Recombinant escherichia coli with high yield of gadusol and application of recombinant escherichia coli

Abstract

The invention relates to recombinant escherichia coli with high yield of gadusol and application of the recombinant escherichia coli, and belongs to the technical field of genetic engineering. The method comprises the following steps: firstly, expressing gadusol synthetic pathway related enzymes, namely EEVS and MT-OX, in escherichia coli, and secondly, systematically modifying a metabolic pathway, namely enhancing the expression of glucose-6-phosphate dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1, and knocking out 6-phosphofructokinase, transaldolase genes and phosphoglycerate kinase genes at the same time. In addition, an efficient circulating system of cofactors SAM and NAD + is also constructed, and 4.2 g / L gadusol is synthesized by recombinant escherichia coli in a 5-L fermentation tank amplification system and is far higher than the highest yield in the prior art. According to the invention, efficient production of the gadusol is realized through engineering transformation of escherichia coli, and a foundation is laid for industrial preparation of the gadusol.

Description

Technical Field

[0001] The present invention relates to the technical field of genetic engineering, in particular to a recombinant Escherichia coli with high gadusol production and application thereof. Background Art

[0002] In recent years, with the continuous advancement of scientific research, public awareness of the harmful effects of UV rays has gradually increased. Excessive UV radiation not only causes sunburn and tanning, but long-term exposure can also lead to health problems such as skin aging, pigmentation, and even skin cancer. This has led to sustained growth in the sunscreen cosmetics market, fueling growing consumer demand for sunscreen products.

[0003] Sunscreens, as core ingredients in sunscreen cosmetics, play a key role in protecting against UV damage. Currently, the main ingredients in widely used sunscreens are typical organic sunscreens such as octinoxate and benzophenone-3. These agents persist in environmental media through processes such as photodegradation and biological metabolism, posing a threat to the structural and functional stability of regional ecosystems.

[0004] Gadusol is a natural UV protectant with sunscreen, antioxidant, and anti-inflammatory properties. Gadusol is primarily derived from zebrafish and is found in high concentrations in the eggs of certain marine fish. Its function is to protect cells from UV radiation damage. Numerous studies have reported that gadusol also possesses antioxidant properties. Various antioxidant experiments have confirmed that gadusol is comparable to ascorbic acid in free radical reduction reactions and has a strong ability to disrupt peroxyl radical chain reactions. In this context, the complementary nature of gadusol's UV protection and antioxidant properties promotes the development of more effective and safer photoprotective agents.

[0005] Currently, gadusol is mostly extracted from marine organisms, which is costly and has a low extraction yield. In terms of microbial fermentation, gadusol is only primarily expressed in Saccharomyces cerevisiae cells, Escherichia coli, and Pichia pastoris, and its biosynthetic pathway has not been optimized. The synthesis yield is low (the highest is only 146 mg / L), which hinders the further commercialization of gadusol. Escherichia coli hosts have advantages such as clear genetic background, simple technical operations, simple culture conditions, and large-scale fermentation economy. Therefore, applying gadusol to recombinant Escherichia coli for expression and production, and optimizing and transforming its synthesis pathway, is of great significance for the industrial production and yield improvement of gadusol. Summary of the Invention

[0006] Therefore, the technical problem to be solved by the present invention is to overcome the problem that the prior art lacks a method for efficiently biosynthesizing gadusol.

[0007] To solve the above technical problems, the present invention provides a recombinant Escherichia coli with high gadusol production and its application. The recombinant Escherichia coli of the present invention is based on Escherichia coli and undergoes the following modifications: overexpression of EEVS enzyme, MT-OX enzyme, glucose-6-phosphate-dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1, and knockout of 6-phosphofructokinase, transaldolase gene and phosphoglycerate kinase. Among them, the expression of EEVS enzyme and MT-OX enzyme is co-regulated by promoters Ppsh and RBS, respectively. The recombinant Escherichia coli after the above modification has a gadusol production of 700-800 mg / L, which is much higher than the biosynthesis amount of 146 mg / L in the prior art. Furthermore, the present invention also optimizes the regulated expression of cofactors, using different promoters to regulate the overexpression of MetE, metk and Luxs, and overexpression of NADPH oxidase (NoxE), achieving a high yield of 4.2 g / L in a 5L fermentation tank scale-up system.

[0008] The first object of the present invention is to provide a recombinant Escherichia coli with high gadusol production, wherein the recombinant Escherichia coli is modified as follows: EEVS enzyme, MT-OX enzyme, glucose-6-phosphate-dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1 are overexpressed, and 6-phosphofructokinase, transaldolase and phosphoglycerate kinase are knocked out.

[0009] Furthermore, the EEVS enzyme and MT-OX enzyme are respectively co-regulated by the promoter Ppsh and the RBS whose gene sequence is as shown in SEQ ID NO.2-4. The gene sequence of the promoter Ppsh is shown in SEQ ID NO.1, and the gene sequence of the RBS is shown in SEQ ID NO.2-4.

[0010] Further, SEQ ID NO.1:

[0011] CTGGCACACCTTTTGCACAATATGACGATCAAAAATAGAGGCGCG CCCCTCCTTGACACTGAATTTAGCATGTGATATAATTAACTTAATATTCTACCCAAGCTTATAAAAAGAGTTTAATGGGCGCCGATATTGGGTATCAGAAAAAAGCATCGAAAAAA.

[0012] Furthermore, AGCGAACCACGACA (SEQ ID NO. 2) is the gene sequence of RBS1;

[0013] AAGGAGGGGTAT (SEQ ID NO.3) is the gene sequence of RBS2:

[0014] AAGGAGGGGTAT (SEQ ID NO. 4) is the gene sequence of RBS3.

[0015] Furthermore, the strength of RBS is: RBS3>RBS2>RBS1.

[0016] Furthermore, the recombinant Escherichia coli also overexpresses methionine adenosyltransferase, homocysteine ​​methyltransferase, S-ribosylhomocysteine ​​lyase and NADPH oxidase.

[0017] Furthermore, the methionine adenosyltransferase, homocysteine ​​methyltransferase and S-ribosylhomocysteine ​​lyase are independently expressed by promoters regulated by gene sequences as shown in any one of SEQ ID NOs. 5-7.

[0018] Further, SEQ ID NO.5(P1):

[0019] CACGGCCGCATAATCGAAATTAATACGACTCACTATAGGGGAATTGTGAGCGGATAACAATTCCCCATCTTAGTA.

[0020] Further, SEQ ID NO.6(P2):

[0021] TTTACGGCTAGCTCAGTCCTAGGTACAATGCTAGC.

[0022] Further, SEQ ID NO.7(P3):

[0023] Ttgacagctagctcagtcctaggtataatactagt.

[0024] Furthermore, the strength of the promoter is P1>P2>P3.

[0025] Furthermore, the NCBI number of the EEVS enzyme is Loc100003999, the NCBI number of the MT-OX enzyme is Zgc:113054, the NCBI number of the glucose-6-phosphate-dehydrogenase is NC_012971.2, the NCBI number of the 6-phosphogluconate dehydrogenase is NC_012971.2, the NCBI number of the transketolase 1 is NC_001148.4, the NCBI number of the 6-phosphofructokinase is ACT45594.1, the NCBI number of the transaldolase gene is ACT44176.1, and the NCBI number of the phosphoglycerate kinase is ACT44574.1.

[0026] Furthermore, the NCBI number of the methionine adenosyltransferase is ACT44589.1, the NCBI number of the homocysteine ​​methyltransferase is ACT45501.1, the NCBI number of the S-ribosylhomocysteine ​​lyase is ACT44361.1, and the NCBI number of the NADPH oxidase is NC_022369.1.

[0027] Furthermore, the Escherichia coli includes Escherichia coli BL21 (DE3).

[0028] The second object of the present invention is to provide a use of the above-mentioned recombinant Escherichia coli in producing gadusol.

[0029] The third object of the present invention is to provide a method for producing gadusol, wherein the recombinant Escherichia coli is inoculated into a culture medium and fermented to obtain the gadusol.

[0030] Furthermore, the fermentation culture temperature is 25-35°C.

[0031] Beneficial effects of the present invention:

[0032] The recombinant Escherichia coli described in the present invention can produce high gadusol. The recombinant Escherichia coli overexpresses the EEVS enzyme, MT-OX enzyme, glucose-6-phosphate-dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1, and the recombinant Escherichia coli after knocking out the 6-phosphofructokinase, transaldolase gene and phosphoglycerate kinase has a gadusol yield of 700-800 mg / L, which is much higher than the 146 mg / L biosynthesis amount in the prior art. Furthermore, the present invention also optimizes the regulated expression of cofactors, uses different promoters to regulate the expression of MetE, metk and Luxs, and overexpresses NADPH oxidase (NoxE). The resulting recombinant Escherichia coli has a gadusol yield of more than 800 mg / L, achieving a high yield of 4.2 g / L in a 5L fermenter amplification system. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] In order to make the content of the present invention more clearly understood, the present invention is further described in detail below based on specific embodiments of the present invention in conjunction with the accompanying drawings, wherein

[0034] Figure 1 This is a schematic diagram of the synthesis of the UV-resistant compound Gadusol based on recombinant Escherichia coli cells;

[0035] Figure 2 is the expression mode of pathway enzymes EEVS and MT-OX in E. coli;

[0036] Figure 3 It is the regulation of the metabolic pathway of Gadusol;

[0037] Figure 4 is a graph of Gadusol production by recombinant strains E2-E4;

[0038] Figure 5 is a graph of Gadusol production by recombinant strains E5-E7;

[0039] Figure 6 is the mass spectrum of Gadusol;

[0040] Figure 7 This is the HPLC chromatogram of Gadusol;

[0041] Figure 8 It is a schematic diagram of the cofactor pair regulating Gadusol synthesis;

[0042] Figure 9 This is a schematic diagram of the promoter's regulation of cofactor expression;

[0043] Figure 10 This is a schematic diagram of the synthesis of Gadusol after promoter-regulated cofactor expression;

[0044] Figure 11 This is a composite graph of the yield of recombinant E. coli S2 in a 5-L fermenter;

[0045] Figure 12 This is the antioxidant characterization diagram of Gadusol;

[0046] Figure 13 This is a characterization diagram of Gadusol's anti-ultraviolet performance. DETAILED DESCRIPTION

[0047] The present invention will be further described below with reference to the accompanying drawings and specific embodiments so that those skilled in the art can better understand the present invention and implement it. However, the embodiments are not intended to limit the present invention.

[0048] Materials and methods are as follows:

[0049] LB medium (g·L -1 ): Yeast extract 5, tryptone 10, sodium chloride 10, solid culture medium supplemented with 2% (w / w) agar powder.

[0050] TB medium (g·L -1 ): Yeast powder 24%, tryptone 12%, 72mM K2HPO4, 17mM KH2PO4, 0.4% glycerol.

[0051] LC-MS determination: The ultraviolet absorption is approximately λ absorbance = 268 nm. Gadusol was dissolved in phosphate buffer at pH 7.0 and loaded on a Hypersil GOLD aQ 5μm liquid chromatography column (size 4.6mm×250mm) with a loading buffer of methanol-5mM phosphate buffer (1% MeOH for 20 minutes, then a gradient from 1% to 95% MeOH within 20 minutes), a flow rate of 0.3mL / min, and a detection wavelength of 294nm. The separated Gadusol was analyzed by ultra-high performance liquid chromatography coupled to a quadrupole time-of-flight mass spectrometer (MALDISYNAPT MS). Its yield was calculated. The chemical structure of the Gadusol is:

[0052]

[0053] The primers involved in the following examples are shown in Table 1.

[0054] Table 1 Primers and their sequences involved in the examples

[0055]

[0056]

[0057] Example 1: Primary expression in E. coli Gadusol

[0058] (1) Construction of Escherichia coli expression plasmid

[0059] The expression of EEVS enzyme and MT-OX enzyme from zebrafish (Danio rerio) in E. coli was optimized. The gene sequence of EEVS enzyme and the gene sequence of MT-OX enzyme (primers are shown in Table 1) were integrated into the E. coli expression plasmid pCDFDuet-1 to obtain the recombinant plasmid pCDFDuet-1-EEVS-MT-OX. The recombinant plasmid pCDFDuet-1-EEVS-MT-OX was introduced into E. coli to obtain recombinant E. coli E1. The recombinant E. coli was inoculated into a fermentation medium for fermentation culture. In addition, this embodiment also uses the promoter Ppsh, RBS and terminator to regulate the expression of EEVS enzyme and MT-OX enzyme in different ways (such as Figure 2 and Table 2).

[0060] Table 2 Effects of different RBS on the expression regulation of EEVS enzyme and MT-OX enzyme on yield

[0061] EEVS MT-OX Yield (mg / L) GA5 RBS1 RBS2 37 GA6 RBS1 RBS3 36 GA7 RBS2 RBS2 24 GA8 RBS2 RBS1 21 GA9 RBS2 RBS3 38 GA10 RBS3 RBS3 37 GA11 RBS3 RBS2 39 GA12 RBS3 RBS1 42

[0062] (2) Escherichia coli and induction expression steps

[0063] Pick a single colony of recombinant E. coli into 10 mL of sterilized LB medium and shake overnight until OD 600 The next day, 2% mL of bacterial solution was inoculated into 50 mL of sterile TB medium, with empty pCDFDuet-1 as a control. The inoculated culture medium was shaken at 37°C and 220 rpm for 3.5 h-4 h until the OD 600 When the pH reaches above 0.6, add 20 μL of 1M IPTG to a final IPTG concentration of 0.4 mM. Induce the culture in a shaker at 30°C and 220 rpm for 20 h. After the culture is completed, collect the cells using a floor-standing high-speed centrifuge (6000 rpm, 10 min) and remove the supernatant.

[0064] The results are as follows Figure 2 As shown, this example found that the highest Gadusol yield was obtained by regulating the expression of EEVS enzyme and MT-OX enzyme using promoters Ppsh and RBS, respectively.

[0065] Example 2: Optimization of Gadusol Synthesis Pathway

[0066] By using metabolic engineering to enhance the expression pathway, Escherichia coli-derived glucose-6-phosphate-dehydrogenase (Zwf, NCBI No.: NC_012971.2), 6-phosphogluconate dehydrogenase (Gnd, NCBI No. NC_012971.2), transketolase 1 (TktA, NCBI No. NC_001148.4), 6-phosphofructokinase (Pfka, NCBI No. ACT45594.1), transaldolase (TAL, NCBI No. ACT44176.1) and phosphoglycerate kinase (Pgk, NCBI No. ACT44574.1) were selected to optimize the Gadusol synthesis pathway. Based on the pCDFDuet-1-EEVS-MT-OX plasmid in Example 1, the 6-phosphofructokinase, transaldolase gene and phosphoglycerate kinase were knocked out using the Escherichia coli expression plasmid Pcreg, and glucose-6-phosphate-dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1 were overexpressed using the Escherichia coli expression plasmid pRSFDuet-1 to obtain the plasmids shown in Table 3, respectively. The plasmids shown in Table 3 were respectively introduced into Escherichia coli to obtain recombinant bacteria and fermented and cultured.

[0067] Table 3 Plasmids and recombinant bacteria involved in Example 2

[0068] plasmids recombinant bacteria Pcreg-EEVS-MT-OX-ΔPfka Escherichia coli E2 Pcreg-EEVS-MT-OX-ΔPfka-ΔTAL Escherichia coli E3 Pcreg-EEVS-MT-OX-ΔPfka-ΔTAL-ΔPgk Escherichia coli E4 pRSFDuet-1-EEVS-MT-OX-ΔPfka-ΔTAL-ΔPgk-Zwf Escherichia coli E5 pRSFDuet-1-EEVS-MT-OX-ΔPfka-ΔTAL-ΔPgk-Zwf-Gnd Escherichia coli E6 pRSFDuet-1-EEVS-MT-OX-ΔPfka-ΔTAL-ΔPgk-Zwf-Gnd-TktA Escherichia coli E7

[0069] After the fermentation culture is completed, the bacteria are collected by centrifugation. Gadusol is dissolved in phosphate buffer at pH 7.0 and loaded on a Hypersil GOLD aQ 5μm liquid chromatography column (size 4.6mm×250mm) with a loading buffer of methanol-5mM phosphate buffer (1% MeOH for 20 minutes, then a gradient from 1% to 95% MeOH within 20 minutes), a flow rate of 0.3mL / min, and a detection wavelength of 268nm. The separated Gadusol is analyzed by ultra-high performance liquid chromatography coupled to a quadrupole time-of-flight mass spectrometer (MALDI SYNAPT MS). Its yield is calculated. Analyze the separated Gadusol.

[0070] The results are as follows Figure 4 and 5 As shown, Escherichia coli E7 had the highest yield, indicating that overexpression of glucose-6-phosphate-dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1, and simultaneous knockout of 6-phosphofructokinase, transaldolase gene and phosphoglycerate kinase can significantly increase Gadusol production.

[0071] Example 3: Optimization of cofactors and promoters in the Gadusol synthesis pathway

[0072] This example regulates the expression of cofactors in the Gadusol synthesis pathway. Based on the plasmid pRSFDuet-1-EEVS-MT-OX-ΔPfka-ΔTAL-ΔPgk-Zwf-Gnd-TktA prepared in Example 2, different promoters were used to regulate the expression of MetE, metk and Luxs respectively, and NADPH dehydrogenase was overexpressed, obtaining 27 recombinant bacteria as shown in Table 4. The 27 recombinant bacteria were fermented and cultured, and their Gadusol production was detected. The results are shown in Table 4. Figure 10 The sequences of P1, P2 and P3 are shown in SEQ ID NO. 5-7 respectively, and the strength of the three promoters is from large to small: P1>P2>P3.

[0073] Table 4 Regulated expression of cofactors by different promoters in Example 3

[0074]

[0075]

[0076] The results are as follows Figure 10 As shown, the Gadusol production of recombinant strain S2 was the highest.

[0077] Example 4: Biosynthesis of recombinant bacteria in a 5 L fermenter

[0078] Fermentation production in a 5L fermenter: The recombinant Escherichia coli S2 constructed in Example 3 was inoculated into 5mL MB culture medium and cultured at 220rpm and 37°C overnight. The seed liquid was transferred to a 50ml triangular flask of fermentation medium at a 2% inoculation rate, and after culturing at 220rpm and 37°C for 10h, it was inoculated into a 5L fermenter at a 15% inoculation rate. The initial temperature was set to 37°C and the rotation speed was 300r / min. After 4h of fermentation, IPTG was added at a final concentration of 1mM to induce gene expression. During the fermentation process, the pH of the fermentation liquid was controlled at about 7 by 50% ammonia water, and glucose was added to maintain about 10g / L in the fermenter. The final gadusol production of the recombinant Escherichia coli after fermentation in a 5L fermenter was 4.2g / L (such as Figure 11 shown).

[0079] Example 5: Gadusol activity detection

[0080] The Gadusol samples prepared in the above embodiment were used to set concentration groups of 0.5 mg / mL, 1 mg / mL and 1.5 mg / mL to analyze the scavenging activity of 4DG against DPPH and ABTS hydroxyl groups. Figure 12 and Figure 13As shown in the data, the scavenging rate of 4DG for DPPH reached 81% at a concentration of 1.5 mg / L, and the scavenging rate for ABTS reached 83.5%. Gadusol has a strong ultraviolet absorption peak at 294 nm. The above data show that Gadusol can effectively scavenge free radicals and has strong antioxidant activity and ultraviolet absorption peak.

[0081] Obviously, the above embodiments are merely examples for clarity of explanation and are not intended to limit the implementation methods. Those skilled in the art will appreciate that other variations or modifications can be made based on the above description. It is not necessary and impossible to enumerate all implementation methods here. Obvious variations or modifications arising therefrom remain within the scope of protection of the present invention.

Claims

1. A recombinant Escherichia coli with high gadusol production, characterized in that: The recombinant Escherichia coli is modified as follows based on Escherichia coli: overexpression of EEVS enzyme, MT-OX enzyme, glucose-6-phosphate-dehydrogenase, 6-phosphogluconate dehydrogenase and transketolase 1, and knockout of 6-phosphofructokinase, transaldolase and phosphoglycerate kinase.

2. The recombinant Escherichia coli according to claim 1, characterized in that The EEVS enzyme and MT-OX enzyme are expressed by the promoter Ppsh and RBS respectively. The gene sequence of the promoter Ppsh is shown in SEQ ID NO.1, and the gene sequence of the RBS is shown in one of SEQ ID NOs.2-4.

3. The recombinant Escherichia coli according to claim 1, characterized in that The recombinant Escherichia coli also overexpresses methionine adenosyltransferase, homocysteine ​​methyltransferase, S-ribosylhomocysteine ​​lyase and NADPH oxidase.

4. The recombinant Escherichia coli according to claim 3, characterized in that The methionine adenosyltransferase, homocysteine ​​methyltransferase and S-ribosylhomocysteine ​​lyase are expressed independently by promoters whose gene sequences are shown in any one of SEQ ID NOs. 5-7.

5. The recombinant Escherichia coli according to claim 1, characterized in that The NCBI number of the EEVS enzyme is Loc100003999, the NCBI number of the MT-OX enzyme is Zgc:113054, the NCBI number of the glucose-6-phosphate-dehydrogenase is NC_012971.2, the NCBI number of the 6-phosphogluconate dehydrogenase is NC_012971.2, the NCBI number of the transketolase 1 is NC_001148.4, the NCBI number of the 6-phosphofructokinase is ACT45594.1, the NCBI number of the transaldolase gene is ACT44176.1, and the NCBI number of the phosphoglycerate kinase is ACT44574.

1.

6. The recombinant Escherichia coli according to claim 3, characterized in that The NCBI number of the methionine adenosyltransferase is ACT44589.1, the NCBI number of the homocysteine ​​methyltransferase is ACT45501.1, the NCBI number of the S-ribosylhomocysteine ​​lyase is ACT44361.1, and the NCBI number of the NADPH oxidase is NC_022369.

1.

7. The recombinant Escherichia coli according to claim 1, characterized in that The Escherichia coli includes Escherichia coli BL21 (DE3).

8. Use of the recombinant Escherichia coli according to any one of claims 1 to 7 in the production of gadusol.

9. A method for producing gadusol, characterized in that: The recombinant Escherichia coli according to any one of claims 1 to 7 is inoculated into a culture medium for fermentation.

10. The method according to claim 9, characterized in that The fermentation temperature is 25-35°C.

Images