TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus as well as application and kit of TaqMan fluorescent quantitative primer combination

Abstract

The invention relates to the technical field of avian virus detection, in particular to a TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus as well as application and a kit of the TaqMan fluorescent quantitative primer combination. The TaqMan fluorescent quantitative primer combination for detecting the AJ / BK subtype avian leukosis virus comprises an AJ primer and a probe as well as a BK primer and a probe, and the sequences are shown as SEQ ID No.1-6. The RNA is directly detected by a one-step method, so that the detection speed is increased. According to the invention, only two fluorescence channels are used to increase sensitivity and convenience, the kit can distinguish endogenous and exogenous viruses, avoids endogenous viruses, and only can detect AJ / BK subtype avian leukosis viruses.

Description

Technical Field

[0001] The present invention relates to the technical field of avian virus detection, in particular to a TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus, an application thereof and a kit. Background Art

[0002] In recent years, people's living standards have continued to improve, and the demand for meat and eggs has continued to increase. However, my country still relies heavily on imported breeding poultry, urgently needing to accelerate the cultivation of local chicken breeds, and livestock and poultry development faces many difficulties and challenges.

[0003] Avian leukosis (AL) has a significant impact on the poultry industry. Avian leukosis (AL) is an infectious disease caused by the avian leukosis virus (ALV), a member of the retrovirus family. ALV poses a significant threat to the poultry industry, causing a variety of diseases in poultry, including tumors, immunosuppression, decreased productivity, egg drop syndrome, immunosuppression, and growth retardation. While ALV has been well-eradicated in imported chicken breeds, it remains a problem in domestic chicken breeding in my country, causing significant economic losses. Based on differences in envelope glycoproteins and host range, ALV can be divided into 11 subtypes, including A and K. Of these, A, B, C, D, J, and K are exogenous, while E is endogenous. Subtypes A and B are more common in commercial laying hens; subtype J has the highest pathogenicity and the widest range of impact, and subtype K is the most recently discovered subtype.

[0004] Currently available detection methods, such as ELISA, can rapidly analyze large numbers of clinical samples simultaneously. However, ELISA cannot eliminate the interference of endogenous viruses, especially in clinical samples that have not been isolated, cultured, and amplified by DF1 cells. Reverse transcription PCR (RT-PCR), a traditional nucleic acid-based detection method, can amplify the target gene of ALV and provide qualitative results. However, this method is labor-intensive, has low sensitivity, and is time-consuming when implemented on an industrial scale. Summary of the Invention

[0005] In order to solve the above problems, the present invention provides a TaqMan fluorescent quantitative primer combination and its application and kit for simultaneously detecting AJ / BK subtype avian leukosis virus. The primer combination provided by the present invention detects avian leukosis virus A / J and B / K subgroups, and has significant improvements in both operation time and kit performance. Its sensitivity and specificity are superior to existing detection methods. The application of this kit can greatly accelerate and simplify the purification of ALV.

[0006] In order to achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides a TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus, comprising an AJ primer and probe, and a BK primer and probe;

[0008] The nucleotide sequence of the upstream primer in the AJ primer probe is shown in SEQ ID No. 1, the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No. 3; the 5' end of the probe is provided with a fluorescent group, and the 3' end is provided with a quenching group; the AJ primer probe detects ALV-A and J subtypes;

[0009] The nucleotide sequence of the upstream primer in the BK primer probe is shown in SEQ ID No. 4, the nucleotide sequence of the downstream primer is shown in SEQ ID No. 5, and the nucleotide sequence of the probe is shown in SEQ ID No. 6; the 5' end of the probe is provided with a fluorescent group, and the 3' end is provided with a quenching group; the BK primer probe detects ALV-B and K subtypes.

[0010] Preferably, the fluorescent group includes FAM and HEX, and the quenching group includes MGB.

[0011] The present invention also provides the use of the TaqMan fluorescent quantitative primer combination described in the above technical solution in the preparation of a reagent for detecting AJ / BK subtype avian leukosis virus.

[0012] Preferably, the system used by the TaqMan fluorescent quantitative primer combination to detect AJ / BK subtype avian leukosis virus is:

[0013] 2×One Step Buffer 12.5μL, Enzyme Mix 1μL, Template 1.5μL, AJ primer probe upstream primer 0.5μL, AJ primer probe downstream primer 0.5μL, AJ primer probe middle probe 0.5μL, BK primer probe upstream primer 0.5μL, BK primer probe downstream primer 0.5μL, BK primer probe middle probe 0.5μL, ddH2O make up to 25μL.

[0014] Preferably, in the system, the final concentration of the upstream primer is 0.2 μM, the final concentration of the downstream primer is 0.2 μM, and the final concentration of the probe is 0.2 μM.

[0015] Preferably, the procedure used by the TaqMan fluorescent quantitative primer combination to detect AJ / BK subtype avian leukosis virus is: reverse transcription at 50°C for 15 minutes; pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing at 55°C for 30 seconds, and 40 cycles.

[0016] The present invention also provides a kit for detecting AJ / BK subtype avian leukosis virus, comprising the TaqMan fluorescent quantitative primer combination described in the above technical solution.

[0017] Preferably, the kit further comprises: 2×One Step Buffer and Enzyme Mix.

[0018] Beneficial effects:

[0019] 1. The present invention's one-step method directly detects RNA, accelerating detection. While RNA normally requires a two-step process (reverse transcription and amplification), the present invention utilizes a one-step method. The one-step method involves converting the viral RNA template into cDNA using reverse transcriptase, followed by real-time fluorescent PCR amplification of the cDNA using DNA polymerase, and finally reading the results.

[0020] 2. The present invention uses only two fluorescence channels to increase sensitivity and convenience. Adding more fluorescence channels often reduces sensitivity and increases operational complexity. However, the present invention simplifies the channels to two, greatly increasing sensitivity. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments are briefly introduced below.

[0022] Figure 1 Amplification curves and standard curves of ALV-AJ and ALV-BK dual qPCR;

[0023] Figure 2 It is the specific test amplification result of the duplex qPCR method;

[0024] Figure 3 The sensitivity test results of duplex qPCR and conventional PCR are shown;

[0025] Figure 4 Design of primers and probes for ALV-AJ;

[0026] Figure 5 Design of primers and probes for ALV-BK. DETAILED DESCRIPTION

[0027] The invention provides a TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus, comprising an AJ primer probe and a BK primer probe; the nucleotide sequence of the upstream primer in the AJ primer probe is shown as SEQ ID No.1, the nucleotide sequence of the downstream primer is shown as SEQ ID No.2, and the nucleotide sequence of the probe is shown as SEQ ID No.3; the 5' end of the probe is provided with a fluorescent group, and the 3' end is provided with a quenching group; the AJ primer probe detects ALV-A and ALV-J subtypes; the nucleotide sequence of the upstream primer in the BK primer probe is shown as SEQ ID No.4, the nucleotide sequence of the downstream primer is shown as SEQ ID No.5, and the nucleotide sequence of the probe is shown as SEQ ID No.6; the 5' end of the probe is provided with a fluorescent group, and the 3' end is provided with a quenching group; the BK primer probe detects ALV-B and ALV-K subtypes.

[0028] The full genome sequences of 46 strains of ALV-A, B, J, and K registered in the GenBank database were used as reference sequences. Multiple sequence alignment analysis was performed using ClustalW. Finally, the primers and probes for ALV-AJ were selected within the LTR region ( Figure 4 ), ALV-BK primers and probes were selected in the gp85 gene region ( Figure 5 ), where the ALV-AJ primers and probes were not selected in the env gene. Different from the conventional design thinking, a set of highly specific primers and probes were finally designed.

[0029] SEQ ID No. 1:

[0030] GGAAGGCAACAGACGGGTCT;

[0031] SEQ ID No. 2:

[0032] GGTAAAATGGCATTTATTGTGT;

[0033] SEQ ID No.3:

[0034] HEX-CTAGGCACTTAAATACA-MGB;

[0035] SEQ ID No.4:

[0036] GCGGATAGACACAATCTTTTT;

[0037] SEQ ID No.5:

[0038] TTTCCTTTGACTGATTAACCCA;

[0039] SEQ ID No.6:

[0040] FAM-CCTCCTGTGCKTGT-MGB(K=G,T).

[0041] In the present invention, the fluorescent group preferably includes FAM and HEX, and the quencher group preferably includes MGB.

[0042] The present invention also provides the use of the TaqMan fluorescent quantitative primer combination described in the above technical solution in the preparation of a reagent for detecting AJ / BK subtype avian leukosis virus.

[0043] In the present invention, the system used for the TaqMan fluorescent quantitative primer combination detection of AJ / BK subtype avian leukosis virus is preferably: 2×One Step Buffer 12.5 μL, Enzyme Mix 1 μL, template 1.5 μL, 0.5 μL of upstream primer in AJ primer probe, 0.5 μL of downstream primer in AJ primer probe, 0.5 μL of probe in AJ primer probe, 0.5 μL of upstream primer in BK primer probe, 0.5 μL of downstream primer in BK primer probe, 0.5 μL of probe in BK primer probe, ddH2O is supplemented to 25 μL. In the present invention, the final concentration of the upstream primer in the system is preferably 0.2 μM, the final concentration of the downstream primer is preferably 0.2 μM, and the final concentration of the probe is preferably 0.2 μM. The present invention is not particularly limited to the source of the above reagents, and conventional commercially available reagents can be used, such as 2×One Step Buffer and Enzyme Mix, which are both purchased from Hanhai New Enzyme Biotechnology Co., Ltd.

[0044] In the present invention, the procedure used by the TaqMan fluorescent quantitative primer combination to detect AJ / BK subtype avian leukosis virus is preferably: reverse transcription at 50°C for 15 minutes; pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing at 55°C for 30 seconds, and 40 cycles.

[0045] The above sample templates were processed according to routine samples, extracted by an automatic nucleic acid extraction instrument, and stored at -80°C for testing.

[0046] The present invention also provides a kit for detecting AJ / BK subtype avian leukosis virus, comprising the TaqMan fluorescent quantitative primer combination described in the above technical solution. In the present invention, the kit also preferably comprises: 2×One Step Buffer and Enzyme Mix.

[0047] In order to further illustrate the present invention, the present invention is described in detail below with reference to the embodiments, but they should not be construed as limiting the scope of protection of the present invention.

[0048] Example 1

[0049] A TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus, comprising an AJ primer probe and a BK primer probe;

[0050] ALV-AJ-F (SEQ ID No. 1): GGAAGGCAACAGACGGGTCT;

[0051] ALV-AJ-R (SEQ ID No. 2): GGTAAAATGGCATTTATTGTGT;

[0052] ALV-AJ-P (SEQ ID No. 3): HEX-CTAGGCACTTAAATACA-MGB.

[0053] ALV-BK-F (SEQ ID No. 4): GCGGATAGACACAATCTTTTT;

[0054] ALV-BK-R (SEQ ID No. 5): TTTCCTTTGACTGATTAACCCA;

[0055] ALV-BK-P (SEQ ID No. 6): FAM-CCTCCTGTGCKTGT-MGB, (K=G,T).

[0056] The probes are all provided with a fluorescent group at the 5' end and a quenching group at the 3' end.

[0057] System: The total volume of the TaqMan fluorescent quantitative reaction system is 25 μL, and the PCR reaction system includes 2×One Step Buffer 12.5 μL, Enzyme Mix 1 μL, template (nucleic acid extracted from serum, meconium, organs, feathers, etc.) 1.5 μL, upstream and downstream primers (ALV-AJ-F, ALV-AJ-R, ALV-BK-F, ALV-BK-R) and probes (ALV-AJ-P-HEX, ALV-BK-P-FAM) are all 0.5 μL, with a final concentration of 0.2 μM, and double distilled water is added to 25 μL.

[0058] TaqMan fluorescence quantitative reaction conditions: reverse transcription at 50°C for 15 minutes, pre-denaturation at 95°C for 3 minutes, denaturation at 94°C for 15 seconds, and annealing at 55°C for 30 seconds, for 40 cycles. Finally, if positive and negative controls are established, a CT value ≤ 36 is considered positive, a CT value between 37 and 40 is considered questionable positive, and a CT value > 40 is considered negative.

[0059] ① Establishment of standard curve

[0060] ALV-AJ-F / R was used to amplify the universal fragments of ALV-A and J using ALV-J as a template. The amplified products that met the expected size were gel-purified and then ligated with the pTOPO-TA vector and transformed into competent cells to construct the recombinant plasmid pTOPO-TA-ALV-AJ, which was then identified by PCR and sequencing. The universal fragments of ALV-B and K were synthesized by GenScript Biotech Co., Ltd. and named pUC-57-ALV-BK. The DNA concentration of the standard was determined using a micro-UV spectrophotometer. The DNA was first diluted to 10 × 10 10 copies / μL, and then diluted step by step to 5×10 10 Copies / μL, TaqMan fluorescence quantitative PCR amplification, establish a standard curve (such as Figure 1 (A is the AJ standard curve, B is the BK standard curve). The linear equation for the ALV-AJ standard curve was y = -3.418x + 46.184, R² = 0.999, and E = 96.2%. The linear equation for the ALV-BK standard curve was y = -3.484x + 49.178, R² = 0.998, and E = 93.6%. This indicates that the different plasmid standard mixtures have a good linear relationship with their respective Ct values.

[0061] ②Specificity analysis

[0062] The one-step dual TaqMan fluorescence quantitative PCR detection method established in this example was used for detection using Marek's virus (MDV), chicken infectious anemia virus (CIAV), Newcastle disease virus (NDV), and avian influenza virus (AIV) nucleic acid materials as templates, and NTC (No Template Control) and positive control pTOPO-TA-ALV-AJ and pUC-57-ALV-BK plasmids.

[0063] Results (such as Figure 2 ) showed that the kit can specifically amplify avian leukosis virus.

[0064] ③ Sensitivity analysis

[0065] The recombinant plasmids pTOPO-TA-ALV-AJ and pUC-57-ALV-BK were diluted 10-fold, and the concentrations after dilution were 1×10 6 , 1×10 5 , 1×10 4 , 1×10 3 , 1×10 2 , 1×10 1 copies / μL, results (such as Figure 3 ) showed that this method can effectively detect avian leukosis virus AJ subtype with a minimum nucleic acid copy of 101 The minimum nucleic acid copy quantity for the effective detection of avian leukosis virus BK subtype is 10 copies / μL. 2 copies / μL.

[0066] ④Repeatability analysis

[0067] 1×10 8 , 1×10 7 Quantitative PCR was performed using 1000 copies / μL of PBS as a template, with three replicates per concentration. The intra-group reproducibility was tested, and the inter-group reproducibility was tested by repeating the procedure three times. The results showed that both the intra-group and inter-group coefficients of variation were less than 1% (see Table 1 below), indicating good reproducibility and stable results.

[0068] Table 1 Repeatability results

[0069]

Claims

1. A TaqMan fluorescent quantitative primer combination for detecting AJ / BK subtype avian leukosis virus, characterized in that: Includes AJ primers and probes and BK primers and probes; The nucleotide sequence of the upstream primer in the AJ primer probe is shown in SEQ ID No. 1, the nucleotide sequence of the downstream primer is shown in SEQ ID No. 2, and the nucleotide sequence of the probe is shown in SEQ ID No. 3; the 5' end of the probe is provided with a fluorescent group, and the 3' end is provided with a quenching group; the AJ primer probe detects ALV-A and J subtypes; The nucleotide sequence of the upstream primer in the BK primer probe is shown in SEQ ID No. 4, the nucleotide sequence of the downstream primer is shown in SEQ ID No. 5, and the nucleotide sequence of the probe is shown in SEQ ID No. 6; the 5' end of the probe is provided with a fluorescent group, and the 3' end is provided with a quenching group; the BK primer probe detects ALV-B and K subtypes.

2. The TaqMan fluorescent quantitative primer combination according to claim 1, characterized in that: The fluorescent group includes FAM or HEX, and the quenching group includes MGB.

3. Use of the TaqMan fluorescent quantitative primer combination according to claim 1 or 2 in the preparation of a reagent for detecting AJ / BK subtype avian leukosis virus.

4. The use according to claim 3, characterized in that The system used by the TaqMan fluorescent quantitative primer combination to detect AJ / BK subtype avian leukosis virus is: 2×One Step Buffer 12.5μL, Enzyme Mix 1μL, Template 1.5μL, AJ primer probe upstream primer 0.5μL, AJ primer probe downstream primer 0.5μL, AJ primer probe middle probe 0.5μL, BK primer probe upstream primer 0.5μL, BK primer probe downstream primer 0.5μL, BK primer probe middle probe 0.5μL, ddH2O make up to 25μL.

5. The use according to claim 3, characterized in that In the system, the final concentration of the upstream primers was 0.2 μM, the final concentration of the downstream primers was 0.2 μM, and the final concentration of the probes was 0.2 μM.

6. The use according to claim 3, characterized in that The program used by the TaqMan fluorescent quantitative primer combination to detect AJ / BK subtype avian leukosis virus is: reverse transcription at 50°C for 15 minutes; pre-denaturation at 95°C for 3 minutes; denaturation at 94°C for 15 seconds, annealing at 55°C for 30 seconds, and 40 cycles.

7. A kit for detecting AJ / BK subtype avian leukosis virus, characterized in that: The method comprises the TaqMan fluorescent quantitative primer combination according to claim 1.

8. The kit according to claim 7, characterized in that The kit further includes: 2×One Step Buffer and Enzyme Mix.

Images