Application of MARCH2 gene as target spot in inhibition of avian leukosis virus replication

Abstract

The invention discloses an application of an MARCH2 gene as a target spot in inhibition of replication of an avian leukosis virus (ALV), and further discloses an MARCH2 gene overexpression cell line, a construction method of the MARCH2 gene overexpression cell line and an application of the MARCH2 gene overexpression cell line in inhibition of infection of different subgroups of ALV. The MARCH2 gene overexpression cell line is successfully constructed through a lentivirus packaging infection technology, and experimental results show that the cell line can significantly inhibit replication of ALVs of different subgroups. The overexpressed MARCH2 gene or the expression of the encoded protein of the overexpressed MARCH2 gene can effectively inhibit the replication of ALV of different subgroups. The discovery provides a technical means for carrying out anti-ALV infection disease-resistant breeding work by taking the MARCH2 gene as a target spot in the future, and has a wide application prospect.

Description

Technical Field

[0001] The present invention relates to a new target for inhibiting the replication of avian leukosis virus, and in particular to the application of MARCH2 gene or its encoded protein in inhibiting the replication of avian leukosis virus. The present invention belongs to the field of biological genetic engineering technology. Background Art

[0002] Avian leukosis virus (ALV) is the main pathogen of avian leukosis. It is mainly transmitted vertically, and there is currently no effective vaccine or drug control measure, relying only on the continuous purification of breeder flocks. However, ALV has the characteristics of latent infection and genome integration. Once infected, the virus is carried for life, and once the purification measures are interrupted, the infection rate is very likely to rebound. Therefore, traditional purification methods are difficult to completely block the spread of ALV, and the development of new prevention and control technologies is urgent. From the perspective of the host, targeting the key host factors that the virus relies on for replication and establishing new antiviral strategies are expected to fundamentally block ALV infection and provide new ideas and directions for the breeding of disease-resistant breeder poultry.

[0003] MARCH2 (Membrane-Associated RING-CH-Type Finger 2) is a member of the MARCH family of E3 ubiquitin ligases. Localized at membrane structures such as the cell membrane and the Golgi apparatus, MARCH2 regulates the stability, endocytosis, and degradation of membrane proteins through ubiquitination, participating in immune responses, cell signaling, and membrane trafficking. Studies have shown that MARCH2 can directly or indirectly affect viral replication by ubiquitinating viral or host proteins. For example, in hepatitis B virus (HBV) infection, MARCH2 ubiquitinates viral surface proteins (such as HBsAg) to promote their lysosomal degradation, thereby inhibiting viral particle secretion. Furthermore, in infections with certain RNA viruses, such as dengue virus, MARCH2 may enhance host antiviral immunity by regulating interferon signaling or viral receptor internalization. Furthermore, MARCH2 activity can be hijacked by viruses; some viruses, such as HIV-1, may exploit the host ubiquitination system to promote protein stability or immune evasion. Therefore, MARCH2 has bidirectional regulatory potential in virus-host interactions and is a potential target for antiviral drug development.

[0004] Based on this, the present invention focuses on the host MARCH2 molecule to explore its regulatory effect and molecular mechanism on ALV replication, aiming to provide a theoretical basis for screening new antiviral targets and developing efficient anti-ALV technologies, and to contribute to the security of poultry seed sources and the revitalization of the seed industry in my country. Summary of the Invention

[0005] The purpose of the present invention is to provide a new target for inhibiting the replication of avian leukosis virus.

[0006] In order to achieve the above-mentioned purpose, the present invention adopts the following technical means.

[0007] The present invention proposes the use of a drug designed with the MARCH2 gene or its encoded protein as a target in the preparation of a drug for inhibiting avian leukosis virus. The drug designed with the MARCH2 gene as a target can upregulate the expression of the MARCH2 gene.

[0008] Among them, preferably, the NCBI Gene ID of the MARCH2 gene is 420062.

[0009] Furthermore, the present invention also proposes the use of a MARCH2 gene overexpression vector in the preparation of a drug for inhibiting avian leukosis virus.

[0010] Among them, preferably, the MARCH2 gene overexpression vector is a lentiviral expression vector containing the MARCH2 gene.

[0011] Among them, preferably, the lentiviral expression vector is a pLVX-mCherry vector containing the MARCH2 gene.

[0012] Furthermore, the present invention also proposes a method for constructing a DF-1 cell line overexpressing the MARCH2 gene, comprising the following steps: (1) Vector construction According to the MARCH2 gene sequence in NCBI, primers were designed: ; The MARCH2 coding sequence was amplified and inserted into the pLVX-mCherry vector to construct a lentiviral packaging plasmid named pLVX-MARCH2-Flag; (2) Construction and screening of MARCH2 overexpressing cell lines The pLVX-MARCH2-Flag, pcGP, and pVSV-G plasmids were co-transfected into 293T cells to package the lentivirus. DF-1 cells were infected with the packaged MARCH2 lentivirus. After 48 hours of culture, cells expressing mCherry fluorescence were selected using a flow cytometer and plated into 96-well plates. Seven days later, monoclonal cell lines were identified under a light microscope and expanded. Western blotting was used to determine whether MARCH2 was successfully overexpressed, resulting in a MARCH2-overexpressing DF-1 cell line.

[0013] The MARCH2 gene overexpressing DF-1 cell line constructed according to the method described is also within the protection scope of the present invention.

[0014] Furthermore, the present invention also proposes the use of the MARCH2 gene overexpressing DF-1 cell line in inhibiting the replication of avian leukosis virus.

[0015] And the application of the MARCH2 gene overexpression DF-1 cell line in animal breeding for resistance to avian leukosis virus.

[0016] Among them, preferably, the avian leukosis virus is subgroup A avian leukosis virus, subgroup B avian leukosis virus or subgroup J avian leukosis virus.

[0017] Compared with the prior art, the present invention has the following beneficial effects: 1. The present invention discovered for the first time that overexpression of the MARCH2 gene can inhibit the replication of different subgroups of avian leukosis virus, and can be used as a drug for preparing a drug for inhibiting the replication of avian leukosis virus.

[0018] 2. The present invention successfully constructed a cell line overexpressing the MARCH2 gene through lentiviral packaging and infection technology. Experimental results showed that this cell line can significantly inhibit the replication of different subgroups of ALV and can be used for animal breeding resistant to different subgroups of avian leukosis virus. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 Western blot detection of MARCH2 overexpressing cell lines; Figure 2 Fluorescence quantitative PCR was used to detect the effect of MARCH2 overexpression on ALV-A replication; Figure 3 Western blot was used to detect the effect of MARCH2 overexpression on ALV-A replication; Figure 4 To detect the effect of MARCH2 overexpression on ALV-B replication by quantitative PCR; Figure 5 Western blot was used to detect the effect of MARCH2 overexpression on ALV-B replication; Figure 6 To detect the effect of MARCH2 overexpression on ALV-J replication by fluorescence quantitative PCR; Figure 7 Western blot was used to detect the effect of MARCH2 overexpression on ALV-J replication. DETAILED DESCRIPTION

[0020] The experimental method of the present invention is described in detail below in conjunction with the examples to more clearly illustrate its technical features and implementation steps. It should be understood by those skilled in the art that the embodiments are merely typical examples of the present invention and do not constitute any limitation to the scope of the present invention. Without departing from the spirit and scope of the present invention, the technical details may be adjusted or replaced, and these adjustments and replacements all fall within the scope of protection of the present invention.

[0021] Example 1 Construction and identification of MARCH2 overexpressing cell lines Materials and Methods 1. Main experimental materials DF-1 cells, ALV-A, ALV-B, and ALV-J were maintained in our laboratory; anti-ALV p27 mouse monoclonal antibody was prepared in our laboratory; RNAiso Plus was purchased from Dalian Takara Biotechnology Co., Ltd.; NP40 lysis buffer was purchased from Shanghai Bio-Tech; THUNDERBIRD™ SYBR® qPCR Mix was purchased from TOYOBO; reverse transcription reagent was purchased from Vazyme; 5× SDS PAGE loading buffer was purchased from Solebro; mouse anti-β-actin monoclonal antibody was purchased from Sigma; pLVX-mCherry, pcGP, and pVSV-G plasmids were maintained in our laboratory.

[0022] 2. Vector Construction Based on the MARCH2 gene (Gene ID: 420062) sequence in NCBI (https: / / www.ncbi.nlm.nih.gov / ), primers (MARCH2-F: AGAGGATCTATTTCCGGTGAATTCatgacgacgggcgactgc (SEQ ID NO. 1) and MARCH2-R: TCTAGAACTAGTCTCGAGGAATTCTTACTTATCGTCGTCATCCTTGTAATCgacagtggtctcatccgc (SEQ ID NO. 2)) were designed. The MARCH2 coding sequence was amplified using DF-1 cell cDNA as a template and inserted into the pLVX-mCherry vector to construct the pLVX-MARCH2-Flag lentiviral packaging plasmid.

[0023] 3. Construction and Screening of MARCH2 Overexpressing Cell Lines The pLVX-MARCH2-Flag, pcGP, and pVSV-G plasmids were co-transfected into 293T cells for lentiviral packaging. DF-1 cells (chicken embryo fibroblasts) were infected with the packaged MARCH2 lentivirus. After 48 hours of culture, cells expressing mCherry fluorescence were selected using a flow cytometer and seeded into 96-well plates at a dilution ratio of 5 cells / well. Seven days later, single clones were identified under a light microscope and expanded. Successful MARCH2 overexpression was confirmed by Western blotting. MARCH2-overexpressing cells were lysed with 100 μL of NP40 cell lysis buffer on ice for 30 minutes. Then, 25 μL of 5× protein loading buffer was added and the sample was boiled at 100°C for 15 minutes. A 10 μL sample was then subjected to SDS-PAGE electrophoresis. The proteins were then transferred to a NC membrane and blocked with 5% skim milk powder for 1 hour. After incubation with mouse anti-Flag antibody and mouse anti-β-actin as primary antibodies at room temperature for 1 h, the NC membrane was washed 5 times with 1×PBST. Then, goat anti-mouse IgG was used as secondary antibody and incubated at room temperature for 1 h. After that, the NC membrane was washed 5 times with 1×PBST and imaged using a near-infrared fluorescence scanning imaging system.

[0024] 4. Virus Infection Experiment MARCH2 overexpressing cell lines and wild-type DF-1 cell lines were each taken at 5×10 5 The cells were plated into 12-well plates at a density of 10 cells / well. After 16 h, ALV-A, ALV-B and ALV-J strains were inoculated at an MOI of 0.1, with three parallel wells set up for each.

[0025] 5. Real-time fluorescence quantitative PCR detection 72 hours after infection, cells were harvested with 200 μL of PBS, and total RNA was extracted using the Trizol lysis method. Viral RNA was reverse transcribed using a Vazyme reverse transcription kit. First, 1 μg of viral RNA was mixed with 4 μL of 4×gDNA wiper mix and diluted to 16 μL with RNase-free ddH2O. Genomic DNA was removed by incubation at 42°C for 2 minutes. Then, 4 μL of 5× HiscniptⅡqRT SupermixⅡ reverse transcriptase was added to the tube. Mix thoroughly by pipetting, and reverse transcription was performed at 50°C for 15 minutes and 85°C for 5 seconds to obtain cDNA. ALV mRNA levels were relative quantified using cDNA as a template and β-actin as an internal reference gene. THUNDERBIRD™ SYBR® QPCR Mix was used for fluorescence quantitative PCR detection according to the protocol of 95°C for 30 s, 95°C for 10 s, and 60°C for 25 s for 40 cycles (primers: RT-ALV-F: GCAGCGAGATGCGAAGAT (SEQ ID NO. 3), RT-ALV-R: CCGCCAGGGAAGGATACA (SEQ ID NO. 4); RT-actin-F: CAACACAGTGCTGTCTGGTGGTA (SEQ ID NO. 5), RT-actin-R: ATCGTACTCCTGCTTGCTGATCC (SEQ ID NO. 6);).

[0026] 6. Western Blot 72 hours after infection, cells were lysed with 100 μL of NP40 cell lysis buffer on ice for 30 minutes. Then, 25 μL of 5× protein loading buffer was added and the sample was boiled at 100°C for 15 minutes. 10 μL of the sample was subjected to SDS-PAGE electrophoresis. The proteins were then transferred to a NC membrane and blocked with 5% skim milk powder for 1 hour. After incubation with mouse anti-ALV p27 and mouse anti-β-actin primary antibodies at room temperature for 1 hour, the membrane was washed five times with 1× PBST. Then, goat anti-mouse IgG was incubated as a secondary antibody at room temperature for 1 hour. After incubation, the membrane was washed five times with 1× PBST and imaged using a near-infrared fluorescence imaging system.

[0027] result 1. Construction and screening of MARCH2 overexpressing cell lines The packaged MARCH2 lentivirus was used to infect wild-type DF-1 cells. After 48 hours, mCherry fluorescence was clearly observed under an inverted fluorescence microscope. Cells with mCherry fluorescence were screened using a flow cytometry system and expanded for single cloning. Western blot experiments were performed on the screened cell lines. The results showed that specific bands were detected in the MARCH2 overexpressing cell line, but not in the wild-type control cells, indicating that the MARCH2 gene overexpression cell line was successfully constructed ( Figure 1 ).

[0028] 2. MARCH2 overexpression inhibits ALV-A replication To investigate the effect of MARCH2 overexpression on ALV-A replication, wild-type DF-1 cell lines and MARCH2-overexpressing DF-1 cell lines were infected with ALV-A. Cells were collected 72 hours after infection, and total RNA was extracted and reverse transcribed for RT-qPCR analysis. The results showed that compared with the wild-type cell line, the viral load of ALV-A in the MARCH2-overexpressing DF-1 cell line was significantly reduced ( Figure 2 ), indicating that overexpression of MARCH2 can effectively inhibit ALV-A replication. To further verify this result, cells were collected 72 hours after infection and Western blot analysis was performed to detect the expression of the viral structural protein p27. The results showed that in the DF-1 cell line with MARCH2 overexpression, the viral protein level was significantly reduced ( Figure 3 ), indicating that DF-1 cell lines overexpressing MARCH2 can effectively inhibit ALV-A replication compared with wild-type cell lines.

[0029] 3. MARCH2 overexpression inhibits ALV-B replication To investigate the effect of MARCH2 gene overexpression on ALV-B replication, wild-type DF-1 cell lines and MARCH2-overexpressing DF-1 cell lines were infected with ALV-B. Cells were collected 72 hours after infection, and total RNA was extracted and reverse transcribed for RT-qPCR analysis. The results showed that compared with the wild-type cell line, the viral load of ALV-B in the MARCH2-overexpressing DF-1 cell line was significantly reduced ( Figure 4 ), indicating that overexpression of MARCH2 can effectively inhibit ALV-B replication. To further verify this result, cells were collected 72 hours after infection and Western blot analysis was performed to detect the expression of the viral structural protein p27. The results showed that the viral protein level in the DF-1 cell line with MARCH2 overexpression was significantly reduced ( Figure 5 ), indicating that DF-1 cell lines overexpressing MARCH2 can effectively inhibit ALV-B replication compared with wild-type cell lines.

[0030] 4. MARCH2 overexpression inhibits ALV-J replication To investigate the effect of MARCH2 gene overexpression on ALV-J replication, wild-type DF-1 cell lines and MARCH2-overexpressing DF-1 cell lines were infected with ALV-J. Cells were collected 72 hours after infection, and total RNA was extracted and reverse transcribed for RT-qPCR analysis. The results showed that compared with the wild-type cell line, the viral load of ALV-J in the MARCH2-overexpressing DF-1 cell line was significantly reduced ( Figure 6 ), indicating that overexpression of MARCH2 can effectively inhibit ALV-J replication. To further verify this result, cells were collected 72 hours after infection and Western blot analysis was performed to detect the expression of the viral structural protein p27. The results showed that the viral protein level in the DF-1 cell line with MARCH2 overexpression was significantly reduced ( Figure 7 ), indicating that DF-1 cell line overexpressing MARCH2 can effectively inhibit ALV-J replication compared with wild-type cell line.

Claims

1. Use of a drug designed with the MARCH2 gene or its encoded protein as a target in the preparation of a drug for inhibiting the replication of avian leukosis virus (ALV), characterized in that: The drug designed with the MARCH2 gene or its encoded protein as a target can upregulate the expression of the MARCH2 gene.

2. The use according to claim 1, characterized in that The NCBI Gene ID of the MARCH2 gene is 420062.

3. Application of MARCH2 gene overexpression vector in the preparation of drugs for inhibiting avian leukosis virus replication.

4. The use according to claim 3, characterized in that The MARCH2 gene overexpression vector is a lentiviral expression vector containing the MARCH2 gene.

5. The use according to claim 4, characterized in that The lentiviral expression vector is a pLVX-mCherry vector containing the MARCH2 gene.

6. A method for constructing a DF-1 cell line overexpressing the MARCH2 gene, characterized in that: The following steps are involved: (1) Vector construction According to the MARCH2 gene sequence in NCBI, primers were designed: ； The MARCH2 coding sequence was amplified and inserted into the pLVX-mCherry vector to construct a lentiviral packaging plasmid named pLVX-MARCH2-Flag; (2) Construction and screening of MARCH2 overexpressing cell lines The pLVX-MARCH2-Flag, pcGP, and pVSV-G plasmids were co-transfected into 293T cells to package the lentivirus. The packaged MARCH2 lentivirus was used to infect DF-1 cells. After 48 h of culture, cells with mCherry fluorescence were selected using a flow cytometer and plated into 96-well plates. After 7 days, monoclonal cell lines were selected under an optical microscope and expanded. Western blotting was used to detect successful overexpression of MARCH2, and a MARCH2 gene-overexpressing DF-1 cell line was obtained.

7. The MARCH2 gene-overexpressing DF-1 cell line constructed according to the method of claim 6.

8. Use of the MARCH2 gene-overexpressing DF-1 cell line according to claim 7 in inhibiting the replication of avian leukosis virus.

9. Use of the MARCH2 gene-overexpressing DF-1 cell line according to claim 7 in animal breeding for resistance to avian leukosis virus.

10. The use according to claim 8 or 9, characterized in that The avian leukosis virus is A subgroup avian leukosis virus, B subgroup avian leukosis virus or J subgroup avian leukosis virus.

Images