Anti-human pepsinogen I antibody, antibody pair and detection kit

Abstract

The invention belongs to the technical field of antibodies, and particularly relates to an anti-human pepsinogen I (Pesinogen I, PG I) antibody, an antibody pair and a detection kit. The antibody is a first antibody or a second antibody, amino acid sequences of light chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.3-5, and amino acid sequences of heavy chains CDR1-3 of the first antibody are respectively shown as SEQ ID NO.8-10; the amino acid sequences of light chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.13-15, and the amino acid sequences of heavy chains CDR1-3 of the second antibody are respectively as shown in SEQ ID NO.18-20. The antibody and the antibody pair disclosed by the invention have specific recognition and binding capacity and relatively high affinity and detection sensitivity to human PG I protein, and a reliable antibody tool and a detection means are provided for stably detecting trace-level human PG I protein.

Description

Technical Field

[0001] The present invention relates to the technical field of antibodies, and in particular to an anti-human pepsinogen I antibody, an antibody pair and a detection kit. Background Art

[0002] Pepsinogen (PG) is an inactive precursor of pepsin in gastric juice. It is primarily secreted by the peptic lining cells and mucous cells of the oxyntic glands. Most of it is secreted into the gastric cavity, where it is activated by gastric acid and converted into pepsin, exerting its digestive function and participating in the digestion of protein. Only 1% of pepsinogen is absorbed into the blood. Currently, seven PGs have been isolated from gastric mucosal extracts and are classified into seven isoenzymes, PG1-PG7, based on their mobility in agar gel electrophoresis, from fast to slow. PG1-PG5, with similar biochemical and immunogenic properties, is primarily secreted by the peptic lining cells and mucous neck cells of the oxyntic glands and is termed pepsinogen I (PGI). PG6 and PG7, with similar biochemical and immunogenic properties, are secreted not only by the peptic lining cells and mucous neck cells of the oxyntic glands but also by the mucous neck cells of the cardia glands and pyloric glands of the antrum, as well as in the upper duodenum. They are termed pepsinogen II (PGII).

[0003] Serum pepsinogen, which enters the bloodstream, is closely associated with the secretory function and morphological changes of the gastric mucosa, making it a reliable, noninvasive, and dynamic indicator for monitoring gastric mucosal health. PGI levels reflect the function of gastric oxyntic gland cells and the health of the gastric mucosa. When the gastric mucosa is damaged, such as in atrophic gastritis, pepsinogen secretion is impaired, and PGI levels decrease accordingly. Therefore, a decrease in serum PGI is a sensitive and specific indicator of moderate to severe atrophic gastritis in the gastric corpus and fundus. It is currently generally accepted that a PGI ≤ 70 ng / mL is considered positive and requires further investigation. A progressive decrease in the PGI / PGI ratio (PGR) is associated with progressive gastric mucosal atrophy. Furthermore, decreased serum PGI levels and elevated PGR are high-risk signals for gastric cancer and have a certain role in early diagnosis. In patients with gastric ulcers, inflammatory stimulation can affect the function of the oxyntic glands, leading to abnormal PGI secretion. Helicobacter pylori infection is also a common biological factor that interferes with normal PGI secretion, damaging the gastric mucosa and triggering an inflammatory response. Therefore, the detection of pepsinogen I and its ratio, or combined with Helicobacter pylori testing, has been used in the early screening and diagnosis of various gastric diseases in clinical practice. Compared with pathological examination methods such as endoscopic biopsy, serum detection methods have the advantages of being non-invasive, simple, rapid, and specific. Therefore, the detection of PGI content is of great significance for the early screening, diagnosis, and disease monitoring of gastric diseases.

[0004] Currently, a variety of PGI detection methods have been established, such as enzyme-linked immunosorbent assay (ELISA), chemiluminescence, immunoturbidimetry, immunohistochemistry, immunofluorescence, and flow cytometry. All of these methods rely on specific monoclonal antibodies against PGI. Although a variety of PGI antibodies are publicly available or commercially available, most have poor specificity and / or affinity, resulting in low sensitivity for antigen detection and insufficient testing for low-content samples. In particular, in double-antibody sandwich immunoassays, the lack of suitable paired antibodies or poor specificity of the paired antibodies can negatively impact the accuracy and sensitivity of the test results. Summary of the Invention

[0005] In response to the problems in the prior art of anti-human PG I protein antibodies having poor specificity and / or affinity, and low sensitivity for antigen detection, the present invention provides two novel anti-human PG I protein antibodies and antibody pairs composed thereof. The antibodies and antibody pairs have specific recognition and binding capabilities for human PG I protein and high affinity and detection sensitivity, providing reliable antibody tools and detection means for stable detection of trace levels of human PG I protein. The present invention also provides the use of the aforementioned antibodies or antibody pairs in detecting human PG I protein and related detection kits, especially double antibody sandwich detection kits based on a double antibody sandwich model. To achieve this purpose, the present invention is implemented through the following technical solutions:

[0006] In a first aspect, the present invention provides an anti-human pepsinogen I antibody, which is a first antibody or a second antibody, wherein: the amino acid sequences of the complementarity determining regions CDR1-3 on the light chain variable region of the first antibody are shown as SEQ ID NOs. 3-5, respectively, and the amino acid sequences of the complementarity determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs. 8-10, respectively; the amino acid sequences of the complementarity determining regions CDR1-3 on the light chain variable region of the second antibody are shown as SEQ ID NOs. 13-15, respectively, and the amino acid sequences of the complementarity determining regions CDR1-3 on the heavy chain variable region are shown as SEQ ID NOs. 18-20, respectively.

[0007] Furthermore, the amino acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.7; the amino acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown as SEQ ID NO.17.

[0008] Furthermore, the amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; the amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.16.

[0009] Furthermore, the first antibody and / or the second antibody is a full-length antibody or the antigen-binding region of the full-length antibody; the antigen-binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

[0010] The second aspect of the present invention provides a nucleic acid molecule or a recombinant vector, wherein the recombinant vector contains the nucleic acid molecule, and the nucleic acid molecule encodes the first antibody or the second antibody as described above.

[0011] Furthermore, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO.22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.24 or a sequence complementary thereto; the nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO.26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO.28 or a sequence complementary thereto.

[0012] Furthermore, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO.21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.23 or a sequence complementary thereto; the nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO.25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO.27 or a sequence complementary thereto.

[0013] The third aspect of the present invention provides an anti-human pepsinogen I antibody pair consisting of the first antibody and the second antibody as described above.

[0014] The fourth aspect of the present invention provides use of the above-mentioned anti-human pepsinogen I antibody or antibody pair in the preparation of a human pepsinogen I detection kit.

[0015] A fifth aspect of the present invention provides a human pepsinogen I detection kit, which comprises the anti-human pepsinogen I antibody or antibody pair as described above.

[0016] Furthermore, the detection kit is a double antibody sandwich detection kit, comprising a first antibody and a second antibody, wherein the first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is coupled with a detection marker.

[0017] The present invention has the following beneficial effects:

[0018] The antibody provided by the present invention has specific recognition and binding ability and high affinity for human pepsinogen I (PG I), and the affinity constant K of the first antibody and the second antibody is D The concentrations of the two antibodies are 1.72nM and 0.626nM, respectively. Moreover, the two antibodies recognize and bind to different epitopes of human PGI protein and can be used as paired antibodies to construct a double-antibody sandwich immunoassay system, such as a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system. This method can be used for accurate, highly sensitive, and highly specific quantitative detection of human PGI protein. It has the advantages of a wide linear detection range, a low detection limit, and a high detection efficiency. It provides a reliable antibody tool and detection means for the stable detection of trace levels of human PGI protein, and has good application prospects in the rapid and accurate detection of PGI protein and the immune diagnosis of related diseases with PGI protein as the detection target. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0020] Figure 1 A map of the vector used to construct the monoclonal antibody expression vector in Example 1 of the present invention, including, from left to right, maps of the pBR322 vector carrying the light chain constant region and the heavy chain constant region;

[0021] Figure 2 This is an affinity curve of the monoclonal antibody of Example 2 of the present invention binding to human PGI protein;

[0022] Figure 3 This is a graph showing the antigen epitope of the monoclonal antibody of Example 2 of the present invention that recognizes human PGI protein;

[0023] Figure 4 This is the standard curve for detecting human PGI protein using the double antibody sandwich enzyme-linked immunosorbent assay system established based on monoclonal antibodies 19B4 and 21F9 in Example 3 of the present invention. DETAILED DESCRIPTION

[0024] In order to make the purpose, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below with reference to the embodiments. The embodiments described herein are only used to explain the present invention and are not intended to limit the present invention.

[0025] Given the information contained herein, it will be readily apparent to those skilled in the art that various modifications may be made to the precise description of the present invention without departing from the spirit and scope of the appended claims. It should be understood that the scope of the present invention is not limited to the processes, properties, or components defined herein, as these embodiments and other descriptions are intended only to illustrate specific aspects of the present invention. Indeed, various modifications to the embodiments of the present invention that are apparent to those skilled in the art or related fields are intended to be within the scope of the appended claims.

[0026] For a better understanding of the present invention and not to limit the scope of the present invention, all numerals and other numerical values ​​used in the present invention to express amounts, percentages, etc. should be understood as modified by the word "about" in all cases. Therefore, unless otherwise specified, the numerical parameters listed in the specification and the appended claims are approximate values, which may be changed according to the different ideal properties to be obtained. Each numerical parameter should at least be regarded as obtained based on the reported significant digits and by conventional rounding methods.

[0027] In addition, it should be noted that, unless otherwise defined, in the context of the present invention, the scientific and technical terms used should have the meanings commonly understood by those skilled in the art.

[0028] The terms "include", "comprising", "containing", "having" and the like are non-limiting in meaning, that is, other steps and other components that do not affect the results may be added.

[0029] The term "and / or" should be considered as a specific disclosure of each of the two specified features or components with or without the other. For example, "A and / or B" is considered to include the following situations: (i) A, (ii) B, and (iii) A and B.

[0030] The terms "first," "second," and the like are used to distinguish similar objects and are not necessarily used to describe a particular order or sequence, and it should be understood that such usage can be interchangeable under appropriate circumstances.

[0031] The terms "rabbit monoclonal antibody," "monoclonal antibody," "rabbit antibody," and "rabbit monoclonal antibody" have the same meaning and, unless otherwise specified, refer to rabbit antibodies that specifically bind to human pepsinogen I (PGI). The modifier "rabbit" indicates that the complementarity determining regions (CDRs) of the antibody are derived from rabbit immunoglobulin sequences. The terms "pepsinogen I," "pesinogen I," "PGI," "PGI protein," and other similar terms have the same meaning and can be used interchangeably.

[0032] An antibody is an immunoglobulin molecule that is capable of specifically binding to a target antigen or epitope through at least one antigen recognition site located in the variable region of the immunoglobulin molecule. In the present invention, the term "antibody" should be interpreted in the broadest sense and encompasses various antibody structures, including but not limited to so-called full-length antibodies, antibody fragments, and genetic or chemical modifications thereof, as long as they exhibit the desired antigen-binding activity. Antibody fragments can be one or more portions or fragments of a full-length antibody that retain the antibody's ability to specifically bind to the target antigen.

[0033] A typical antibody molecule (full-length antibody) consists of two identical light chains (L) and two identical heavy chains (H). Light chains can be divided into two types: kappa (κ) and lambda (λ); heavy chains can be classified into five types: μ, δ, γ, α, and ε, which define antibodies as IgM, IgD, IgG, IgA, and IgE, respectively. The amino acid sequences near the N-terminus of heavy and heavy chains vary greatly, while the remaining amino acid sequences are relatively constant. The regions of the light and heavy chains with the most variable amino acid sequences near the N-terminus are called the variable region (V), while the regions with relatively stable amino acid sequences near the C-terminus are called the constant region (C). The heavy chain variable region (VH) and light chain variable region (VL) are generally the most variable parts of antibodies and contain the antigen recognition site. The VH and VL regions can be further subdivided into hypervariable regions (HVRs) and framework regions (FRs). The HVRs, also known as complementarity-determining regions (CDRs), are circular structures. The heavy and light chain CDRs are closely aligned and interact with each other through the FRs, forming a surface that complements the three-dimensional structure of the target antigen or epitope. This determines the antibody's specificity and is the site of antigen recognition and binding. The FRs are the more conserved portions of the VH and VL sequences. They generally follow a β-pleated sheet configuration and are connected by three CDRs that form a connecting loop. Each VH and VL sequence typically consists of three CDRs and four FRs, arranged from amino-terminus to carboxyl-terminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, FR4.

[0034] CDRs and FRs can be identified according to the Kabat definition, the Chothia definition, a cumulative of the Kabat and Chothia definitions, the AbM definition, the contact definition, the IMGT unique numbering definition and / or the conformational definition, or any CDR determination method known in the art. As used herein, the Kabat numbering system is used to define CDRs.

[0035] The light chain constant region (CL) and heavy chain constant region (CH) are not directly involved in antibody-antigen binding, but they exhibit different effector functions, such as antibody-dependent cell-mediated cytotoxicity (ADCC). The CL length is generally consistent across different Ig types (κ or λ), but the CH length varies across different Ig classes. For example, IgG, IgA, and IgD comprise CH1, CH2, and CH3, while IgM and IgE comprise CH1, CH2, CH3, and CH4. The amino acid sequences of the heavy and light chain constant regions of antibodies are well known in the art and can be obtained by querying the IMGT database.

[0036] A full-length antibody is the most complete antibody molecular structure and has a typical Y-shaped molecular structure. Therefore, in the context of the present invention, "full-length antibody", "intact antibody" and "Y-shaped antibody" have the same meaning and can be used interchangeably.

[0037] Antibody fragments are one or more parts or fragments of a full-length antibody that essentially retain the same biological function or activity as the full-length form. Specifically, an antibody fragment includes at least the same CDR regions as the full-length antibody, and more preferably the same variable regions, thereby retaining complete antigen recognition and binding sites and being able to bind to the same antigen as the full-length antibody, particularly to the same epitope. Typical examples include: Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv, and sc(Fv)2. These antibody fragments can be obtained using conventional techniques in the art.

[0038] (i) Fab: An antigen-binding fragment (Fab) is a monovalent fragment consisting of a complete light chain (variable and constant regions) and a portion of the heavy chain (variable and first constant regions). By proteolytic cleavage of the full-length antibody, fragments such as Fab, F(ab')2, and Fab' can be obtained. For example, IgG can be degraded into two Fab fragments and an Fc fragment by papain; and into an F(ab')2 fragment and a pFc' fragment by pepsin. The F(ab')2 fragment is further reduced to form two Fab' fragments. Because Fab contains both the antigen-binding region and a portion of the constant region, it not only possesses the same antibody-antigen affinity and excellent tissue penetration as scFv, but also has a more stable structure.

[0039] (ii) F(ab)2: A bivalent fragment consisting of two Fabs linked by a disulfide bridge at the hinge region.

[0040] (iii) Fv: The variable fragment (Fv) is located at the N-terminus of the antibody Fab fragment, contains only the variable region, and is composed of the variable regions of a light chain and a heavy chain. It is a dimer of VH and VL non-covalently bound (VH-VL dimer). The three CDRs of each variable region interact with each other to form an antigen binding site on the surface of the VH-VL dimer, which has the ability to recognize and bind to antigens, although the affinity is lower than that of the intact antibody.

[0041] (iv) (Fv)2: Consists of two covalently linked Fv fragments.

[0042] (v) scFv: A single-chain variable fragment (scFv) is an Fv fragment composed of a single polypeptide chain, consisting of a heavy chain variable region (VH) and a light chain variable region (VL) connected by a flexible linker (typically consisting of 10-25 amino acids). It retains the antigen-binding specificity of the original antibody. The linker in this invention is not particularly limited, as long as it does not hinder the expression of the antibody variable regions connected to it. Compared to full-length antibodies, scFv has a smaller molecular weight, resulting in higher penetration and lower immune side effects.

[0043] (vi) The sc(Fv)2 fragment is composed of two heavy chain variable regions and two light chain variable regions connected by a linker or the like.

[0044] In some embodiments, the full-length sequence of the antibody or antibody fragment of the present invention may comprise a complementary determining region (CDR) and a framework region (FR) from a rabbit immunoglobulin sequence. In other embodiments, the antibody may comprise amino acid residues encoded by non-rabbit immunoglobulin sequences, for example, humanized antibodies, chimeric antibodies, etc., to reduce the body's rejection reaction while maintaining the required specificity and affinity. The term "chimeric antibody" refers to a portion of an antibody derived from a specific source or species, while the rest is derived from a different source or species. The term "humanized antibody" is a chimeric antibody comprising a CDR region of a non-human antibody, such as a rabbit antibody, and a human FR region. In some cases, the variable region of a non-human antibody is combined with the constant region of a human antibody, such as a human-rabbit chimeric antibody; in other cases, the CDR region of a non-human antibody is combined with the FR region and constant region derived from a human antibody sequence, that is, the CDR region of a non-human antibody is grafted onto a human antibody framework (FR) sequence, which is derived from the FR sequence of a single or multiple other human antibody variable regions. In the present invention, the CDR regions in the chimeric or humanized antibodies are derived from rabbit-derived CDR regions.

[0045] The terms "monoclonal antibody" or "single antibody" and other similar terms are used interchangeably and refer to a homogeneous antibody population, i.e., the individual antibodies comprising the population are identical except for a small amount of mutations and / or post-translational modifications (e.g., isomerization, amidation) that may occur naturally. "Monoclonal antibodies" are highly specific and exhibit a single binding specificity and affinity for the same or substantially identical epitope on the antigen. The modifier "monoclonal" indicates that the antibody is obtained from a substantially homogeneous antibody population and should not be construed as limiting the source or preparation method of the antibody. The antibody can be prepared by a variety of methods, including but not limited to hybridoma methods, phage display methods, yeast display methods, recombinant DNA methods, single cell screening, or single cell sequencing methods.

[0046] The term "specific binding" is a well-known term in the art, and a molecule exhibits "specific binding" if it reacts with a specific target antigen or epitope more frequently, more rapidly, longer-lastingly, and / or with greater affinity than with other target antigens or epitopes. "Specific binding" or "preferential binding" does not necessarily require (although it can include) exclusive binding.

[0047] In order to make the above-mentioned objects and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below.

[0048] An embodiment of the present invention provides an anti-human pepsinogen I (PG I) antibody, which is a first antibody or a second antibody, wherein the antibody comprises a light chain variable region and a heavy chain variable region, wherein the light chain variable region and the heavy chain variable region each comprise three complementarity determining regions (CDRs), respectively named CDR1, CDR2, and CDR3; wherein: the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NO.3, SEQ ID NO.4, and SEQ ID NO.5, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.8, SEQ ID NO.9, and SEQ ID NO.10, respectively; the amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NO.13, SEQ ID NO.14, and SEQ ID NO.15, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NO.18, SEQ ID NO.19, and SEQ ID NO. Shown in NO.20.

[0049] The present invention develops anti-human PG I rabbit monoclonal antibodies through single B cell screening and culture technology and performs paired screening to obtain monoclonal antibodies and combinations thereof with sensitivity, specificity and affinity that meet detection requirements. The antibodies have specific recognition and binding ability to human pepsinogen I (PG I) and high affinity. The affinity constant K of the first and second antibodies is D The concentrations of the two antibodies are 1.72nM and 0.626nM, respectively. Moreover, the two antibodies recognize and bind to different epitopes of the PGI protein and can be used as paired antibodies to construct a double-antibody sandwich immunoassay system. One of the antibodies is used as the capture antibody and the other antibody labeled with biotin is used as the detection antibody to construct a double-antibody sandwich enzyme-linked immunosorbent assay (ELISA) detection system. This method can be used for the quantitative detection of human PGI protein with a detection range of 0-250pg / mL and a detection limit of 0.08pg / mL. It has the advantages of a wide linear detection range, a low detection limit, and a high detection efficiency. It can accurately, highly sensitively, and specifically detect trace amounts of human PGI protein in samples, providing a reliable antibody tool and detection means for the stable detection of trace levels of human PGI protein. It has good application prospects in the rapid and accurate detection of PGI protein and the immune diagnosis of related diseases with PGI protein as the detection target.

[0050] Optionally, the light chain variable region and the heavy chain variable region each include four framework regions (FRs), and the four FRs and three CDRs are arranged in a staggered order to form a variable region. The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO.2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.7. The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.17.

[0051] Optionally, the antibody of the present invention further comprises a light chain constant region (CL) and a heavy chain constant region (CH), wherein CL and VL constitute the light chain, and CH and VH constitute the heavy chain. The constant region of an antibody is usually obtained by querying the IMGT online database.

[0052] Optionally, the amino acid sequence of the light chain (FL) of the first antibody is shown in SEQ ID NO. 1, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO. 6. The amino acid sequence of the light chain (FL) of the second antibody is shown in SEQ ID NO. 11, and the amino acid sequence of the heavy chain (FH) is shown in SEQ ID NO. 16. The light chain is a κ chain, and the heavy chain is of IgG1 type.

[0053] It should be noted that the antibody of the present invention can be a full-length antibody (having a typical Y-shaped molecular structure) or an antigen-binding region of the full-length antibody; the antigen-binding region refers to a polypeptide that substantially maintains the same biological function or activity as the full-length form of the antibody. Specifically, the antigen-binding region includes the CDR region as described above, and more preferably has the variable region as described above, thereby retaining a complete antigen recognition and binding site, and can bind to the same antigen as the full-length antibody, especially to the same epitope. Optionally, the antigen-binding region is selected from at least one of Fab, F(ab)2, Fab', F(ab')2, Fv, (Fv)2, scFv and sc(Fv)2. These antigen-binding regions can be obtained by conventional techniques in the art.

[0054] Yet another embodiment of the present invention provides a nucleic acid molecule, a recombinant vector comprising the aforementioned nucleic acid molecule, or a host cell comprising the aforementioned nucleic acid molecule, wherein the nucleic acid molecule encodes the first antibody and / or the second antibody as described above.

[0055] Nucleic acid molecules can be in the form of DNA (e.g., cDNA, genomic DNA, or synthetic DNA) or RNA (e.g., mRNA or synthetic RNA). DNA can be single-stranded or double-stranded, and can be either a coding strand or a non-coding strand. The sequence of the nucleic acid molecule can be derived from the antibody amino acid sequence by conventional means, such as codon coding rules.

[0056] The full-length sequence of a nucleic acid molecule or a fragment thereof can usually be obtained by PCR amplification, recombination or artificial synthesis.

[0057] Illustratively, the nucleic acid sequence of the light chain variable region of the first antibody is shown as SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 24 or a sequence complementary thereto. The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

[0058] Illustratively, the nucleic acid sequence of the light chain of the first antibody is shown as SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 23 or a sequence complementary thereto. The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

[0059] Those skilled in the art will understand that due to the degeneracy of the genetic code, nucleic acid molecules other than those exemplified above can also encode the antibodies of the present invention. Therefore, the nucleic acid molecules exemplified above should not be used to limit the scope of protection of the present invention.

[0060] The original vector for constructing the recombinant vector is a variety of vectors conventional in the art, as long as it can accommodate the nucleic acid molecule. Typical vectors include plasmids (such as pBR322, pUC series, pET series, pGEX series, pcDNA series), viral vectors, bacteriophages (such as λgt4λB, λ-Charon, λΔz1 and M13), cosmids and minichromosomes. The vector can be a cloning vector (i.e., for transferring the nucleic acid molecule into the host and multiplying it in large quantities in the host cell) or an expression vector (i.e., containing the necessary genetic elements to allow the nucleic acid molecule inserted into the vector to be expressed in the host cell). The nucleic acid molecule is inserted into a suitable vector to form a cloning vector or expression vector carrying the nucleic acid molecule. This is a well-known technology in the art.

[0061] The nucleic acid molecules encoding the antibodies FL and FH of the present invention can be inserted into two vectors, respectively, which can be introduced into the same or different host cells. When the heavy chain and light chain are expressed in different host cells, each chain can be isolated from the host cell in which it is expressed, and the isolated heavy and light chains are mixed and incubated under appropriate conditions to form antibodies. In other embodiments, the nucleic acid molecules of the antibodies FL and FH can also be cloned into a single vector, with each nucleic acid sequence linked to a suitable promoter downstream; for example, each nucleic acid sequence encoding the heavy chain and light chain can be operably linked to a different promoter, or the nucleic acid sequence encoding the heavy chain and light chain can be operably linked to a single promoter so that both the heavy chain and the light chain can be expressed by the same promoter. The choice of expression vector / promoter depends on the type of host cell used to produce the antibody.

[0062] Conventional techniques are used to transfect or transform the recombinant vector into host cells. When the host is a prokaryotic organism such as Escherichia coli, competent cells capable of absorbing DNA are harvested after the exponential growth phase and treated with CaCl₂ or MgCl₂. Alternatively, transfection can be performed using methods such as microinjection, electroporation, liposome packaging, or a gene gun. When the host is a eukaryotic organism, the following DNA transfection methods can be used: calcium phosphate coprecipitation, microinjection, electroporation, liposome packaging, or a gene gun.

[0063] The host cell can be a prokaryotic or eukaryotic cell. Examples of prokaryotic host cells that can be used in the present invention include, but are not limited to, Escherichia coli (e.g., DH5α, JM109, BL21, W3110), Bacillus (e.g., Bacillus subtilis, Bacillus thuringiensis), and Enterobacteriaceae strains (e.g., Salmonella typhimurium, Serratia marcescens), and Pseudomonas. Eukaryotic host cells that can be used for transformation include, but are not limited to, yeast, insect cells, and animal cells, such as Drosophila S2 or Sf9 cells, mammalian CHO, CHO DG44, CHO-S, COS-7, 293 series cells, HepG2, Huh7, 3T3, RIN, MDCK, and HEK293 cell lines. After obtaining a host cell transfected or transformed with the recombinant vector described above, the antibody can be expressed by culturing under suitable conditions, and then separated to obtain purified antibodies.

[0064] In a typical embodiment, the method for preparing an antibody of the present invention comprises: tandemly linking the light and heavy chain genes of the antibody with a signal peptide, loading each gene onto the expression vector pBR322, co-transfecting human renal epithelial cells (293F), culturing the 293F cells, collecting the cell culture supernatant, and purifying the target antibody strain. The sequence of the signal peptide is designed based on the host cell and is not particularly limited in the present invention. The signal peptide encoding gene is located upstream (5' end) of the antibody gene.

[0065] Another embodiment of the present invention provides an anti-human pepsinogen I antibody pair consisting of the first antibody and the second antibody as described above.

[0066] The first antibody and the second antibody of the present invention bind to different epitopes of human PG I protein and can be used as paired antibodies. They have good practical value in the field of constructing double antibody sandwich immunological detection methods, such as double antibody sandwich ELISA or double antibody sandwich immunochromatography.

[0067] Yet another embodiment of the present invention provides use of the above-mentioned anti-human pepsinogen I antibody or antibody pair in the preparation of a human pepsinogen I detection kit.

[0068] The advantages of using the anti-human pepsinogen I antibody or antibody pair in preparing a human pepsinogen I detection kit are the same as those of the anti-human pepsinogen I antibody or antibody pair described above, and will not be repeated here.

[0069] The monoclonal antibody provided by the present invention can specifically recognize and bind to human PGI protein. When used to detect human PGI protein, human PGI protein should be understood in the broadest sense, which includes not only pure human PGI protein, but also mixtures containing human PGI protein or organisms containing human PGI protein, such as cells and tissues.

[0070] Based on the same inventive concept as above, an embodiment of the present invention further provides a human pepsinogen I detection kit, which includes the first antibody and / or second antibody as described above.

[0071] In the present invention, the first antibody and the second antibody can be used separately, together, or in pairs. During detection, if used separately or together, the first antibody and / or the second antibody is used as a primary antibody or capture antibody, the sample to be tested is contacted with the capture antibody, and then the antibody is detected. In some embodiments, the capture antibody can be coupled (covalently or non-covalently) to a detection marker, and the qualitative or quantitative detection of human PGI protein is achieved by analyzing the signal change generated by the detection marker; for example, in a direct ELISA system, the object to be tested is coated on a solid phase carrier, and then the labeled antibody of the present invention is used to specifically recognize and bind to the solid phase antigen to detect human PGI protein. In other embodiments, the primary antibody against human PGI protein is not labeled, and the detection marker is coupled to the secondary antibody against the capture antibody (as a detection antibody) or other molecules to achieve detection; for example, in an indirect ELISA system, the anti-human PGI protein antibody of the present invention (as a primary antibody) is a rabbit IgG antibody, and the secondary antibody can be an anti-rabbit IgG antibody, and detection is achieved by generating a signal change after the labeled secondary antibody binds to the primary antibody. If used in pairs, one of the two antibodies serves as the primary antibody or capture antibody, and the other serves as the secondary antibody or detection antibody.

[0072] The above-mentioned detection labels for generating identifiable signal changes include, but are not limited to: biotin, fluorescent dyes (such as acridinium esters, umbelliferones, fluorescein, anthocyanins, fluorescein isothiocyanate (FITC), rhodamine, dichlorotriazinylamine fluorescein, dansyl chloride), fluorescent proteins (such as allophycocyanin, phycoerythrin, PerCP and phycocyanin), enzymes (such as alkaline phosphatase, acid phosphatase, β-galactosidase, glucose oxidase, horseradish peroxidase, acetylcholinesterase, avidin), colloidal gold, colored magnetic beads, latex particles, radionuclides, detection antibodies or combinations thereof.

[0073] The detection method adopts common immunological methods, such as enzyme-linked immunosorbent assay (ELISA), enzyme-linked immunospot assay (ELISPOT), immunohistochemistry (IHC), immunofluorescence (IF), immunoprecipitation (IP), immunochromatography (ICA), immunoblotting (WB), flow cytometry (FC), etc. The detection targets include recombinantly expressed human PGI protein and human PGI protein naturally secreted or expressed by cells / tissues. The detection samples include but are not limited to serum, plasma, urine, cells or cell culture fluid, tissue or tissue homogenate, etc.

[0074] Preferably, the detection kit is a detection kit based on a double antibody sandwich mode, such as a double antibody sandwich enzyme-linked immunosorbent assay kit, which includes a first antibody and a second antibody, the first antibody serving as a capture antibody (or primary antibody), the second antibody serving as a detection antibody (or secondary antibody) and being coupled to a detection marker.

[0075] In double antibody sandwich ELISA kits, the detection label is usually biotin. In other types of double antibody sandwich detection kits, the detection label can be adaptively replaced, such as in immunochromatographic kits, where the detection label is usually colloidal gold or quantum dots.

[0076] Optionally, the double antibody sandwich enzyme-linked immunosorbent assay kit further comprises a diluent, a blocking solution, a horseradish peroxidase-labeled streptavidin solution, and a 3,3',5,5'-tetramethylbenzidine color development solution.

[0077] The present invention will be further described below with reference to specific examples. Experimental methods in the following examples where specific conditions are not specified were generally performed under conventional conditions, such as those described in the Molecular Cloning Laboratory Manual (4th Edition) published by Cold Spring Harbor Laboratory, or under conditions recommended by the manufacturer.

[0078] Example 1 Screening and Preparation of Rabbit Antibodies Against Human Pepsinogen I (PG I)

[0079] 1.1 Animal Immunization: The immunogen was commercially available recombinant human pepsinogen 4 (Pepsin A-4) (from ABclonal, Catalog No. RP01749, protein sequence see UniProt No. P0DJD7). Two New Zealand white rabbits were immunized at 200 μg / rabbit. Before the first immunization, the immunogen was mixed with an equal amount of complete Freund's adjuvant to form an emulsion and injected subcutaneously at multiple sites on the abdomen and back of the rabbits. Three weeks apart, 100 μg of the immunogen was mixed with an equal amount of incomplete Freund's adjuvant to form an emulsion and injected subcutaneously at multiple sites on the abdomen and back of the rabbits for two booster immunizations. After the three immunizations, serum was collected and its titer against Human PGI (ABclonal, Catalog No. RP01749) was determined by ELISA. Rabbits with high serum titers were boosted once again with 200 μg of the immunogen. Three days later, the animals were sacrificed and their spleens were harvested.

[0080] 1.2. Isolation of B lymphocytes in the spleen and sorting of antigen-specific B lymphocytes: For related methods, please refer to the published patents "Method for Efficient Isolation of Single Antigen-Specific B Lymphocytes from Spleen Cells (Publication No.: CN110016462A, Publication Date: 2019-07-16)" and "A B Lymphocyte In Vitro Culture System and Application (Publication No.: CN111518765A, Publication Date: 2020-08-11)".

[0081] 1.3 Cloning of monoclonal antibody genes: The supernatant of cultured B cells was used to identify antigen-specific B lymphocytes using ELISA coated with Human PG I (ABclonal, catalog number RP01749). The cells were collected and lysed, and then the cells were analyzed using Quick-RNA TM RNA was extracted using a MicroPrep kit (ZYMO, Catalog No. R1051) and reverse transcribed into cDNA. Using the cDNA as a template, the naturally paired antibody light chain variable region (VL) and heavy chain variable region (VH) were amplified by PCR using the Gloria Nova HS2X Master Mix kit (ABclonal, Catalog No. RK20717). The primer sequences (5'-3') for amplifying the VL and VH genes are shown below, where F and R represent forward and reverse primers, respectively:

[0082] VL-F: tgaattcgagctcggtacccATGGACACGAGGGCCCCCAC (see SEQ ID NO. 29);

[0083] VL-R: cacacacgatggtgactgTTCCAGTTGCCACCTGATCAG (see SEQ ID NO. 30);

[0084] VH-F: tgaattcgagctcggtacccATGGAGACTGGGCTGCGCTG (see SEQ ID NO. 31);

[0085] VH-R: gtagcctttgaccaggcagcCCAGGGTCACCGTGGAGCTG (see SEQ ID NO. 32).

[0086] The amplified products were sequenced to obtain the variable regions of the antibody and their encoding gene sequences. The sequencing work was completed by Jin Kairui Biotechnology Co., Ltd. The heavy chain constant region (CH) was obtained by searching the IMGT online database (www.imgt.org) for rabbit IgG gamma reign, and the light chain constant region (CL) was obtained by searching the IMGT online database (www.imgt.org). The gene and protein sequences of the complete antibody were obtained.

[0087] 1.4. Large-scale production of monoclonal antibodies: The obtained antibody heavy chain and light chain genes were loaded onto the expression vector pBR322. In this example, the light chain CL and heavy chain CH genes were pre-inserted into pBR322. The resulting vector map is shown in Figure 1 , where pBR322origin and f1origin are replication promoters, Ampcillin is a resistance gene, CMVpromoter is a transcription promoter, SV40PA terminator is a tailing signal, the light chain constant is the CL sequence (left), and the heavy chain constant is the CH sequence (right). The VL and VH genes were then ligated via homologous recombination with the pBR322 expression vector carrying the CL and CH genes, linearized with the XbaI and NheI restriction enzymes, respectively, to generate the FL and FH gene expression vectors. Sequencing verified the successful construction of the vectors.

[0088] In order to facilitate the purification of antibodies, the secretory expression of antibodies is achieved by adding signal peptides upstream of VL and VH. The signal peptides can be antibody expression signal peptides commonly used in the art, such as the patent "Rabbit monoclonal antibody against human interferon α2 and its application (publication number: CN116063487A, publication date: 2023-05-05)" and the patent "High-affinity human IL-5 rabbit monoclonal antibody and its application (publication number: CN115819578A, publication date: 2023-03-21)". The upstream of VL has a signal peptide MDTRAPTQLLGLLLLWLPGARC (the encoding gene in this example is atggacacgagggcccccactcagctgct The VH upstream has a signal peptide "METGLRWLLLVAVLKGVQC (the gene encoding in this embodiment is atggagactgggctgcgctggcttctcctggtgg ctgtactgaaaggagtgcagtgt or atggagactgggctgcgctggcttctcctggtcgctgtcctgaagggcgttcagtgt)". Of course, those skilled in the art can also replace other signal peptides for expression after obtaining the antibody sequence of the present invention. Therefore, the signal peptide sequence is not reflected in the antibody sequence of Table 1-2 below in this embodiment. In addition, it should be noted that the PCR products amplified using the above-mentioned VL and VH primers carry signal peptides. When expressing antibodies, the VL gene and VH gene with upstream signal peptide encoding genes can be constructed into the expression vector pBR322 respectively.

[0089] The constructed expression vectors containing the FL and FH genes were co-transfected into 293F cells. After transfection, the cells were cultured for 72-96 hours. The culture supernatant was collected and purified from the culture supernatant using Protein A affinity gel resin (purchased from Tiandi Renhe, Catalog No. SA023100). Recombinant rabbit antibodies that recognize Human PG I were designated 19B4 and 21F9. The concentration of 19B4 was 11.6 μg / mL, and that of 21F9 was 8.12 μg / mL, with purities exceeding 95%.

[0090] The amino acid (AA) and nucleotide (DNA) sequences of monoclonal antibodies 19B4 and 21F9 are shown in Tables 1-2, respectively. For ease of description, light chain CDRs 1-3 are represented by LCDRs 1-3, and heavy chain CDRs 1-3 are represented by HCDRs 1-3.

[0091] Table 1 Sequence information of monoclonal antibody 19B4 in this example

[0092]

[0093] Table 2 Sequence information of monoclonal antibody 21F9 in this example

[0094]

[0095]

[0096] Example 2 Performance Testing of Antibodies 19B4 and 21F9 Against Human Pepsinogen I (PG I)

[0097] The antigen-antibody binding curve was determined using the Gator Prime biomolecular interaction analyzer from Probe Life to identify antibody affinity and antigen recognition epitopes. The probe for immobilizing the antigen or antibody was an HFC probe (Anti-Human IgG Fc (HFC) Probes, purchased from Gator Bio, catalog number 160003).

[0098] 2.1. Affinity test: Human PG I (ABclonal, Catalog No. RP01749) was immobilized on HFC probes at a concentration of 1 μg / mL. The probes with the immobilized antigen were placed in 11.6 μg / mL antibody 19B4 and 8.12 μg / mL antibody 21F9 solutions to test the ability of the antibodies to bind to the antigens. The affinity curves of antibody 19B4 (top) and 21F9 (bottom) binding to Human PG I are shown in Figure 2. Figure 2 As shown in the figure, the vertical axis is the change in the thickness of the conjugate after the probe binds to the antibody and protein, the horizontal axis is the binding time, the dark gray curve is the real-time binding value curve, and the light gray curve is the fitted average curve. The affinity constants obtained by curve fitting and calculation are shown in Table 3, and the dissociation coefficient K off The constant that characterizes the dissociation rate between antibody and antigen, the binding coefficient K on A constant that characterizes how quickly an antibody binds to its target, the affinity constant K D K off / K on The ratio of , which characterizes the dissociation equilibrium constant between antibody and antigen.

[0099] Table 3 Affinity parameter determination results of monoclonal antibodies 19B4 and 21F9

[0100] Rabbit monoclonal antibody <![CDATA[K off (1 / s)]]> <![CDATA[K on (1 / Ms)]]> <![CDATA[K D (M)]]> 19B4 <![CDATA[1.28×10 -4 ]]> <![CDATA[7.43×10 4 ]]> <![CDATA[1.72×10 -9 ]]> 21F9 <![CDATA[2.48×10 -4 ]]> <![CDATA[3.97×10 5 ]]> <![CDATA[6.26×10 -10 ]]>

[0101] From Table 3, Figure 2 It can be seen that the affinity constants K of antibodies 19B4 and 21F9 for human PG I protein are D The results were 1.72nM and 0.626nM respectively, showing a high affinity for human PG I protein.

[0102] 2.2. Identification of antigen recognition epitopes: Human PG I was immobilized on an HFC probe at a concentration of 3 μg / mL. The antigen-immobilized probe was placed in a 3 μg / mL solution of antibody 19B4 (primary antibody) to allow antibody 19B4 to bind to the human PG I protein. The probe was then placed in a 3 μg / mL solution of antibody 21F9 (secondary antibody) to allow antibody 21F9 to bind to the human PG I protein. The epitope recognized by the antibody was determined by analyzing the signal changes after the antibody bound to the antigen.

[0103] The antigenic determinant recognition results of the two antibodies are shown in Figure 3 The ordinate represents the change in thickness of the complex after the probe binds to the antibody and human PG I protein, and the abscissa represents the binding time between the antibody and human PG I protein. It can be seen that after binding to antibody 19B4, human PG I protein can also bind to antibody 21F9, with the shift value further increasing from approximately 1.0 to approximately 1.5, indicating that the two antibodies recognize different epitopes.

[0104] Example 3 Establishment of a double-antibody sandwich ELISA system based on antibodies 19B4 and 21F9 and its sensitivity analysis

[0105] Biotin labeling of antibody 21F9: To 200 μL of a 1 mg / mL solution of antibody 21F9, 10 μL of a 60 mg / mL NHS-LC-biotin solution was added. The mixture was mixed and allowed to react at room temperature for 30 minutes. The reaction was terminated by adding 50 μg of a 500 mM Tris solution (pH 9.0). Finally, a large amount of PBS buffer (pH 7.4) was added, and the mixture was centrifuged using a spin column with an exclusion limit of 30 kD to remove excess biotin molecules and equilibrate the buffer system to obtain biotin-labeled antibody 21F9 (21F9-biotin).

[0106] A double antibody sandwich enzyme-linked immunosorbent assay (ELISA) system was established using antibody 19B4 as the capture antibody and antibody 21F9-biotin as the detection antibody. The steps are as follows: 1) Coating of capture antibody 19B4: 2 μg / mL antibody 19B4 solution was prepared with 1× PBS, added to a 96-well microplate at 100 μL / well, and incubated at 4°C for 16-20 h; 2) Washing: After incubation, the liquid in the wells was discarded, and the plate was washed once with 300 μL 1× PBST, allowed to stand for 40 s, and then the liquid in the wells was discarded; 3) Blocking: E013 blocking solution (1× PBS containing 2% BSA, 5% sucrose, 0.05% Tween 20, and 0.1% proclin 300, pH 7.0) was added to the wells at 200 μL / well. 7.2) Add to the plate and block at 37°C for 2 hours. After blocking, discard the blocking solution and place in a 37°C oven to dry for 0.5-2 hours. 4) Add antigen protein: Human PG I (ABclonal, Catalog No. RP01749) is diluted with E003 diluent (1× PBS containing 2% BSA, 0.05% Tween 20 and 0.1% proclin 300, pH 7.4). 7.2) Perform a gradient dilution to the following concentrations: 250, 125, 62.5, 31.25, 15.625, 7.8125, 3.9063, and 0 pg / mL, and add 100 μL / well to the plate. Incubate at 37°C for 2 h. Simultaneously, replace the protein solution with E003 diluent as a blank control. 5) Wash the plate: Same as step 2). 6) Add detection antibody 21F9-biotin: Add 0.083 μg / mL antibody 21F9-biotin solution to the plate at 100 μL / well. Incubate at 37°C for 1 h. 7) Wash the plate: Same as step 2). 8) Add SA-HRP: Add 100× After dilution of the concentrated horseradish peroxidase-labeled streptavidin solution (SA-HRP, purchased from Wuhan Sanying, product number SA00001-0), 100 μL / well was added to the well plate and incubated at 37°C for 0.5 h; 9) Washing: Same as step 2); 10) Adding color development solution: 3,3',5,5'-tetramethylbenzidine (TMB) color development solution (purchased from Tetramethylborax, product number 4ATMB1000) was added to the well plate at 100 μL / well and incubated at 37°C for 15 min; 11) Reading: After the incubation is completed, remove the ELISA plate, add 50 μL of stop solution (1 mol / L hydrochloric acid) to each well, and immediately read the plate using a microplate reader.

[0107] The concentration of Human PG I is the horizontal axis, and the absorbance value OD 450nm The vertical axis is plotted using the four-parameter Logistic curve fitting (R 2 =0.9999), the obtained standard curve is shown in Figure 4It can be seen that the double-antibody sandwich antibody pair composed of antibodies 19B4 and 21F9 of the present invention has the advantages of good linear relationship between PGI concentration and detection signal, wide linear range, and high sensitivity when detecting human PGI protein. It can effectively and reliably detect the content of human PGI protein, with a minimum limit of 0.08 pg / mL (see Table 4).

[0108] Table 4 Sensitivity of double antibody sandwich ELISA based on antibodies 19B4 and 21F9

[0109]

[0110] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. An anti-human pepsinogen I antibody, characterized in that is a primary antibody or a secondary antibody, wherein: The amino acid sequences of CDR1, CDR2, and CDR3 on the light chain variable region of the first antibody are shown in SEQ ID NOs. 3-5, respectively, and the amino acid sequences of CDR1, CDR2, and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 8-10, respectively; The amino acid sequences of CDR1, CDR2 and CDR3 on the light chain variable region of the second antibody are shown in SEQ ID NOs. 13-15, respectively, and the amino acid sequences of CDR1, CDR2 and CDR3 on the heavy chain variable region are shown in SEQ ID NOs. 18-20, respectively.

2. The anti-human pepsinogen I antibody according to claim 1, characterized in that The amino acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 2, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO. 7; The amino acid sequence of the light chain variable region of the second antibody is shown in SEQ ID NO.12, and the amino acid sequence of the heavy chain variable region is shown in SEQ ID NO.

17.

3. The anti-human pepsinogen I antibody according to claim 1, characterized in that The amino acid sequence of the light chain of the first antibody is shown in SEQ ID NO.1, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.6; The amino acid sequence of the light chain of the second antibody is shown in SEQ ID NO.11, and the amino acid sequence of the heavy chain is shown in SEQ ID NO.

16.

4. The anti-human pepsinogen I antibody according to claim 1, characterized in that The first antibody or the second antibody is a full-length antibody or an antigen-binding region of the full-length antibody; The antigen binding region is selected from at least one of a Fab fragment, a F(ab)2 fragment, a Fv fragment, a (Fv)2 fragment, a scFv fragment and a sc(Fv)2 fragment.

5. A nucleic acid molecule or recombinant vector, characterized in that: The recombinant vector comprises the nucleic acid molecule, which encodes the first antibody or the second antibody according to any one of claims 1 to 4.

6. The nucleic acid molecule or recombinant vector according to claim 5, characterized in that The nucleic acid sequence of the light chain variable region of the first antibody is shown in SEQ ID NO. 22 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown in SEQ ID NO. 24 or a sequence complementary thereto; The nucleic acid sequence of the light chain variable region of the second antibody is shown as SEQ ID NO. 26 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain variable region is shown as SEQ ID NO. 28 or a sequence complementary thereto.

7. The nucleic acid molecule or recombinant vector according to claim 6, characterized in that The nucleic acid sequence of the light chain of the first antibody is shown in SEQ ID NO. 21 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown in SEQ ID NO. 23 or a sequence complementary thereto; The nucleic acid sequence of the light chain of the second antibody is shown as SEQ ID NO. 25 or a sequence complementary thereto, and the nucleic acid sequence of the heavy chain is shown as SEQ ID NO. 27 or a sequence complementary thereto.

8. An anti-human pepsinogen I antibody pair, characterized in that: The method comprises the first antibody and the second antibody as described in any one of claims 1 to 4.

9. A human pepsinogen I detection kit, characterized in that: The detection kit comprises the anti-human pepsinogen I antibody according to any one of claims 1 to 4 or the anti-human pepsinogen I antibody pair according to claim 8.

10. The human pepsinogen I detection kit according to claim 9, characterized in that: The detection kit is a double antibody sandwich detection kit, comprising a first antibody and a second antibody; The first antibody is a capture antibody, the second antibody is a detection antibody, and the second antibody is coupled with a detection label.

Images