culture medium into a large dish, add the required amount of cells, and shake well.

[0173] (4) Plate preparation: Add the obtained single-cell suspension to a 96-well plate, 200 μL per well, and add 200 μL of PBS to the wells around the experimental group and the control group as blank groups.

[0174] (5) Place the plated 96-well plates in a cell culture incubator at 37°C with 5% CO2. After cell adhesion, discard the old culture medium, wash once with PBS, add 180 μL of culture medium and 20 μL of CCK-8 reagent to each well, mix well, and incubate in the cell culture incubator for 3 h. Then, transfer 180 μL of cell supernatant to an enzyme-labeled strip and measure the OD value at 450 nm using an enzyme-labeled reader. Use the same method to detect the OD values ​​at 0 h, 12 h, 24 h, 36 h, 48 h, and 72 h of cell culture.

[0175] (6) Data collection and statistical analysis showed that overexpression of TCF19 accelerated the proliferation of lung adenocarcinoma cells, while knockdown of TCF19 inhibited the proliferation of lung adenocarcinoma cells. Figure 4 (A and B in the text).

[0176] Cell cycle detection

[0177] (1) Cell treatment: 1. The cell plate density is 35%. When the cell density reaches about 80%, discard the culture medium, rinse once with PBS, add trypsin to digest, and stop digestion with complete culture medium. Disperse the cells, centrifuge at 800 rpm for 3 min, and discard the supernatant. Add 1 ml of PBS to resuspend and wash once, centrifuge at 800 rpm for 3 min, discard the supernatant, and disperse the precipitate at the bottom of the tube.

[0178] (2) Cell fixation: Take another 1.5ml EP tube, add 700μL of anhydrous ethanol, resuspend the cells at the bottom of the tube in 300μL of PBS, drop the cell suspension into anhydrous ethanol, gently pipette to mix, and fix overnight at 4℃ or -20℃. Centrifuge at 600g for 10min in a pre-cooled centrifuge at 4℃, discard the supernatant, add 1ml of cold PBS, resuspend the cells, centrifuge at 600g for 10min, discard the supernatant, and gently disperse the cells to avoid cell clumping.

[0179] (3) RNase digestion and PI staining: PI staining solution (50 μg / ml PI + 50 μg / ml RNase) was used to stain in a 500 ml system. The mixture was incubated at 37°C in the dark for 30 min, and stirred once during the staining process. After staining, the solution was stored at 4°C or on ice in the dark.

[0180] (4) Flow cytometry analysis: A flow cytometer was used to detect the red fluorescent PE channel at an excitation wavelength of 480 nm. Cells were acquired at a low speed to minimize differences between cells and ensure higher accuracy. Cell DNA content was analyzed using appropriate analysis software (such as Modifit). Results showed that overexpression of TCF19 accelerated the proliferation of lung adenocarcinoma cells, with more cells transitioning from the G0 / G1 phase to the S phase for DNA synthesis. Figure 4 (B in the middle).

[0181] Cloning experiments:

[0182] (1) Cell preparation: Digest, resuspend and count cells that are in good growth condition and have a density of 80-90% overexpressing pLVX-EF1a-IRES-Puro-TCF19, PLVX-shRNA2-TCF19 and pLVX-EF1a-IRES-Puro.

[0183] (2) Calculation: Based on 1000 cells per well of a 6-well plate, design 3 replicates for each experimental group and control group, and calculate the required number of cells.

[0184] (3) Preparation of single-cell suspension: Take 10 ml of complete culture medium into a large dish, add the required amount of cells, and shake well.

[0185] (4) Plate preparation: Add the obtained single-cell suspension to a 6-well plate, with 2 ml of culture medium per well.

[0186] (5) Place the plated 6-well plates in a cell culture incubator at 37°C and 5% CO2. Change the culture medium every 2-3 days. Perform treatment after 10-14 days. Discard the culture medium, wash once with PBS, fix with 4% paraformaldehyde for 10 min, stain with 0.05% crystal violet for 30 min, recover the crystal violet after staining, wash the 6-well plates 3-5 times with ultrapure water, invert and air dry, and then take images. Analyze the results. It can be seen that after overexpression of TCF19, the proliferation of lung adenocarcinoma cells is accelerated, and after knockdown of TCF19, the proliferation rate of lung adenocarcinoma cells is inhibited. Figure 4 (C in the middle).

[0187] EDU detection of cell proliferation

[0188] (1) Preparation of the slide: First, put the slide into the 24-well plate, add polylysine and treat for 10 minutes, then recover the polylysine, and place the 24-well plate in a sterile operating table and ventilate and treat with ultraviolet light for 30 minutes to sterilize.

[0189] (2) Cell preparation: Wash the 24-well plate three times with PBS, and seed the cells at a density of 40%-80% to ensure that the cells are evenly attached to the slide.

[0190] (3) EDU labeling: First, dilute the EDU stock solution with cell culture medium at a ratio of 1000:1 to prepare an appropriate amount of 10 μM EDU. Add 2 μl of 10 μM EDU to each well, incubate for 2 h, then discard the culture medium and wash the cells twice with PBS for 5 min each time.

[0191] (4) Cell fixation: Add 500 μL of 4% paraformaldehyde fixative to each well and fix at room temperature for 15 min. After discarding the fixative, add 1 ml of 3% BSA to each well and wash 3 times for 5 min each time. (3% BSA is prepared from PBS).

[0192] (5) Cell permeabilization: Add 1 ml of PBS containing 0.3% Triton X-100 to each well and incubate on a shaker at room temperature for 20 min. Discard the permeabilization solution and wash each well three times with 1 ml of 3% BSA for 5 min each time.

[0193] (6) Fluorescent labeling: Prepare Click reaction solution according to the number of experimental samples, referring to the table below. (The reaction solution must be used within 15 minutes of preparation).

[0194] Table 1. Preparation of Click Reaction Solution

[0195]

[0196]

[0197] Discard the supernatant, add 500 μL of Click reaction solution prepared according to the table above, and incubate in a shaker at room temperature in the dark for 30 min; discard the supernatant, add 1 ml of 3% BSA to each well and wash 3 times, 5 min each time.

[0198] (7) DNA staining: Discard the supernatant, add 500 μL of DAPI working solution to each well, and incubate at room temperature in the dark for 20 min. Discard the supernatant, add 1 ml of 3% BSA to each well and wash 3 times, 5 min each time.

[0199] (8) Image acquisition and analysis: Immediately after staining, images were acquired using confocal fluorescence microscopy. It was observed that overexpression of TCF19 accelerated the proliferation of lung adenocarcinoma cells; knockdown of TCF19 inhibited the proliferation of lung adenocarcinoma cells. Figure 4 (D in the middle).

[0200] Nude mouse subcutaneous tumor-bearing experiment to detect cell proliferation

[0201] (1) Experimental animals: Select nude mice around 6 weeks old, weighing 15-18 grams.

[0202] (2) Cell preparation: Overexpressing pLVX-EF1a-IRES-Puro-TCF19 and pLVX-EF1a-IRES-Puro cells in the logarithmic growth phase were collected, digested with trypsin, and collected into sterile centrifuge tubes. Centrifuged at 1000 rpm for 3 min, and the supernatant was discarded; the cells were resuspended in PBS, centrifuged at 1000 rpm for 3 min, and the supernatant was discarded. The cells were resuspended in an appropriate amount of PBS, and the cell concentration was adjusted to the required level. The cells were then placed on ice for later use.

[0203] (3) Subcutaneous injection:

[0204] 1. Anesthesia: Nude mice were anesthetized by intraperitoneal injection of 1% sodium pentobarbital.

[0205] 2. Disinfection: Disinfect the back or armpit area of ​​the nude mouse with 75% ethanol cotton balls.

[0206] 3. Injection: Inject 0.2 ml of cell suspension (2 × 10⁻⁶ cells / ml) into the infusion container. 6 The cells were injected subcutaneously into the axillary region of nude mice. The needle was left in place for a few seconds after injection before being withdrawn to prevent leakage of the cell suspension.

[0207] (4) Monitor tumor growth: Observe the nude mice 2-3 times a week and record their survival status and tumor growth. When the tumor volume reaches 150-200 mm, the tumor growth rate will be recorded. 3 The experiment can be ended when the time is right.

[0208] (5) End of Experiment and Tissue Collection: When the tumors reached the predetermined size or the experimental period ended, the nude mice were euthanized by cervical dislocation. Subcutaneous tumor tissue was removed, categorized by group, and photographed. The results showed that overexpression of pLVX-EF1a-IRES-Puro-TCF19 could promote the proliferation of lung adenocarcinoma cells. Figure 4 (E in the text)

[0209] After the tissue was embedded and sectioned, immunohistochemical experiments (the specific steps of which have been described in detail above) were used to detect tumor tissue proliferation. It was found that overexpression of pLVX-EF1a-IRES-Puro-TCF19 significantly promoted the proliferation of lung adenocarcinoma cells. Figure 4 (F in the text)

[0210] Example 4

[0211] Searching for upstream regulators of TCF19

[0212] RNA-SEQ omics analysis of TCF19 and BRD4 concluded that TCF19 RNA levels increased after overexpression of BRD4. Figure 5 A in the middle.

[0213] RNA-SEQ omics analysis of TCF19 and JQ1 concluded that TCF19 RNA levels decreased after JQ1 treatment. Figure 5 (B in the middle).

[0214] By inhibiting the function of BET proteins (BRD2, BRD3, BRD4) using JQ1, cellular proteins were extracted, and the TCF19 protein level was verified by Western blotting.

[0215] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were passaged and then plated in six-well plates and cultured in a cell culture incubator at 37°C for 12 hours with 5% CO2.

[0216] (2) Inhibition of BET protein function: After 12 h of cell plating, the culture medium was changed to 1640 medium containing 0.5% fetal bovine serum and starved for 24 h. Then, BET protein inhibitor JQ1 was added and treated with time gradient (0 h, 12 h, 24 h, 48 h) and concentration gradient (0 uM, 0.01 uM, 0.1 uM, 1 uM).

[0217] (3) Cellular proteins were extracted for Western blotting experiments (the specific experimental procedure has been detailed previously). The results indicated that with the increase of JQ1 stimulation time and concentration, the protein level of TCF19 decreased significantly. Figure 5 (C and D in the text).

[0218] By knocking down the expression of specific BET proteins (BRD2, BRD3, BRD4), cellular proteins and RNA were extracted, and the levels of TCF19 protein and mRNA were verified by Western blotting and quantitative real-time PCR (Q-PCR).

[0219] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were passaged and then plated in six-well plates and cultured in a cell culture incubator at 37°C for 12 hours with 5% CO2.

[0220] (2) Plasmid transfection: After 12 hours of cell plating, the density was 40%, and the old culture medium was discarded and replaced with serum-free culture medium.

[0221] The shRNA plasmids for BRD2, BRD3, and BRD4 were purchased from Qingke Biotechnology.

[0222] The plasmid functional sequence is as follows:

[0223] BRD2-shRNA (SEQ ID NO.14):

[0224] CCGGGCTGCTGATGTACGGCTTATGCTCGAGCATAAGCCGTACATCAGCAGCT TTTTT

[0225] BRD3-shRNA (SEQ ID NO.15):

[0226] CCGGGGGAGATGCTATCCAAGAAGCCTCGAGGCTTCTTGGATAGCATCTCCCT TTTTT

[0227] BRD4-shRNA (SEQ ID NO.3):

[0228] CCGGCAGAGTGATCTATTGTCAATACTCGAGTATTGACAATAGATCACTCTGT TTTTT.

[0229] Preparation of the transfection system:

[0230] shRNA plasmid: 2μg

[0231] Lopo8000 transfection reagent: 4μL

[0232] Serum-free culture medium: 100 μL.

[0233] (The specific transfection steps have been described in detail earlier.)

[0234] RNA was extracted from cells 48 hours after transfection and used for quantitative real-time PCR (Q-PCR) experiments (the specific experimental steps have been described in detail above).

[0235] Primer sequence:

[0236] GAPDH-QPCR-F: CATGTTCGTCATGGGTGTGAACCA (SEQ ID NO.16)

[0237] GAPDH-QPCR-R: ATGGCATGGACTGTGGTCATGAGT (SEQ ID NO.17)

[0238] TCF19-QPCR-F: GGGCGGTGATCTCTACAC (SEQ ID NO.18)

[0239] TCF19-QPCR-R: GGGAGTCGGACATTATTGACCA (SEQ ID NO.19)

[0240] BRD2-QPCR-F: GAGGTGTCCAATCCCAAAAAGC (SEQ ID NO.20)

[0241] BRD2-QPCR-R: ATGCGAACTGATGTTTCCACA (SEQ ID NO. 21)

[0242] BRD3-QPCR-F: TCAAATTGAACCTGCCGGATT (SEQ ID NO.22)

[0243] BRD3-QPCR-R: TGCATACATTCGCTTGCACTC (SEQ ID NO. 23)

[0244] BRD4-QPCR-F: GAGCTACCCACAGAAGAAACC (SEQ ID NO. 24)

[0245] BRD4-QPCR-R:GAGTCGATGCTTGAGTTGTGTT (SEQ ID NO.25)

[0246] The results indicate that BRD2, BRD3, and BRD4 were successfully knocked down. Figure 5 (E, F, G in the text).

[0247] Knockdown of BRD4 significantly reduced the mRNA level of TCF19, suggesting that BRD4 is the main upstream protein member regulating TCF19 in the BET protein family. Figure 5 J in

[0248] Cell proteins were extracted 72 hours after transfection and subjected to Western blotting experiments (detailed experimental procedures have been described previously). The results indicated that knocking down BRD4 significantly reduced TCF19 protein levels, suggesting that BRD4 is the primary upstream protein member regulating TCF19 within the BET protein family. Figure 5 (H, I, L in the text).

[0249] Cellular proteins were extracted by overexpressing BRD4, and the TCF19 protein level was verified by Western blotting.

[0250] (1) Cell plating: Lung adenocarcinoma cell lines A549 and H1299 were passaged and then plated in six-well plates and cultured in a cell culture incubator at 37°C for 12 hours with 5% CO2.

[0251] (2) Plasmid transfection: After 12 hours of cell seeding at a density of 40%, the old culture medium was discarded and replaced with serum-free culture medium. 2 μg of the ov-flag-BRD4 plasmid purchased from Qingke Biotechnology was transfected. Cell proteins were collected 48 hours after transfection and subjected to Western blotting experiments. The results showed that the protein level of TCF19 was significantly increased after overexpression of BRD4.

[0252] By overexpressing BRD4 in leads BD1 and BD2, the function of BRD4 in both leads is competitively inhibited.

[0253] (1) Construct BD1 and BD2 overexpression plasmids with GFP tags on pcDNA3.0 (the specific construction steps have been described in detail earlier).

[0254] Primer sequences:

[0255] BRD4-BD1-BamHI-F: CGGGATCCAGGCAGACCAACCAACTGC (SEQ ID NO. 26)

[0256] BRD4-BD1-xbal-R: GCTCTAGATTGCAAGAAGAGCTTTCCAG (SEQ ID NO. 27)

[0257] BRD4-BD2-BamHI-F: CGGGATCCAAGGTCTCGGAGCAGCTCAAG (SEQ ID NO. 28)

[0258] BRD4-BD2-xbaI-R: GCTCTAGAAGGCTCGTCCGGCATCTTG (SEQ ID NO. 29)

[0259] After successful construction, the plasmid is amplified.

[0260] (2) Transfect 3 μg of each plasmid (the specific experimental steps have been described in detail earlier).

[0261] (3) 24-48 h after transfection, cell proteins were extracted and subjected to Western blotting experiments (specific experimental procedures have been detailed previously). The results indicated that the protein level of TCF19 was significantly reduced after overexpression of BRD4-BD1, suggesting that BRD4-BD1 is responsible for regulating TCF19 in the two leads of BRD4. Figure 5 K in the middle.

[0262] Immunohistochemical staining of BRD4 and TCF19 was performed on clinicopathological tissues (the specific steps have been detailed above): BRD4 and TCF19 show consistent expression, that is, in cancerous tissues and adjacent normal tissues with high expression of BRD4, TCF19 is also highly expressed, and the two are significantly correlated. Figure 5 L in the middle.

[0263] Chromatin immunoprecipitation experiments were used to further verify that BRD4 binds to the promoter of the TCF19 gene and regulates the transcription of TCF19.

[0264] (1) Cross-linking and cell harvesting

[0265] 1. Cells were passaged and plated into 10cm cell culture dishes, and divided into an untreated group, a BRD4 overexpression group, and a JQ1 overexpression group. After the cells reached confluence, 37% formaldehyde solution was added according to the volume of the culture medium to make a final concentration of 1%. The cells were then slowly shaken on a shaker at room temperature for 10 minutes to allow DNA and protein to cross-link. (A 1% formaldehyde solution can be prepared using PBS).

[0266] 2. Add 1.25M glycine according to the volume of the culture medium to make a final concentration of 125mM. Shake slowly on a shaker at room temperature for 5 minutes to terminate the cross-linking reaction.

[0267] 3. Wash the cells twice with 10 ml of pre-cooled PBS.

[0268] 4. Add 1 ml of solution A, scrape off the cells, and collect them in a 1.5 ml centrifuge tube. Centrifuge at 4000 rpm and 4°C for 5 min, discard the supernatant, and keep the precipitate.

[0269] (2) Ultrasonic fragmentation

[0270] 1. Add 600 μL of solution C (add protease inhibitor immediately before use), resuspend the cells, and vortex to lyse the cells. After ultrasound, run DNA gel to check the fragment size (DNA gel concentration of around 1.5% is suitable), with fragments of 200-1000 bp being ideal.

[0271] 2. Centrifuge at 12000 rpm and 4℃ for 15 min. Collect the supernatant and discard the precipitate.

[0272] (3) Preclear sample

[0273] 1. Add 50 μL of protein A / G beads and protamine (final concentration 200 μg / ml. Stock solution 10 mg / ml, prepared with ddH2O) to 400–500 μL of supernatant and incubate by rotation at 4°C for 2 h.

[0274] 2. Centrifuge at 12000 rpm and 4℃ for 15 min. Collect the supernatant and discard the precipitate.

[0275] 3. Take 20 μL from the supernatant as input.

[0276] (4) Combination

[0277] 1. Take 200 μL of supernatant and add 4 μL of primary antibody, 8 μL of protein A / G beads, protamine (final concentration 200 ug / ml), and BSA (final concentration 1 mg / ml). Then, bring the total volume to 300 μL with Chip1 solution. Incubate at 4°C overnight or for 4-6 hours by rotation. Store the remaining supernatant at -80°C for later use.

[0278] (5) Cleaning

[0279] Centrifuge at 1.4℃ and 3000rpm for 1 min to precipitate the beads; discard the supernatant.

[0280] 2. The beads were washed with 400 μL each of Chip1, Chip2, Chip3 and TE solutions in sequence. During the washing process, DTT (final concentration 1 mM) was added to each of the four solutions.

[0281] (6) Proteinase K digestion

[0282] 1. Add 100 μl of elution buffer (0.5% SDS, 0.1 M NaHCO3, and 5 μg proteinase K). This step and subsequent processing should also be performed on samples from inpu. The elution buffer should be prepared fresh for each use.

[0283] Shake overnight or for 6 hours on a molecular hybridization apparatus at 2.65℃.

[0284] (7) DNA purification, precipitation and dissolution

[0285] 1. Add 300 μL of phenol-chloroform to each tube and shake vigorously. A white emulsion will appear. Centrifuge at 8000 rpm and 4°C for 3 min. Collect the supernatant and discard the beads. Repeat the extraction 2-3 times until no white emulsion appears and the supernatant is clear.

[0286] 2. Take the supernatant, add 100 μL of chloroform, shake vigorously, centrifuge at 8000 rpm and 4℃ for 3 min, and take the supernatant.

[0287] 3. Add 300 μL (3 times the volume) of anhydrous ethanol, 10 μL (1 / 10 volume) of 3M NaOAc, and 0.3 μL (1 / 100 volume) of glycogen (20 mg / ml), and precipitate at -20℃ for 30 min.

[0288] 4. Centrifuge at 12,000 rpm for 10 minutes at room temperature.

[0289] 5. Discard the supernatant and wash the precipitate once with 70% ethanol.

[0290] 6. Centrifuge at 12,000 rpm for 10 minutes at room temperature. After removing as much ethanol as possible, let the precipitate air dry.

[0291] 7. Add 40 μL TE to dissolve the DNA. For the input group, 60–80 μL TE can be used for dissolution.

[0292] (8) PCR reaction: The results of the chip can be reflected by a Q-PCR experiment or by conventional PCR followed by DNA gel running. Subsequent quantitative PCR (Q-PCR) experiments will be performed. Q-PCR primer sequences:

[0293] TCF19-chip-F (SEQ ID NO.30): TGTGAACTAATCAGAAAAAGTGG

[0294] TCF19-chip-R(SEQ ID NO.31):GTTTGACAGCCAAGAAGCC

[0295] The Q-PCR primer sequence bound to the TCF19 promoter sequence. The results suggest that BRD4 binds to the TCF19 gene promoter and regulates TCF19 transcription. Figure 5 M in the middle.

[0296] Example 5

[0297] Searching for downstream regulatory factors of TCF19

[0298] RNA-SEQ omics analysis of Cyclin D2 and TCF19 concluded that overexpression of TCF19 increased Cyclin D2 RNA levels. Simultaneously, changes in the RNA expression levels of 20 cell cycle-related genes were observed. Correlation analysis revealed a stronger correlation between Cyclin D2 and TCF19 expression. Figure 6 (A, B, C, D)

[0299] After overexpressing and knocking down TCF19, Western blotting experiments (details of which have been described previously) revealed that the protein levels of Cyclin D2 also significantly increased and decreased after TCF19 overexpression and knockdown. Figure 7 (A and B in the middle)

[0300] Immunofluorescence analysis was performed after overexpression of OV-Flag-TCF19.

[0301] (1) Preparation of the slide: First, put the slide into the 24-well plate, add polylysine and treat for 10 minutes, then recover the polylysine, and place the 24-well plate in a sterile operating table and ventilate and treat with ultraviolet light for 30 minutes to sterilize.

[0302] (2) Cell preparation: Wash the 24-well plate three times with PBS, and seed the cells at a density of 40%-80% to ensure that the cells are evenly attached to the slide.

[0303] (3) Fixation: Discard the culture medium and wash with PBS 1-2 times. Be careful to be gentle and avoid washing the cells off.

[0304] Immobilize cells with 500 μL of 4% paraformaldehyde for 15 min, discard the paraformaldehyde, add 500 μL of PBS and wash slowly on a shaker for 5 min, repeat 3 times.

[0305] (4) Penetration: Add 500 μL of 1% Triton X-100 PBS to punch holes for 15 min, aspirate the punching solution, add 500 μL of PBS and shake slowly for 5 min, repeat 3 times.

[0306] (5) Add 2% BSA and incubate in a shaker at room temperature for 30 minutes to block nonspecific proteins.

[0307] (6) Discard the BSA, add the primary antibody (TCF19 and Cyclin D2 diluted at a ratio of 1:100), and incubate on a shaker at 4°C for 16 hours.

[0308] (7) Recover the primary antibody, wash 2-3 times with PBS, add the fluorescent secondary antibody with the corresponding excitation wavelength, and dilute the secondary antibody with PBS according to the instructions. Incubate at 4°C in the dark for 2 hours.

[0309] (8) Add 500 μL PBS and shake slowly for 5 min on a shaker. Repeat 3 times.

[0310] (9) Add DAPI staining and incubate on a shaker at room temperature for 20 min. After incubation, wash with PBS on a shaker for 5 min, for a total of 3 times.

[0311] (10) The slide was transferred to a glass slide, fixed with neutral resin, and photographed and analyzed under a laser confocal fluorescence microscope. Results showed that the protein expression level of Cyclin D2 was also significantly increased when TCF19 was overexpressed. Figure 7 (C in the middle).

[0312] Immunohistochemical staining of TCF19 and Cyclin D2 in a mouse lung cancer model (details of the procedure have been described previously): TCF19 and Cyclin D2 are highly expressed in tumor tissues. Figure 7 D)

[0313] Immunohistochemical staining of TCF19 and Cyclin D2 was performed on a mouse subcutaneous tumor-bearing model (the specific steps have been detailed previously): After overexpression of TCF19, the protein expression level of Cyclin D2 also increased significantly. Figure 7 E in

[0314] Protein immunoblotting and quantitative real-time PCR (Q-PCR) experiments were performed on a mouse subcutaneous tumor-bearing model.

[0315] qPCR primers:

[0316] CyclinD2-QPCR-F (SEQ ID NO.32): TGCATGTTCCTAGCTTCC

[0317] CyclinD2-QPCR-R(SEQ ID NO.33):CTCTTGACGGAACTGCTG

[0318] (The specific steps have been detailed above): It can be observed that after overexpression of TCF19, the protein level and mRNA expression level of Cyclin D2 also significantly increased. Figure 7 (F and G in the middle)

[0319] Chromatin immunoprecipitation experiments were used to further verify that TCF19 binds to the promoter of the CyclinD2 gene and regulates the transcription of CyclinD2.

[0320] Cells were divided into an untreated group, a TCF19 overexpression group, and a TCF19 knockdown group for further treatment. Q-PCR primer sequences:

[0321] CyclinD2-chip-F(SEQ ID NO.34):GGATCGTGTTTGAAGTTTGGTC

[0322] CyclinD2-chip-R(SEQ ID NO.35):CCTTTTGGCTGAATGGGAGA

[0323] (Specific steps have been detailed above): The Q-PCR primer sequence binds to the CyclinD2 promoter sequence. Results indicate that TCF19 binds to the CyclinD2 gene promoter, regulating CyclinD2 transcription. Figure 7 (H in the text).

[0324] Example 6

[0325] The existence of the BRD4-TCF19-CyclinD2 pathway in lung adenocarcinoma has been confirmed.

[0326] Following JQ1 stimulation, BRD4 overexpression, BRD4 knockdown, Western blotting, and quantitative PCR (Q-PCR) experiments (details of which have been previously described), the protein and mRNA expression levels of TCF19 and CyclinD2 increased and decreased accordingly. Figure 8 (A, B, C, D, E, F in the original text).

[0327] After overexpressing BRD4 and knocking down TCF19, Western blotting and Q-PCR (details of which have been described previously) clearly showed that the protein and mRNA levels of TCF19 and Cyclin D2 increased and decreased accordingly. Figure 8 Based on the above, we can conclude that BRD4 regulates Cyclin D2 mRNA transcription by regulating TCF19 expression, thereby affecting its expression.

[0328] Example 7

[0329] 5-Fluorouracil can regulate chemotherapy resistance in lung adenocarcinoma by inhibiting BRD4, thereby affecting the expression of TCF19 and CyclinD2.

[0330] Lung adenocarcinoma cells A549 showed inhibitory effects on TCF19 expression after the addition of the anticancer drug 5-fluorouracil. After 12 hours of plating, the culture medium was replaced with 1640 medium containing 0.5% fetal bovine serum for 12 hours of starvation. Then, 5-fluorouracil was added, followed by treatment with time gradients (0 h, 12 h, 24 h, 48 h) and concentration gradients (0 μM, 0.05 μM, 0.5 μM, 5 μM). Cell proteins were extracted for Western blotting and Q-PCR (the specific experimental procedures have been detailed previously). The results showed that with increasing stimulation time and concentration of 5-fluorouracil, the protein and mRNA expression levels of TCF19 significantly decreased. Figure 9 (A, B, C, D in the list).

[0331] In lung adenocarcinoma cells A549, the protein and mRNA expression levels of BRD4, TCF19, and Cyclin D2 were significantly reduced after the addition of the anticancer drug 5-fluorouracil. After 12 hours of plating, the culture medium was changed to 1640 medium containing 0.5% fetal bovine serum for 12 hours of starvation. Then, 5-fluorouracil (final concentration 5 μM) was added for stimulation for 48 hours. Cell proteins were extracted for Western blotting and Q-PCR (details of which have been described previously). The protein and mRNA expression levels of BRD4, TCF19, and Cyclin D2 were significantly reduced. Figure 9 (E and F in the text). After knocking down TCF19, the addition of 5-fluorouracil resulted in lower cell viability compared to the control group. Figure 9 (G in the middle).

[0332] As demonstrated by the above examples, knocking down TCF19 can inhibit the proliferation of lung adenocarcinoma cells and enhance the chemotherapeutic effect of 5-fluorouracil. Furthermore, it was found that BRD4 is the upstream regulator of TCF19's elevated expression in lung adenocarcinoma; knocking down BRD4 significantly reduced both TCF19 mRNA and protein levels. Therefore, TCF19 has significant potential as a therapeutic target for lung adenocarcinoma and possesses considerable application prospects and medical value.

[0333] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.

Claims

1. The application of a substance that inhibits TCF19 in the preparation of a 5-fluorouracil chemosensitizer, characterized in that, The substance that inhibits TCF19 is the shRNA of TCF19; The sense strand of the shRNA is shown in SEQ ID NO. 1, and the antisense strand of the shRNA is shown in SEQ ID NO. 2; The shRNA inhibits lung adenocarcinoma proliferation by knocking down TCF19 and enhances the chemotherapeutic effect of 5-fluorouracil.

Images