Recombinant escherichia coli strain, preparation method and application thereof, and synthesis method of oryzanol A

Abstract

The invention discloses a recombinant escherichia coli strain, a preparation method and application thereof, and a synthesis method of oryzanol A, and relates to the technical field of bioengineering. The recombinant escherichia coli strain takes E.coli BL21 (DE3) as a chassis cell, and is modified as follows: (a) knockout of a gene pfkA; or, the gene pfkA is knocked out, and an untranslated region of the 5'end of the gltA gene is mutated from the sequence as shown in SEQ ID NO: 1 to the sequence as shown in SEQ ID NO: 2; and (b) inserting exogenous genes agmA, agmB, agmC, agmE and agmF, so as to obtain the gene. The recombinant Escherichia coli strain is high in growth speed and short in fermentation period (within 72 hours), a culture medium which is cheap and easy to obtain can be adopted, and compared with an existing Escherichia coli system, the fermentation yield of oryzanol A is obviously increased.

Description

Technical Field

[0001] The present invention relates to the field of bioengineering technology, in particular to a recombinant Escherichia coli strain, a preparation method and application thereof, and a method for synthesizing oryzanol A. Background Art

[0002] Angustmycin A, also known as oryzanthate, is a class of biologically important nucleoside compounds. Since its discovery in 1950, oryzanthate A has garnered significant attention for its unique cytokinin activity. Its potential as a plant growth regulator in agricultural production is promising. In recent years, with the advancement of genomics and synthetic biology, research on the biosynthesis of oryzanthate A has made significant progress.

[0003] At present, the production of oryzanol A mainly relies on two technical routes: natural strain fermentation production and heterologous expression system production.

[0004] However, the method of producing oryzanin A by fermentation of natural strains has the following limitations: (1) the yield of wild strains is unstable; (2) the fermentation cycle is long (usually 7-10 days); and (3) there are many by-products, which are difficult to separate and purify. For example, the agricultural microbial pesticide innovation team of Northeast Agricultural University isolated oryzanin A from the fermentation broth of the actinomycete Streptomyces caniferus NEAU6, but it has the above limitations.

[0005] The heterologous expression systems used to produce oryzanol A through heterologous expression systems include Escherichia coli expression systems and Streptomyces expression systems. The limitations of the existing Escherichia coli expression system for fermentation production of oryzanol A include: (1) low product concentration, (2) the presence of by-products, and (3) the need for a complex plasmid maintenance system. For example, Chen Wenqing's team at Wuhan University (Yu et al., 2021, Nat. Commun.) identified six essential genes (agmA~F) from Streptomyces. angustmyceticus JCM 4053 through genome mining and constructed a three-plasmid expression system. After the system was introduced into Escherichia coli GYJ23, only 370 μg / mL of oryzanol A was obtained after 96 hours of fermentation, and the by-product oryzanol C (110 μg / mL) was also obtained. Although the production of oryzanin A by the existing Streptomyces expression system has significantly increased, the following problems still exist: (1) slow growth of Streptomyces; (2) long fermentation cycle (5-7 days); (3) difficulty in genetic manipulation; and (4) high culture medium cost. For example, Xiang Wensheng's team at Northeast Agricultural University identified a homologous gene cluster (gvmA-F) from Streptomyces caniferus NEAU6 and cloned it into the expression plasmid pJTU2554-10H5. By conjugative transfer, this plasmid was introduced into Streptomyces coelicolor M1154, and the resulting engineered strain could produce oryzanin A only after 7 days of fermentation.

[0006] In the above prior art, when natural strains and heterologous expression systems are used to ferment and produce oryzanol A,

[0007] Problems such as long fermentation cycle (low production efficiency), low yield of oryzanin A, and high cost have limited the large-scale production and application of oryzanin A. Therefore, the development of an efficient, high-yield, and economical oryzanin A production system and method will be of great practical significance. Summary of the Invention

[0008] In view of the above-mentioned deficiencies in the prior art, the purpose of the present invention is to provide a recombinant Escherichia coli strain, a preparation method and application thereof, and a method for synthesizing oryzanol A, aiming to solve the problems of long fermentation cycle, low oryzanol A yield, or high cost when using natural strains and heterologous expression systems to produce oryzanol A.

[0009] The technical solutions of the present invention are as follows:

[0010] In a first aspect of the present invention, a recombinant Escherichia coli strain is provided, wherein the recombinant Escherichia coli strain is based on E. coli BL21 (DE3) as a base cell and undergoes the following transformations (a) and (b):

[0011] (a) knocking out the gene pfkA; or,

[0012] The pfkA gene was knocked out, and the 5′ untranslated region of the gltA gene was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2;

[0013] (b) Insertion of exogenous genes agmA, agmB, agmC, agmE and agmF.

[0014] Optionally, when performing (b) transformation, a codon-optimized exogenous gene agmA, a codon-optimized exogenous gene agmB, a codon-optimized exogenous gene agmC, a codon-optimized exogenous gene agmE, and a codon-optimized exogenous gene agmF are specifically inserted;

[0015] Among them, the nucleotide sequence of the codon-optimized exogenous gene agmA is shown in SEQ ID NO: 3, the nucleotide sequence of the codon-optimized exogenous gene agmB is shown in SEQ ID NO: 4, the nucleotide sequence of the codon-optimized exogenous gene agmC is shown in SEQ ID NO: 5, the nucleotide sequence of the codon-optimized exogenous gene agmE is shown in SEQ ID NO: 6, and the nucleotide sequence of the codon-optimized exogenous gene agmF is shown in SEQ ID NO: 7.

[0016] Optionally, when performing (b) transformation, gene RIAD_agmA, codon-optimized exogenous gene agmB, gene RIAD_agmC, codon-optimized exogenous gene agmE and codon-optimized exogenous gene agmF are specifically inserted;

[0017] The nucleotide sequence of the gene RIAD_agmA is shown in SEQ ID NO: 8;

[0018] The codon-optimized nucleotide sequence of the exogenous gene agmB is shown in SEQ ID NO: 4;

[0019] The nucleotide sequence of the gene RIAD_agmC is shown in SEQ ID NO: 9;

[0020] The codon-optimized nucleotide sequence of the exogenous gene agmE is shown in SEQ ID NO: 6;

[0021] The codon-optimized nucleotide sequence of the exogenous gene agmF is shown in SEQ ID NO:7.

[0022] Optionally, the method further comprises at least one of the following modifications (c) and (d):

[0023] (c) overexpression of the endogenous genes alsE and / or yaiE;

[0024] (d) Inserting the gene RGG_RIDD. The nucleotide sequence of the gene RGG_RIDD is shown in SEQ ID NO: 10.

[0025] A second aspect of the present invention provides a method for constructing the recombinant Escherichia coli strain of the present invention, wherein the construction method comprises the following steps:

[0026] The pfkA gene of E. coli BL21 (DE3) was knocked out to obtain the mutant strain E. coli Any-11;

[0027] Inserting exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-11 to obtain the recombinant E. coli strain; or,

[0028] The construction method comprises the following steps:

[0029] The pfkA gene of E. coli BL21 (DE3) was knocked out to obtain the mutant strain E. coli Any-11;

[0030] The 5′ untranslated region of the gltA gene of the mutant strain E. coli Any-11 was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2 to obtain the mutant strain E. coli Any-217;

[0031] Into the mutant strain E. coli Any-217, exogenous genes agmA, agmB, agmC, agmE and agmF are inserted to obtain the recombinant E. coli strain.

[0032] Optionally, the following steps are included:

[0033] Inserting the codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217 to obtain the recombinant E. coli strain; or

[0034] Into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE and the codon-optimized exogenous gene agmF are inserted to obtain the recombinant E. coli strain.

[0035] Optionally, the codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF are inserted into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, and the endogenous genes alsE and / or yaiE are overexpressed to obtain the recombinant E. coli strain; or,

[0036] In the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE and the codon-optimized exogenous gene agmF are inserted, the endogenous genes alsE and / or yaiE are overexpressed, and the gene RGG_RIDD is inserted to obtain the recombinant E. coli strain.

[0037] The third aspect of the present invention provides a use of the recombinant Escherichia coli strain of the present invention as described above and / or the recombinant Escherichia coli strain constructed by the construction method of the present invention as described above in synthesizing oryzanol A.

[0038] The fourth aspect of the invention provides a method for synthesizing oryzanol A, comprising the following steps:

[0039] The recombinant Escherichia coli strain of the present invention as described above and / or the recombinant Escherichia coli strain constructed by the construction method of the present invention as described above is fermented to synthesize the oryzanol A.

[0040] Optionally, the culture medium used for the fermentation includes the following components:

[0041] Na2HPO4 6.8g / L, KH2PO4 3.0g / L, NaCl 0.5g / L, NH4Cl 1.0g / L, yeast extract 15g / L, MgSO4 2mM, CaCl2 0.1mM and glucose 20-40g / L.

[0042] Beneficial effects: The present invention expresses the oryzanol A biosynthetic gene cluster (agmA, agmB, agmC, agmE and agmF) in Escherichia coli and knocks out the glycolysis key enzyme gene pfkA to redirect the carbon flux. It can also regulate the activity of gltA by mutating several bases in the 5' non-translated region of the gene gltA, so that its activity is reduced to 46% of the original, thereby balancing the carbon flow distribution during the fermentation process, so that the recombinant Escherichia coli strain has a fast growth rate and a short fermentation cycle (within 72 hours). Cheap and readily available culture medium can be used, and the fermentation yield of oryzanol A reaches 629 mg / L, which is significantly improved compared to the existing Escherichia coli system. The recombinant Escherichia coli strain provided by the present invention has the advantages of high efficiency, high yield and economy when used to produce oryzanol A. BRIEF DESCRIPTION OF THE DRAWINGS

[0043] Figure 1 Schematic diagram of the biosynthetic pathway and chassis modification of oryzanol A.

[0044] Figure 2 Schematic diagram of the construction of different recombinant expression plasmids in Example 2, wherein (a) is recombinant expression plasmid 024, (b) is recombinant expression plasmid 068, and (c) is recombinant expression plasmid 082.

[0045] Figure 3 The figures are the results of detecting oryzanin A by liquid chromatography in Example 4, wherein (a) is the liquid chromatogram of oryzanin A standard, and (b) is the liquid chromatogram of the fermentation broth of the recombinant strain E. coli Any-181.

[0046] Figure 4 This is a graph showing the yield of oryzanol A after fermentation of the recombinant strain E. coli Any-49 and the recombinant strain E. coli Any-60 in Example 4.

[0047] Figure 5 This is a graph showing the yield of oryzanol A after fermentation of the recombinant strain E. coli Any-60 and the recombinant strain E. coli Any-181 in Example 4.

[0048] Figure 6 This is a graph showing the yield of oryzanol A after fermentation of the recombinant strain E. coli Any-181 and the recombinant strain E. coli Any-233 under optimized fermentation conditions in Example 5. DETAILED DESCRIPTION

[0049] The present invention provides a recombinant Escherichia coli strain, a preparation method and application thereof, and a method for synthesizing oryzanol A. To clarify and clarify the objectives, technical solutions, and effects of the present invention, the present invention is described in further detail below. It should be understood that the specific embodiments described herein are intended only to illustrate the present invention and are not intended to limit the present invention.

[0050] Unless otherwise defined, all technical terms and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art of the present invention. The terms used in the specification of the present invention are only for the purpose of describing specific embodiments and are not intended to limit the present invention.

[0051] In this disclosure, for the same English abbreviation, italics indicate genes, and regular font indicates proteins or enzymes. For example, agmB indicates a gene encoding a phosphatase, also known as a phosphatase gene; agmB indicates a phosphatase. The same applies to other English abbreviations.

[0052] The present invention combines the technologies of genetic engineering, metabolic engineering and fermentation engineering to develop a more efficient cell factory for biosynthesis of oryzanol A.

[0053] The embodiment of the present invention provides a recombinant Escherichia coli strain, wherein Figure 1 As shown, the recombinant E. coli strain uses E. coli BL21 (DE3) (i.e., E. coli BL21 (DE3)) as the chassis cell, and undergoes the following transformations (a) and (b):

[0054] (a) knocking out the gene pfkA; or,

[0055] The pfkA gene was knocked out, and the 5'-untranslated region (5'-UTR) of the gltA gene was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2;

[0056] (b) Insertion of exogenous genes agmA, agmB, agmC, agmE and agmF.

[0057] The present invention expresses the oryzanol A biosynthetic gene cluster (agmA, agmB, agmC, agmE, and agmF) in Escherichia coli and knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux. It can also regulate gltA activity by mutating several bases in the 5′-UTR of the gltA gene, reducing its activity to 46% of the original, thereby balancing the carbon flow distribution during the fermentation process. The recombinant E. coli strain has a fast growth rate and a short fermentation cycle (within 72 hours). It can use cheap and readily available culture media, and the fermentation yield of oryzanol A reaches 629 mg / L, which is significantly improved compared to the existing E. coli system. The recombinant E. coli strain provided by the present invention has the advantages of high efficiency, high yield, and economy when used to produce oryzanol A.

[0058] Specifically, the activity of 6-phosphofructokinase in the glycolysis pathway of Escherichia coli is carried out by enzymes encoded by two genes, pfkA / pfkB. The pfkA gene (i.e., the 6-phosphofructokinase gene) is responsible for 90% of the function. Knocking out the pfkA gene can direct the glucose carbon source to the synthesis pathway of oryzanol A while balancing cell growth and basal metabolic needs. The gltA gene encodes citrate synthase, the starting enzyme of the TCA cycle (tricarboxylic acid cycle), which catalyzes the condensation of oxaloacetate and acetyl-CoA to produce citric acid. By regulating the expression level or activity of gltA, the carbon flow distribution during the fermentation process can be balanced.

[0059] The exogenous genes agmA, agmB, agmC, agmE and agmF are five genes derived from the genome of Streptomyces angustmyceticus JCM 4053. Among them, the gene agmA (encoding AMP phosphoribosyl hydrolase), gene agmB (encoding phosphatase), gene agmC (encoding D-psicose-6-phosphate pyrophosphokinase), gene agmE (encoding adenine phosphate psicosyltransferase), and gene agmF (encoding dehydratase) are combined with the gene alsE (NC_000913.3) encoding D-psicose-6-phosphate isomerase in E. coli BL21 (DE3) to achieve the biosynthesis of oryzanol A.

[0060] In some embodiments, when performing (b) modification, specifically inserting a codon-optimized exogenous gene agmA, a codon-optimized exogenous gene agmB, a codon-optimized exogenous gene agmC, a codon-optimized exogenous gene agmE, and a codon-optimized exogenous gene agmF;

[0061] Among them, the nucleotide sequence of the codon-optimized exogenous gene agmA is shown in SEQ ID NO: 3, the nucleotide sequence of the codon-optimized exogenous gene agmB is shown in SEQ ID NO: 4, the nucleotide sequence of the codon-optimized exogenous gene agmC is shown in SEQ ID NO: 5, the nucleotide sequence of the codon-optimized exogenous gene agmE is shown in SEQ ID NO: 6, and the nucleotide sequence of the codon-optimized exogenous gene agmF is shown in SEQ ID NO: 7.

[0062] In some embodiments, when performing (b) modification, gene RIAD_agmA, codon-optimized exogenous gene agmB, gene RIAD_agmC, codon-optimized exogenous gene agmE, and codon-optimized exogenous gene agmF are specifically inserted;

[0063] The nucleotide sequence of the gene RIAD_agmA is shown in SEQ ID NO: 8. The gene RIAD_agmA is obtained by fusing a RIAD tag nucleotide sequence to the 5' end of the codon-optimized exogenous gene agmA via a linker, that is, a protein obtained by fusing a RIAD tag to the N-terminus of AMP phosphoribosylhydrolase (agmA) via a linker. The gene RIAD_agmA encodes the obtained protein.

[0064] The codon-optimized nucleotide sequence of the exogenous gene agmB is shown in SEQ ID NO: 4;

[0065] The nucleotide sequence of the gene RIAD_agmC is shown in SEQ ID NO: 9. The gene RIAD_agmC is obtained by fusing a RIAD tag nucleotide sequence to the 5' end of the codon-optimized exogenous gene agmC via a linker, i.e., a protein obtained by fusing a RIAD tag to the N-terminus of D-psicose-6-phosphate pyrophosphokinase (agmC) via a linker. The gene RIAD_agmC encodes the obtained protein.

[0066] The codon-optimized nucleotide sequence of the exogenous gene agmE is shown in SEQ ID NO: 6;

[0067] The codon-optimized nucleotide sequence of the exogenous gene agmF is shown in SEQ ID NO:7.

[0068] In some embodiments, as Figure 1 As shown, it also includes at least one of the following modifications (c) and (d):

[0069] (c) overexpression of the endogenous genes alsE and / or yaiE;

[0070] (d) Inserting the gene RGG_RIDD. The nucleotide sequence of the gene RGG_RIDD is shown in SEQ ID NO: 10.

[0071] like Figure 1 As shown, the phosphatase (agmB) removes a phosphate group from adenosine monophosphate (AMP) to produce adenosine as a byproduct. Accumulation of adenosine inhibits the dehydratase (agmF) in the pathway, thereby reducing the production of the target product, oryzanol A. The endogenous nucleoside phosphorylase (yaiE) in Escherichia coli converts adenosine to adenine, which is one of the substrates of the adenine phosphate-psicosyltransferase (agmE) in the pathway. Therefore, overexpressing the endogenous genes alsE and yaiE can increase oryzanol A production.

[0072] The present invention utilizes the characteristics of RGG sequence (repeating sequence rich in arginine and glycine) and artificially designed RIAD / RIDD tag (with specific binding ability and bioorthogonality) to issue a kind of efficient metabolic engineering tool. Specifically, after fusion of RGG sequence and RIDD tag, droplets can be spontaneously formed in vivo, and the protein fused with RIAD tag tends to aggregate in droplets, thereby contributing to improving metabolic efficiency. Therefore, the present invention fuses RIAD tag by linker at the N-terminus of key enzymes agmA and agmC, inserts into Escherichia coli, and inserts gene RGG_RIDD, which helps to improve the synthesis of oryzanol A. That is, the present invention combines liquid-liquid phase separation (LLPS) technology to construct enzyme catalytic micro-region, realizes metabolic flow synergy, and finally significantly improves the concentration of oryzanol A (72h fermentation can achieve a yield of up to 1205mg / L).

[0073] An embodiment of the present invention provides a method for constructing the recombinant Escherichia coli strain of the present invention, wherein the construction method comprises the following steps:

[0074] S11, knocking out the pfkA gene of E. coli BL21 (DE3) to obtain the mutant strain E. coli Any-11;

[0075] S12. Inserting exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-11 to obtain the recombinant E. coli strain.

[0076] The present invention expresses the oryzanol A biosynthetic gene cluster (agmA, agmB, agmC, agmE, and agmF) in Escherichia coli and knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux. This allows the recombinant E. coli strain to grow rapidly and have a short fermentation cycle (less than 72 hours). Cheap and readily available culture media can be used, and the fermentation yield of oryzanol A reaches 629 mg / L, significantly improving the fermentation yield compared to existing E. coli systems. The recombinant E. coli strain provided by the present invention has the advantages of high efficiency, high yield, and economy when used to produce oryzanol A.

[0077] In step S11, specifically, the pEcCas / pEcgRNA editing tool can be used to knock out the pfkA gene in E. coli BL21 (DE3).

[0078] In step S12, in some specific embodiments, the codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF are inserted into the mutant strain E. coli Any-11 to obtain the recombinant E. coli strain.

[0079] In some specific embodiments, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE and the codon-optimized exogenous gene agmF are inserted into the mutant strain E. coli Any-11 to obtain the recombinant E. coli strain.

[0080] In some specific embodiments, the codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted into the mutant strain E. coli Any-11, and the endogenous genes alsE and / or yaiE are overexpressed to obtain the recombinant E. coli strain. This can further increase the yield of oryzanol A. This step may specifically include:

[0081] The codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF were connected to the alsE gene fragment cloned from the E. coli BL21 (DE3) genome by Gibson assembly method to obtain the first recombinant expression plasmid;

[0082] The Gibson assembly method was used to connect the genes yaiE and agmE to the second plasmid to obtain the second recombinant expression plasmid;

[0083] The first recombinant expression plasmid and the second recombinant expression plasmid are co-transformed into the mutant strain E. coliAny-11 to obtain the recombinant E. coli strain.

[0084] The present invention adopts a double-plasmid expression system, which can improve genetic stability.

[0085] In some embodiments, the recombinant E. coli strain is obtained by inserting the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF into the mutant strain E. coli Any-11, overexpressing the endogenous genes alsE and / or yaiE, and inserting the gene RGG_RIDD. This step may specifically include:

[0086] The gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF were ligated to the third plasmid using the Gibson assembly method to obtain a third recombinant expression plasmid;

[0087] The yaiE and agmE genes and the RGG_RIDD gene were connected to the fourth plasmid using the Gibson assembly method to obtain the fourth recombinant expression plasmid.

[0088] The third recombinant expression plasmid and the fourth recombinant expression plasmid are co-transformed into the mutant strain E. coliAny-11 to obtain the recombinant E. coli strain.

[0089] An embodiment of the present invention provides a method for constructing the recombinant Escherichia coli strain of the present invention, wherein the construction method comprises the following steps:

[0090] S21, knocking out the pfkA gene of E. coli BL21 (DE3) to obtain the mutant strain E. coli Any-11;

[0091] S22, mutating the 5′-UTR of the gltA gene of the mutant strain E. coli Any-11 from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2 to obtain the mutant strain E. coli Any-217;

[0092] S23. Inserting exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-217 to obtain the recombinant E. coli strain.

[0093] The present invention expresses the oryzanol A biosynthetic gene cluster (agmA, agmB, agmC, agmE, and agmF) in Escherichia coli, knocks out the key glycolysis enzyme gene pfkA to redirect carbon flux, and regulates gltA activity by mutating several bases in the 5′-UTR of the gltA gene, reducing its activity to 46% of the original, thereby balancing the carbon flow distribution during the fermentation process. The recombinant E. coli strain has a fast growth rate and a short fermentation cycle (within 72 hours). It can use cheap and readily available culture media, and the fermentation yield of oryzanol A reaches 629 mg / L, which is significantly improved compared to the existing E. coli system. The recombinant E. coli strain provided by the present invention has the advantages of high efficiency, high yield, and economy when used to produce oryzanol A.

[0094] In step S21, specifically, the pEcCas / pEcgRNA editing tool can be used to knock out the pfkA gene in E. coli BL21 (DE3).

[0095] In step S23, in some embodiments, the codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted into the mutant strain E. coli Any-217 to obtain the recombinant E. coli strain.

[0096] In some embodiments, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE and the codon-optimized exogenous gene agmF are inserted into the mutant strain E. coli Any-217 to obtain the recombinant E. coli strain.

[0097] In some embodiments, the codon-optimized exogenous genes agmA, agmB, agmC, agmE, and agmF are inserted into the mutant strain E. coli Any-217, and the endogenous genes alsE and / or yaiE are overexpressed to obtain the recombinant E. coli strain. The specific steps are described above.

[0098] In some specific embodiments, the recombinant E. coli strain is obtained by inserting the RIAD_agmA gene, the codon-optimized exogenous gene agmB, the RIAD_agmC gene, the codon-optimized exogenous gene agmE, and the codon-optimized exogenous gene agmF into the mutant strain E. coli Any-217, overexpressing the endogenous genes alsE and / or yaiE, and inserting the RGG_RIDD gene. The specific steps are described above.

[0099] By overexpressing the endogenous genes alsE and / or yaiE, the inhibitory effect of the byproduct adenosine accumulation on the dehydratase (agmF) in the pathway is avoided, thereby increasing the production of the target product oryzanol A. By inserting the genes RIAD_agmA, RIAD_agmC, and RGG_RIDD, the RGG sequence is fused with the RIDD tag, and droplets can be spontaneously formed in the body. Proteins fused with the RIAD tag tend to aggregate in the droplets, which helps to improve metabolic efficiency.

[0100] The embodiments of the present invention further provide a use of the recombinant Escherichia coli strain of the present invention as described above and / or the recombinant Escherichia coli strain constructed using the construction method of the present invention as described above in synthesizing oryzanol A.

[0101] The present invention also provides a method for synthesizing oryzanol A, which comprises the following steps:

[0102] The recombinant Escherichia coli strain of the present invention as described above and / or the recombinant Escherichia coli strain constructed by the construction method of the present invention as described above is fermented to synthesize the oryzanol A.

[0103] Because recombinant E. coli strains have the advantages of fast growth and high gene conversion efficiency, the method for synthesizing oryzanol A provided by the present invention has a short fermentation cycle (less than 72 hours). In addition, the shake flask fermentation product has a high yield of oryzanol A (629-1205 mg / L), thereby improving production efficiency and having stronger economic competitiveness and application prospects in actual production.

[0104] In some embodiments, the culture medium used for the fermentation includes the following components:

[0105] Na2HPO4 6.8g / L, KH2PO4 3.0g / L, NaCl 0.5g / L, NH4Cl 1.0g / L, (Yeast extract 15g / L, MgSO4 2mM, CaCl2 0.1mM and glucose 20-40g / L.

[0106] The culture medium has low-cost components and can increase the yield of oryzanol A.

[0107] The present invention will be further described below with reference to specific examples.

[0108] In the following examples, unless otherwise specified, the reagents, raw materials, instruments, etc. used are all commercially available products.

[0109] In the following embodiments, some symbols have the following meanings:

[0110] OD600 : The absorbance value of a certain solution at a wavelength of 600nm.

[0111] Example 1

[0112] The pfkA gene in E. coli BL21 (DE3) was knocked out using the pEcCas / pEcgRNA editing tool to obtain the mutant strain E. coli Any-11. Based on the mutant strain E. coli Any-11, the 5'-UTR sequence of the gltA gene was further mutated to reduce its activity to 46% of its original value, resulting in the strain E. coli Any-217.

[0113] (1) Knockout of the pfkA gene in E. coli BL21 (DE3) to obtain the mutant strain E. coli Any-11

[0114] Using the E. coli BL21 (DE3) genome as a template, PCR amplification was performed using left-arm primers (pfkA-up-f and pfkA-up-r) and right-arm primers (pfkA-dn-f and pfkA-dn-r) to obtain the pfkA upstream homologous left arm and the pfkA downstream homologous right arm. Fusion PCR amplification of the above-mentioned pfkA upstream homologous left arm and pfkA downstream homologous right arm was performed using pfkA-up-f and pfkA-dn-r, and the knockout donor_pfkA fragment was obtained by gel excision and recovery.

[0115] The CHOPCHOP website was used to design gRNA for knockout of the pfkA gene in E. coli BL21 (DE3), and the top-ranked gRNA_pfkA sequence was selected for knockout. The sequence of gRNA_pfkA was tctgacatgatcaaccgtgg (as shown in SEQ ID NO: 11). Then, using the pEcgRNA plasmid (catalog number P34353, provided by Wuhan Miaoling Biotechnology Co., Ltd.) as a template, PCR amplification was performed with primers pEcgRNA-pfkA-f and pEcgRNA-pfkA-r, gel excision was performed to recover linear fragments, and Gibson enzyme ligation reaction was performed to obtain positive clones, indicating that the knockout plasmid pEcgRNA-pfkA was successfully constructed.

[0116] The pECcas9 plasmid (catalog number P31042, provided by Wuhan Miaoling Biotechnology Co., Ltd.), knockout plasmid pEcgRNA-pfkA, and knockout donor_pfkA fragment were transformed into E. coli BL21 (DE3), and the mutant strain E. coli Any-11 was obtained by homologous recombination screening.

[0117] (2) The 5′-UTR sequence of the gltA gene of the mutant strain E. coli Any-11 was mutated to obtain the mutant strain E. coli Any-217

[0118] Using the E. coli BL21 (DE3) genome as a template, PCR amplification was performed using left-arm primers (gltA-up-f and gltA-up46-r) and right-arm primers (gltA-dn-f and gltA-dn46-r) to obtain the 5'-UTA upstream homologous left arm of the gltA gene and the 5'-UTA downstream homologous right arm of the gltA gene, respectively. Fusion PCR amplification of the above-mentioned 5'-UTA upstream homologous left arm of the gltA gene and the 5'-UTA downstream homologous right arm of the gltA gene was performed using gltA-up-f and gltA-dn46-r, and the mutant donor_gltA fragment was recovered by gel excision.

[0119] The CHOPCHOP website was used to design gRNA for the 5'-UTR sequence mutation of the gltA gene in E. coli BL21 (DE3). The top-ranked gRNA_gltA sequence was selected for mutation. The gRNA_gltA sequence was ggcgctaaggagaccttaaa (specifically, as shown in SEQ ID NO: 12). Using the pEcgRNA plasmid (specific information as above) as a template, PCR amplification was performed with primers pEcgRNA1-gltA-F and pEcgRNA1-gltA-R, gel excision was performed to recover linear fragments, and Gibson enzyme ligation reaction was performed to obtain positive clones, indicating that the mutant plasmid pEcgRNA-gltA was successfully constructed.

[0120] The pECcas9 plasmid (detailed information is the same as above), the mutant plasmid pEcgRNA-gltA and the mutant donor_gltA fragment were transformed into the mutant strain E. coli Any-11, and the mutant strain E. coli Any-217 was obtained by homologous recombination screening.

[0121] The specific information of the primers used is shown in Table 1.

[0122] Table 1. Primer sequence information used in Example 1

[0123] Primers Sequence number Primers Sequence number pfkA-up-f (forward primer) SEQ ID NO: 13 gltA-up-f (forward primer) SEQ ID NO: 19 pfkA-up-r (reverse primer) SEQ ID NO: 14 gltA-up46-r (reverse primer) SEQ ID NO: 20 pfkA-dn-f (forward primer) SEQ ID NO: 15 gltA-dw-f (forward primer) SEQ ID NO: 21 pfkA-dn-r (reverse primer) SEQ ID NO: 16 gltA-dw46-r (reverse primer) SEQ ID NO: 22 pEcgRNA-pfkA-f (forward primer) SEQ ID NO: 17 pEcgRNA1-gltA-F (forward primer) SEQ ID NO: 23 pEcgRNA-pfkA-r (reverse primer) SEQ ID NO: 18 pEcgRNA1-gltA-R (reverse primer) SEQ ID NO: 24

[0124] Example 2

[0125] The construction of recombinant expression plasmid 024, recombinant expression plasmid 068 and recombinant expression plasmid 082 specifically includes the following steps:

[0126] (1) Construction of recombinant expression plasmid 024

[0127] like Figure 2 As shown in (a), the nucleotide sequences of five genes, agmA, agmB, agmC, agmE, and agmF, derived from the genome of Streptomyces angustmyceticus JCM 4053 were codon-optimized in an E. coli chassis. The nucleotide sequences of the codon-optimized genes agmA, agmB, agmC, agmE, and agmF are shown in SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, and SEQ ID NO: 7, respectively. The alsE gene fragment was cloned from the genome of E. coli BL21 (DE3);

[0128] PCR amplification was performed using primers agmA-F and agmA-R to obtain the amplified product agmA;

[0129] PCR amplification was performed using primers agmB-F and agmB-R to obtain the amplified product agmB;

[0130] PCR amplification was performed using primers agmC-F and agmC-R to obtain the amplified product agmC;

[0131] PCR amplification was performed using primers agmE-F1 and agmE-R1 to obtain the amplified product agmE;

[0132] PCR amplification was performed using primers agmF-F and agmF-R to obtain the amplified product agmF;

[0133] PCR amplification was performed using primers alsE-F and alsE-R to obtain the amplified product alsE;

[0134] The five codon-optimized genes (agmA, agmB, agmC, agmE, and agmF) obtained after the above amplification were ligated together with alsE to the backbone of plasmid pCDFDuet-1 (a common commercial vector) using the Gibson assembly method to obtain recombinant expression plasmid 024. The recombinant expression plasmid 024 was transformed into E. coli DH5α strain, and the successful construction was verified by sequencing.

[0135] (2) Construction of recombinant expression plasmid 068

[0136] like Figure 2 As shown in (b), the RIAD tag sequence was fused to the N-terminus of the key enzymes agmA and agmC via a linker to obtain genes RIAD_agmA (the nucleotide sequence of which is shown in SEQ ID NO: 8) and RIAD_agmC (the nucleotide sequence of which is shown in SEQ ID NO: 9);

[0137] PCR amplification was performed using primers RIAD_agmA-F and agmA-R to obtain the amplified product RIAD_agmA;

[0138] PCR amplification was performed using primers agmB-F and agmB-R to obtain the amplified product agmB;

[0139] PCR amplification was performed using primers RIAD_agmC-F and agmC-R to obtain the amplified product RIAD_agmC;

[0140] PCR amplification was performed using primers agmE-F and agmE-R to obtain the amplified product agmE;

[0141] PCR amplification was performed using primers agmF-F1 and agmF-R1 to obtain the amplified product agmF;

[0142] PCR amplification was performed using primers alsE-F and alsE-R to obtain the amplified product alsE;

[0143] The amplified products alsE, agmB, agmE, agmF, as well as RIAD_agmA and RIAD_agmC, were ligated to the backbone of plasmid pCDFDuet-1 (a common commercial vector) using the Gibson assembly method to obtain recombinant expression plasmid 068. The recombinant expression plasmid 068 was transformed into E. coli DH5α strain, and the successful construction was verified by sequencing.

[0144] (3) Construction of recombinant expression plasmid 082

[0145] like Figure 2 As shown in (c), the gene yaiE (NC_000913.3) encoding nucleoside phosphorylase was amplified from the genome of E. coli BL21 (DE3) using primers (yaiE-F and yaiE-R) to obtain the PCR amplification product yaiE;

[0146] PCR amplification was performed using primers alsE-F2 and alsE-R2 to obtain the amplified product alsE;

[0147] Primers RGG_RIDD-F and RGG_RIDD-R were used for PCR amplification to obtain the synthetic gene fragment RGG_RIDD (as shown in SEQ ID NO: 10).

[0148] Then, the PCR amplification products (yaiE, agmE) and the synthetic gene fragment RGG_RIDD were connected with the backbone fragment of plasmid pET28a (a common commercial vector) using the Gibson assembly method to obtain the recombinant expression plasmid 082. The recombinant expression plasmid 082 was transformed into the E. coli DH5α strain, and the successful construction was verified by sequencing.

[0149] The specific information of the primers used is shown in Table 2.

[0150] Table 2. Primer sequence information used in Example 2

[0151]

[0152] Example 3

[0153] The construction of the recombinant Escherichia coli strain includes the following steps:

[0154] The recombinant expression plasmid 024 was transformed into E. coli BL21 (DE3) to obtain a recombinant E. coli strain, which was designated as the recombinant strain E. coli Any-49;

[0155] The recombinant expression plasmid 024 was transformed into the mutant strain E. coli Any-11 to obtain a recombinant E. coli strain, which was recorded as the recombinant strain E. coli Any-60;

[0156] The recombinant expression plasmid 068 and the recombinant expression plasmid 082 were co-transformed into the mutant strain E. coli Any-11 to obtain a recombinant E. coli strain, which was recorded as the recombinant strain E. coli Any-181.

[0157] The recombinant expression plasmid 068 and the recombinant expression plasmid 082 were co-transformed into the mutant strain E. coli Any-217 to obtain a recombinant E. coli strain, which was recorded as the recombinant strain E. coli Any-233.

[0158] Example 4 Fermentation production of oryzanol A using recombinant Escherichia coli strains

[0159] The recombinant E. coli strain constructed in Example 3 was used to ferment and produce oryzanol A, which specifically included the following steps:

[0160] M9Y medium was provided, which included the following components: Na2HPO4 6.8 g / L, KH2PO4 3.0 g / L, NaCl 0.5 g / L, NH4Cl 1.0 g / L, yeast extract 15 g / L, MgSO4 2 mM and CaCl2 0.1 mM, and the solvent was ultrapure water.

[0161] Colonies were picked from fresh transformation plates of recombinant strains E. coli Any-49, E. coli Any-60, and E. coli Any-181, respectively, and inoculated into 10 mL of M9Y medium supplemented with glucose (20 g / L), streptomycin (50 mg / L), and kanamycin (50 mg / L), and cultured at 37°C for 12 hours to prepare seed solutions.

[0162] Subsequently, another 20 mL of M9Y medium supplemented with glucose (20 g / L), streptomycin (50 mg / L), and kanamycin (50 mg / L) was added to a 100 mL shake flask and the cells were grown at a starting OD of 0. 600 The seed liquid was inoculated at a ratio of 1.0, and 50 μM IPTG (isopropyl-β-D-thiogalactoside) was added at the same time, and fermented at 30°C and 200 rpm for 72 hours, that is, the recombinant strain E. coli Any-49, the recombinant strain E. coli Any-60 and the recombinant strain E. coli Any-181 were fermented at 30°C and 200 rpm for 72 hours, respectively.

[0163] After the fermentation was completed, 50 μL of the fermentation supernatant was mixed with 200 μL of acetonitrile, centrifuged at 12000 rpm for 5 min, and then the supernatant was filtered through a 0.45 μm filter membrane and transferred to a chromatography bottle.

[0164] The yield of oryzanin A was determined using an Agilent 1290 liquid chromatograph equipped with a photodiode array detector. The chromatographic column was an Agilent Poroshell 120EC-C18 (4 μm particle size, 4.6 × 250 mm). The injection volume was 5 μL, the mobile phases A and B were 10 mM ammonium acetate in water, and acetonitrile, respectively. The elution program was an isocratic elution of 90% A / 10% B for 10 minutes at a flow rate of 0.5 mL / min. The detection wavelength was 254 nm.

[0165] The results showed that chromatographic peaks consistent with those of the oryzanol A standard (brand: MCE, product number: HY-101835) were detected in all samples, indicating that the constructed recombinant E. coli strains were able to produce oryzanol A. The liquid chromatogram of the oryzanol A standard is shown in Figure 2. Figure 3 As shown in (a), the liquid chromatogram of the fermentation broth of the recombinant strain E. coli Any-181 is as shown in Figure 3 As shown in (b) in .

[0166] The yield of oryzanol A was quantitatively analyzed by standard curve. Figure 4 and Figure 5As shown, the yields of oryzanol A in the fermentation broth of the recombinant strains E. coli Any-49, E. coli Any-60 and E. coli Any-181 were 225 mg / L, 629 mg / L and 667 mg / L, respectively.

[0167] Example 5

[0168] Fermentation conditions were optimized for recombinant strains E. coli Any-181 and E. coli Any-233. A similar method was used as in Example 4, with the only difference being that the amount of glucose added to the M9Y medium was increased from 20 g / L to 40 g / L, and the fermentation temperature was raised from 30°C to 37°C. Other conditions remained the same, and fermentations of recombinant strains E. coli Any-181 and E. coli Any-233 were performed separately. The oryzanol A production results after fermentation are shown in Figure 4. Figure 6 As shown in the figure, after the fermentation conditions were optimized, the yields of oryzanol A in the fermentation broth of the recombinant strain E. coli Any-181 and the recombinant strain E. coli Any-233 were 1058 mg / L and 1205 mg / L, respectively (corresponding to Figure 6 Any-181* and Any-233* in ).

[0169] It should be understood that the application of the present invention is not limited to the above examples. For those skilled in the art, improvements or changes can be made based on the above description. All these improvements and changes should fall within the scope of protection of the claims attached to the present invention.

Claims

1. A recombinant Escherichia coli strain, characterized in that The recombinant E. coli strain was transformed with E. coli BL21 (DE3) as the base cell, and the following (a) and (b) were performed: (a) knocking out the gene pfkA; or, The pfkA gene was knocked out, and the 5′ untranslated region of the gltA gene was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2; (b) Insertion of exogenous genes agmA, agmB, agmC, agmE and agmF.

2. The recombinant Escherichia coli strain according to claim 1, characterized in that When performing (b) transformation, specifically inserting a codon-optimized exogenous gene agmA, a codon-optimized exogenous gene agmB, a codon-optimized exogenous gene agmC, a codon-optimized exogenous gene agmE, and a codon-optimized exogenous gene agmF; Among them, the nucleotide sequence of the codon-optimized exogenous gene agmA is shown in SEQ ID NO: 3, the nucleotide sequence of the codon-optimized exogenous gene agmB is shown in SEQ ID NO: 4, the nucleotide sequence of the codon-optimized exogenous gene agmC is shown in SEQ ID NO: 5, the nucleotide sequence of the codon-optimized exogenous gene agmE is shown in SEQ ID NO: 6, and the nucleotide sequence of the codon-optimized exogenous gene agmF is shown in SEQ ID NO:

7.

3. The recombinant Escherichia coli strain according to claim 1, characterized in that When performing (b) modification, specifically, gene RIAD_agmA, codon-optimized exogenous gene agmB, gene RIAD_agmC, codon-optimized exogenous gene agmE, and codon-optimized exogenous gene agmF are inserted; The nucleotide sequence of the gene RIAD_agmA is shown in SEQ ID NO: 8; The codon-optimized nucleotide sequence of the exogenous gene agmB is shown in SEQ ID NO: 4; The nucleotide sequence of the gene RIAD_agmC is shown in SEQ ID NO: 9; The codon-optimized nucleotide sequence of the exogenous gene agmE is shown in SEQ ID NO: 6; The codon-optimized nucleotide sequence of the exogenous gene agmF is shown in SEQ ID NO:

7.

4. The recombinant Escherichia coli strain according to any one of claims 1 to 3, characterized in that Also comprising at least one of the following modifications (c) and (d): (c) overexpression of the endogenous genes alsE and / or yaiE; (d) inserting the gene RGG_RIDD, the nucleotide sequence of the gene RGG_RIDD is shown in SEQ ID NO:

10.

5. A method for constructing the recombinant Escherichia coli strain according to any one of claims 1 to 4, characterized in that: The construction method comprises the following steps: The pfkA gene of E. coli BL21 (DE3) was knocked out to obtain the mutant strain E. coli Any-11; Inserting exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-11 to obtain the recombinant E. coli strain; or, The construction method comprises the following steps: The pfkA gene of E. coli BL21 (DE3) was knocked out to obtain the mutant strain E. coli Any-11; The 5′ untranslated region of the gltA gene of the mutant strain E. coli Any-11 was mutated from the sequence shown in SEQ ID NO: 1 to the sequence shown in SEQ ID NO: 2 to obtain the mutant strain E. coli Any-217; Into the mutant strain E. coli Any-217, exogenous genes agmA, agmB, agmC, agmE and agmF are inserted to obtain the recombinant E. coli strain.

6. The construction method according to claim 5, characterized in that: The steps include: Inserting the codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217 to obtain the recombinant E. coli strain; or Into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE and the codon-optimized exogenous gene agmF are inserted to obtain the recombinant E. coli strain.

7. The construction method according to claim 6, characterized in that: Inserting the codon-optimized exogenous genes agmA, agmB, agmC, agmE and agmF into the mutant strain E. coli Any-11 or the mutant strain E. coli Any-217, and overexpressing the endogenous genes alsE and / or yaiE to obtain the recombinant E. coli strain; or, In the mutant strain E.coli Any-11 or the mutant strain E.coli Any-217, the gene RIAD_agmA, the codon-optimized exogenous gene agmB, the gene RIAD_agmC, the codon-optimized exogenous gene agmE and the codon-optimized exogenous gene gmF are inserted, the endogenous genes alsE and / or yaiE are overexpressed, and the gene RGG_RIDD is inserted to obtain the recombinant E. coli strain.

8. Use of the recombinant Escherichia coli strain according to any one of claims 1 to 4 and / or the recombinant Escherichia coli strain constructed by the construction method according to any one of claims 5 to 7 in synthesizing oryzanol A.

9. A method for synthesizing oryzanol A, characterized in that: The steps include: The recombinant Escherichia coli strain according to any one of claims 1 to 4 and / or the recombinant Escherichia coli strain constructed by the construction method according to any one of claims 5 to 7 is fermented to synthesize the oryzanol A.

10. The synthesis method according to claim 9, characterized in that The culture medium used in the fermentation includes the following components: Na2HPO4 6.8g / L, KH2PO4 3.0g / L, NaCl 0.5g / L, NH4Cl 1.0g / L, yeast extract 15g / L, MgSO4 2mM, CaCl2 0.1mM and glucose 20-40g / L.

Images