Method for rapidly detecting watermelon silver mottle virus in plant by using RT-RPA (reverse transcription recombinase polymerase amplification) method
By combining recombinant polymerase amplification (RPA) with primer and probe design, the problem of rapid detection of watermelon silver mottle virus in plants in the field was solved, and efficient and simple virus detection was achieved, which is suitable for rapid diagnosis and identification in the field.
Patent Information
- Application Number
- CN202510990342.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-07-18
- Publication Date
- 2025-09-16
AI Technical Summary
Existing technologies make it difficult to quickly and easily detect watermelon silver mottle virus in plants in the field. Common methods are time-consuming and require specific instruments.
Recombinant polymerase amplification (RPA) combined with primer and probe design was used to rapidly detect watermelon silver mottle virus in plants under constant temperature conditions using RT-RPA reaction, and the detection results were verified by RT-PCR.
It has achieved efficient and simple detection of watermelon silver mottle virus in plants in a short time, which is suitable for rapid diagnosis and identification in the field and reduces disease losses.
Smart Images

Figure CN120648852A_ABST
Abstract
Description
Technical field:
[0001] The present invention relates to a rapid detection technology for watermelon silver mottle virus in plants and its application in disease diagnosis and forecasting, belonging to the field of agricultural science and technology. Background technology:
[0002] Watermelon silver mottle virus (WSMoV) belongs to the Bunyaviridae family and the genus Orthotospovirus. It primarily infects Solanaceae and Cucurbitaceae crops, causing symptoms such as chlorosis, ring spots, ring spots, and shrivel, resulting in severe economic losses. WSMoV is transmitted by palm yellow thrips in a persistent, cyclical manner and is not seed- or mechanically transmitted. Currently, no resistant crop varieties have been identified, and control primarily relies on insect vector control and antiviral agents.
[0003] Currently, commonly used methods for plant virus identification include biological inoculation experiments, serological testing, electron microscopy, and molecular biology. Most of these methods require specialized equipment and are time-consuming, making them unsuitable for rapid field testing. Recombinase polymerase amplification (RPA), a novel isothermal nucleic acid amplification method invented by Piepenburget et al. in 2006, is a highly sensitive strand-displacement technique and a novel alternative to PCR. RPA utilizes two specific primers and a specific probe designed for a single region of a target gene. The nucleic acid amplification reaction is completed in approximately 20 minutes at a constant temperature (37°C) using recombinases, a single-stranded DNA-binding protein, and a strand-displacing polymerase. Rapid lateral flow cytometry (LF) is used to detect RPA reaction products, providing direct and clear results. This approach eliminates the need for lengthy temperature cycling, expensive equipment like PCR machines, or cumbersome electrophoresis and UV-visible imaging. It has been widely used in the detection and rapid diagnosis of diseases caused by various viruses, bacteria, parasites, etc. in humans, animals and plants. Summary of the invention:
[0004] The invention provides a method for quickly detecting watermelon silver mottle virus in plants, by which it is possible to quickly diagnose whether the plants carry the virus.
[0005] The present invention provides a method for rapidly detecting watermelon silver mottle virus in plants, which is obtained by the following method:
[0006] 1) Based on the nucleotide sequence of watermelon silver mottle virus NP (PV177962.1) reported by NCBI, a relatively conserved region of 300-600 bp was selected after analysis using the DNAstar software. Multiple primers, including two primers NP-RPA-F and NP-RPA-R and one probe NP-probe, were designed using the online primer design software Primer blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome).
[0007] 2) Extract total RNA from plants using Trizol reagent;
[0008] 3) Reverse transcribe RNA into cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser.
[0009] 4) Screen the optimal primers based on agarose electrophoresis and test strip results and construct the RT-RPA reaction system;
[0010] 5) Using field samples, compare with the RT-PCR method to verify the reliability of the RT-RPA method for detecting WSMoV in plants;
[0011] The primer sequences provided by the present invention are as follows:
[0012] NP-RPA-F: 5'-CCTCCAATACATAACATCATCCTCAAGGCA-3'
[0013] NP-RPA-R: 5'-BIOTIN-AACAGAAGACTCCACTCCTGGATTTAGCTT-3'
[0014] NP-probe:5'-FAM-AAAAATTATACTTACCACTCTTACAGGCTG(THF)CAAAAATCTGTTTCCTGCAT-3'BLOCK.
[0015] The reaction temperature of RT-RPA was 37°C and the reaction time was 20 min.
[0016] The invention discloses a method for detecting watermelon silver mottle virus in plants, and its application includes rapid diagnosis and identification of suspected diseased plants.
[0017] This method can be used to quickly identify whether a plant is infected with watermelon silver mottle virus, and then take targeted prevention and control strategies to reduce losses caused by the disease. Description of the drawings:
[0018] Figure 1 : Detection of WSMoV in susceptible plants by RT-PCR (A, symptoms of WSMoV-infected cucumber; B, symptoms of WSMoV-infected melon; C, detection of WSMoV by RT-PCR).
[0019] Figure 2 :Screening of optimal primers for RT-RPA detection of WSMoV in plants.
[0020] Figure 3 : Comparison of RT-RPA and RT-PCR detection of WSMoV in field samples (A, RT-RPA detection of WSMoV in field samples; B, RT-PCR detection of WSMoV in field samples). Specific implementation method:
[0021] The methods used in the following examples are all conventional methods unless otherwise specified.
[0022] Example 1, Establishment of RT-RPA Detection Method for Watermelon Silver Mottle Virus
[0023] (1) Primer design
[0024] Primers were designed based on the watermelon silver mottle virus NP nucleotide sequence (PV177962.1) reported in NCBI. A relatively conserved sequence of 300-600 bp was selected as a template, and multiple primer pairs were designed using the online PrimerBlast primer design software (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=Blast Home).
[0025] The RT-PCR primer sequences are as follows:
[0026] WSMoV-F:5'-ATGTCTAACGTTAAGCAGCT-3'
[0027] WSMoV-R:5'-TTACACTTCCAAAGAAGTGC-3'
[0028] The optimal primer sequences for RT-RPA were determined as follows:
[0029] NP-RPA-F: 5'-CCTCCAATACATAACATCATCCTCAAGGCA-3'
[0030] NP-RPA-R: 5'-BIOTIN-AACAGAAGACTCCACTCCTGGATTTAGCTT-3'
[0031] NP-probe:5'-FAM-AAAAATTATACTTACCACTCTTACAGGCTG(THF)CAAAAATCTGTTTCCTGCAT-3'BLOCK.
[0032] (2) Establishment of RT-PCR method for detecting WSMoV
[0033] Diseased cucumber and melon plants were collected from Nanjing, Jiangsu Province. Total RNA was extracted from the samples using the Reagents (Kangwei Century) instructions. Reverse transcription was performed using the PrimeScript™ RT reagent kit with gDNA Eraser (Dalian Takara Biotech) to generate cDNA. PCR amplification was performed using the cDNA as a template using WSMoV-specific primers (WSMoV-F: ATGTCTAACGTTAAGCAGCT; WSMoV-R: TTACACTTCCAAAGAAGTGC). The PCR reaction system (20 μL) consisted of 10 μL of 2× Taq Master Mix (Nanjing Novozymes Biotech Co., Ltd.), 7 μL of ddH2O, 1 μL of each upstream and downstream primer, and 1 μL of cDNA. The reaction procedure was as follows: denaturation at 98°C for 5 min, 35 cycles of 98°C for 10 s, 54°C for 15 s, and 72°C for 30 s, followed by extension at 72°C for 10 min, and storage at 4°C. PCR products were separated by 1% agarose gel electrophoresis in 0.5× TAE electrophoresis buffer and imaged using a gel imaging system (Shanghai Tianneng Life Sciences Co., Ltd.). The WSMoV RT-PCR product was recovered by gel tapping, connected to the T vector and transformed into Escherichia coli DH5a, and the positive clones were selected for sequencing verification (Nanjing Qingke Biotechnology Co., Ltd.) Figure 1 ).
[0034] (3) Screening of optimal primers for RT-RPA detection of WSMoV
[0035] The RT-RPA reaction was performed using the TwistAmp nfo kit (TwistDx, UK) with a system consisting of 1 μl of cDNA, 30 μl of rehydration buffer, 2 μl of 10 mM NP-RPA-F primer, 2 μl of 10 mM NP-RPA-R primer, 0.5 μl of 10 mM NP-probe, and 2.5 μl of 280 mM magnesium acetate. The mixture was mixed and incubated at 37°C for 20 min. Ten μl of the RT-RPA reaction product was purified by agarose gel electrophoresis or diluted with 100 μl of detection buffer and directly detected using Milenia GenLine HybriDetect test strips (Milenia, Germany). The cDNA of diseased leaves showed obvious positive bands when detected by RT-RPA, while healthy leaves showed negative bands. This means that the optimal detection primers were successfully screened and the RT-RPA detection system for WSMoV in plants was established ( Figure 2 ).
[0036] (3) Comparative validation of RT-RPA and RT-PCR detection of WSMoV in field samples
[0037] RT-PCR is a commonly used method for detecting pathogens with high sensitivity and accuracy. To verify the accuracy of the RT-RPA method for detecting WSMoV, 10 melon samples were collected from leaves of WSMoV-infected and healthy plants. RNA was extracted and reverse transcribed into cDNA, and then the two methods were used for comparison. The experimental results showed that the results of RT-RPA and RT-PCR were consistent, that is, 8 samples showed WSMoV positive, and 2 samples had no obvious bands and were negative ( Figure 3 ). This shows that the RT-RPA WSMoV detection method of the present invention can be used for the detection of field samples.
[0038] The invention discloses a method for detecting watermelon silver mottle virus in plants, and its application includes: rapid diagnosis and identification of watermelon silver mottle virus in plants.
[0039] The above embodiments do not limit the present invention in any form.
Claims
1. A method for rapid detection of watermelon silver mottle virus in plants, characterized in that: Using specific primers for RT-RPA reaction, the reaction was carried out at 37°C for 20 minutes to identify watermelon silver mottle virus in the plants. The "specific primers for RT-RPA reaction" refer to the following three primers: NP-RPA-F:5'-CCTCCAATACATAACATCATCCTCAAGGCA-3' NP-RPA-R:5'-BIOTIN-AACAGAAGACTCCACTCCTGGATTTAGCTT-3'NP-probe:5'-FAM-AAAAATTATACTTACCACTCTTACAGGCTG(THF) CAAAAATCTGTTTCCTGCAT-3'BLOCK.