Escherichia coli for producing L-histidine as well as construction method and application of escherichia coli

Abstract

The invention belongs to the technical field of microbial engineering and genetic engineering, and discloses escherichia coli for producing L-histidine as well as a construction method and application of the escherichia coli. The escherichia coli contains a growth dependent type promoter PprpB of a methyl isocitrate lyase gene prpB and / or a stable phase dependent type promoter PydgI of an ornithine reverse transport protein / lysine permease gene ydgI. According to the escherichia coli for producing L-histidine, expression of glutamine phosphoribose pyrophosphate transamidase gene purF is regulated and controlled by using growth dependent promoter PprpB of methylisocitrate lyase gene prpB, and table of ATP phosphoribose transferase gene hisG is regulated and controlled by using stable phase dependent promoter PydgI of ornithine reverse transport protein / lysine permease gene ydgI According to the invention, cell growth energy supply in the earlier stage of thalli and L-histidine metabolic flux in the later stage of thalli production can be realized, so that balanced distribution of metabolic flux between cell growth of a microbial cell factory and L-histidine production is effectively balanced.

Description

Technical Field

[0001] The present invention relates to the technical field of microbial engineering and genetic engineering, and in particular to an Escherichia coli for producing L-histidine, a construction method thereof and an application thereof. Background Art

[0002] L-histidine is a synthetic precursor for a variety of drugs and can be used to treat a variety of diseases, including ulcers, renal failure, rheumatoid arthritis, and Alzheimer's disease. It has a wide range of applications in medicine, industry, food, cosmetics, animal husbandry, and other fields, and has important economic and social value.

[0003] Currently, there are three main methods for producing L-histidine: microbial fermentation, chemical synthesis, and protein hydrolysis. Microbial fermentation, with its advantages of a wide range of raw materials, relatively simple production processes, minimal environmental impact, and high product purity, has become the mainstream method for L-histidine production.

[0004] Improving L-histidine production in chassis microorganisms is a continuous goal of rational metabolic engineering breeding. During the systematic reconstruction of chassis microbial metabolic networks, increasing or decreasing the expression intensity of target genes is a common strategy for improving L-histidine production. For example, increasing the expression of key enzymes in the target product synthesis pathway, increasing the expression of target product efflux membrane proteins, and increasing the expression of key enzymes in the target product precursor synthesis pathway have significant beneficial effects on improving chassis microbial L-histidine production. Furthermore, dynamic regulation of key metabolic targets in the L-histidine synthesis pathway can further balance cell growth and L-histidine production, promoting efficient L-histidine synthesis in microbial cell factories.

[0005] In order to obtain the optimal target product synthesis rate, a large number of trial-and-error experiments are often required to obtain the appropriate target gene expression dosage. On the basis of controlling the appropriate gene dosage, regulating the expression intensity of the target gene in the genome is an effective strategy to further optimize the metabolic flux intensity of the synthesis pathway. Gene expression regulation is a complex process involving the coordinated cooperation of multiple expression regulatory elements. Promoter engineering can precisely control the transcription of target genes to meet the challenges of coordinated expression regulation of multiple genes in the target product synthesis metabolic network. Therefore, using promoter engineering to modify the genes of microorganisms is promising. Summary of the Invention

[0006] The purpose of the present invention is to solve the problems in the prior art of obtaining the optimal target product synthesis rate by regulating gene expression, such as complex process, high trial and error cost, and great difficulty in operation, thereby providing an Escherichia coli for producing L-histidine and its construction method and application. The Escherichia coli utilizes the methyl isocitrate lyase gene to produce L-histidine. prpB Growth-dependent promoter P prpBand / or ornithine antiporter / lysine permease genes ydgI The stationary phase-dependent promoter P ydgI Regulating gene expression can achieve the energy supply for early cell growth and the metabolic flux required for L-histidine production in the later stage of the bacteria, thereby effectively balancing the metabolic flux distribution between cell growth and L-histidine production in the microbial cell factory.

[0007] In order to achieve the above object, the technical solution of the present invention is as follows: In a first aspect, the present invention provides an Escherichia coli for producing L-histidine, wherein the Escherichia coli contains a methyl isocitrate lyase gene. prpB Growth-dependent promoter P prpB and / or ornithine antiporter / lysine permease genes ydgI The stationary phase-dependent promoter P ydgI ;in, The methyl isocitrate lyase gene prpB Growth-dependent promoter P prpB The base sequence is shown in SEQ ID NO: 1; and / or The ornithine antiporter / lysine permease gene ydgI The stationary phase-dependent promoter P ydgI The base sequence is shown in SEQ ID NO: 2.

[0008] In a second aspect, the present invention provides use of the Escherichia coli according to the first aspect in producing L-histidine.

[0009] In a third aspect, the present invention provides a method for producing L-histidine, comprising: culturing the strain on a slant, culturing the strain on a seed, inoculating the strain on a fermentation medium, culturing the strain on a shaker, and adding glucose containing betaine after the substrate sugar is depleted; wherein, The bacterial species is the Escherichia coli described in the first aspect.

[0010] In the above technical solution, the inventors found two dynamic regulation promoters triggered by betaine during the research process: based on the growth-dependent promoter P prpB (Growth phase-dependent promoter, GPP), stable phase-dependent promoter P ydgI(Stationary phase-dependent promoter, SPP) gene dynamic regulatory element. Therefore, the present invention adopts two regulatory methods to regulate the 5-phosphoribosyl-1-pyrophosphate (PRPP) node glutamine phosphoribosyl pyrophosphate transaminase (by purF gene encoding, NCBI-GeneID:946794, EC:2.4.2.14) and ATP phosphoribosyltransferase (encoded by hisG Gene encoding, NCBI-GeneID:946549, EC:2.4.2.17) for promoter dynamic regulation to refine the redirected carbon flux distribution.

[0011] Specifically, the present invention uses CRISPR / Cas9-mediated gene editing technology to modify the glutamine phosphoribosylpyrophosphate amidotransferase gene of the production strain. purF The original promoter P purF Replaced with methyl isocitrate lyase gene prpB Growth-dependent promoter P prpB , and / or ATP phosphoribosyltransferase gene hisG The original promoter P hisG Replaced with ornithine antiporter / lysine permease gene ydgI The stationary phase-dependent promoter P ydgI , thereby achieving the goal of purF Genes are normally transcribed and expressed hisG Gene low transcription expression to ensure sufficient metabolic flux for energy ATP and the synthesis of various primary metabolites and to maintain normal cell growth; and when the microbial cells are in the stable growth stage, P ydgI Regulation hisG Gene expression automatically switches to high transcription expression and P prpB Automatic control purF The gene was switched to a low expression mode to redirect more metabolic flux to L-histidine synthesis.

[0012] The L-histidine-producing Escherichia coli provided by the present invention can trigger dynamic regulation by adding betaine, and dynamically regulate the metabolic flux distribution of the PRPP metabolic node according to the requirements of different fermentation stages, thereby improving the synthesis efficiency of L-histidine.

[0013] Other features and advantages of the present invention will be described in detail in the following detailed description. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] The accompanying drawings are used to provide a further understanding of the present invention and constitute a part of the specification. Together with the following detailed description, they are used to explain the present invention but do not constitute a limitation of the present invention. In the accompanying drawings: Figure 1 Schematic diagram of the metabolic flux distribution of the PRPP node of the L-histidine-producing Escherichia coli dynamically regulated L-histidine-producing strain of the present invention; Figure 2 is the pGRB plasmid map; Figure 3 This is the pREDCas9 plasmid map. DETAILED DESCRIPTION

[0015] The specific embodiments of the present invention are described in detail below. It should be understood that the specific embodiments described herein are only used to illustrate and explain the present invention and are not intended to limit the present invention. The essence and scope of the present invention are limited only by the claims. Unless otherwise specified, the technical means used in the present invention are methods well known to those skilled in the art. For those skilled in the art, various changes or modifications to the material components and dosages in these embodiments, without departing from the essence and scope of the present invention, also fall within the scope of protection of the present invention.

[0016] The endpoints of the ranges and any values ​​disclosed herein are not limited to the precise ranges or values, and these ranges or values ​​should be understood to include values ​​close to these ranges or values. For numerical ranges, the endpoints of each range, the endpoints of each range and individual point values, and the individual point values ​​can be combined with each other to obtain one or more new numerical ranges, which should be considered to be specifically disclosed herein.

[0017] In a first aspect, the present invention provides an Escherichia coli for producing L-histidine, wherein the Escherichia coli contains a methyl isocitrate lyase gene. prpB Growth-dependent promoter P prpB and / or ornithine antiporter / lysine permease genes ydgI The stationary phase-dependent promoter P ydgI ;in, The methyl isocitrate lyase gene prpB Growth-dependent promoter P prpB The base sequence is shown in SEQ ID NO: 1; and / or The ornithine antiporter / lysine permease gene ydgI The stationary phase-dependent promoter P ydgI The base sequence is shown in SEQ ID NO: 2.

[0018] SEQ ID NO: 1 TGAAATTAAACATTTAATTTTATTAAGGCAATTGTGGCACACCCCTTGCTTTGTCTTTATCAACGCAAATAACAAGTTGATAGGAAACAGACC SEQ ID NO:2 CTCCTATCAGGTTGCGAAACGTGCCGCGAAGAAAGGTGCTAAGTATTACCACATCACCCGCCAGTGGCAGGAACGTGGTAATAACCTGACCGTCAGCGCAGATCTGTATAAATAACTATTCAGTTACTCCTATAAGGCGGCTTGATGCCG CCTTTCGCATTTTTAGTCACAAATTTCCCCGCGACCATTGCATGCAGACACATCTCTTCGTAAAATCCCGCGCTTCAGTGGCAAACTCCATTTTTATGCGTTTTGCCCTAATATTTATTCTTCTTATCACGTTTTAATCACTGGATATCG In a preferred embodiment of the present invention, the glutamine phosphoribosyl pyrophosphate amidotransferase gene of Escherichia coli purF The original promoter P purF Replaced with the growth-dependent promoter P shown in SEQ ID NO: 1 prpB .

[0019] In a preferred embodiment of the present invention, the ATP phosphoribosyltransferase gene of Escherichia coli hisG The original promoter P hisG Replaced with the stationary phase dependent promoter P shown in SEQ ID NO: 2 ydgI .

[0020] In a preferred embodiment of the present invention, the glutamine phosphoribosyl pyrophosphate amidotransferase gene of Escherichia coli purF The original promoter P purF Replaced with the growth-dependent promoter P shown in SEQ ID NO: 1 prpB , and / or ATP phosphoribosyltransferase gene hisG The original promoter P hisG Replaced with the stationary phase dependent promoter P shown in SEQ ID NO: 2 ydgI .

[0021] In a second aspect, the present invention provides use of the Escherichia coli according to the first aspect in producing L-histidine.

[0022] In a third aspect, the present invention provides a method for producing L-histidine, comprising: slant culture and seed culture of the bacterial strain, inoculating the bacterial strain onto a fermentation medium, shaking the culture, and adding glucose containing betaine after the substrate sugar is exhausted; wherein the bacterial strain is the Escherichia coli described in the first aspect.

[0023] In a preferred embodiment of the present invention, the slant culture step comprises: taking a strain stored at -80°C and streaking it onto an activated slant, culturing it at 37°C for 12 hours, and subculturing it once to obtain slant seeds.

[0024] In a preferred embodiment of the present invention, the seed culture step comprises: scraping a ring of the slant seeds with an inoculating loop and inoculating it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, sealing it with nine layers of gauze, and culturing it at 37°C and 200 rpm for 7-10 h to obtain a seed culture solution.

[0025] In a preferred embodiment of the present invention, the shaking culture conditions include: inoculating the seed culture solution into a 500 mL Erlenmeyer flask containing the fermentation medium at an inoculum size of 10% of the volume, sealing with nine layers of gauze, 37°C, 200 r / min, pH 7.0-7.2, a fermentation cycle of 26-30 h, and a dissolved oxygen of 30%-40%.

[0026] In a preferred embodiment of the present invention, the final volume of the fermentation medium after inoculation is 30 mL.

[0027] In a preferred embodiment of the present invention, the mass concentration of betaine in the betaine-containing glucose is 1 g / L, and the mass fraction of the glucose is 60%.

[0028] In a preferred embodiment of the present invention, the mass concentration of glucose in the shaking culture is <5 g / L.

[0029] The present invention will be described in more detail below with reference to examples.

[0030] (1) Methods and equipment used in the examples Unless otherwise specified, the experimental methods and equipment described in the following examples are conventional methods and equipment.

[0031] (2) Culture medium, bacteria and enzymes used in the examples Slant culture medium: glucose 1-5 g / L, peptone 5-10 g / L, beef extract 5-10 g / L, yeast powder 1-5 g / L, NaCl 1-2.5 g / L, agar 15-20 g / L, the rest is water, pH 7.0-7.2.

[0032] Seed culture medium: glucose 20-40 g / L, yeast extract 2-5 g / L, peptone 2-4 g / L, K2HPO4 1-3 g / L, MgSO4·7H2O 1-2 g / L, FeSO4·7H2O 15-20 mg / L, MnSO4·3H2O 15-20 mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L each, the rest is water, pH 7.0-7.2.

[0033] Fermentation medium: glucose 20-40 g / L, yeast extract 1-3 g / L, peptone 2-3 g / L, K2HPO4 3-6 g / L, MgSO4·7H2O 1-2 g / L, FeSO4·7H2O 15-20 mg / L, MnSO4·3H2O 15-20 mg / L, V B1 、V B3 、V B5 、V B12 、V H 1-3 mg / L each, the rest is water, pH 7.0-7.2.

[0034] All recombinant enzymes used are from the ClonExpress ® II One Step Cloning Kit series.

[0035] HS enzyme was purchased from PrimeSTAR Biotechnology.

[0036] (3) Sequence The primer sequences used in the examples are shown in Table 1: Table 1

[0037] (4) Reaction system and reaction conditions Annealing system and reaction conditions are shown in Table 2: Table 2

[0038] The recombinant system and reaction conditions are shown in Table 3: Table 3

[0039] The PCR amplification system is shown in Table 4: Table 4

[0040] The overlapping PCR amplification system is shown in Table 5: Table 5

[0041] Note: The template consists of equimolar amounts of the amplified fragments of the upstream and downstream homology arms and the target gene, and the total amount does not exceed 10 ng.

[0042] The reaction conditions of the PCR amplification system and the overlapping PCR amplification system are shown in Table 6: Table 6

[0043] Note: Tm value is the melting temperature of DNA, and in this invention refers to the melting temperature value of primers and products.

[0044] (5) Gene editing methods The gene editing method used in the present invention is based on the literature (Li Y, Lin Z, Huang C, et al .Metabolic engineering of Escherichia coli using CRISPR-Cas9 meditated genome editing. Metabolic engineering, 2015, 31: 13-21.) The two plasmid maps used in this method are shown in Figure 2-3 Among them, pREDCas9 carries the elimination system of the gRNA expression plasmid pGRB, the Red recombination system of λ phage and the Cas9 protein expression system, spectinomycin resistance (working concentration: 100 mg / L), and is cultured at 32°C; pGRB uses pUC18 as the backbone, including the promoter J23100, the gRNA-Cas9 binding region sequence and the terminator sequence, ampicillin resistance (working concentration: 100 mg / L), and is cultured at 37°C.

[0045] Example 1: This example is used to illustrate the construction of the L-histidine-producing Escherichia coli of the present invention, specifically the construction of the genetically engineered bacterium HCBHIS1.

[0046] 1.1 Gene Editing Operation (1) Construction of the pGRB plasmid: The purpose of constructing the pGRB plasmid is to transcribe the corresponding gRNA, thereby forming a complex with the Cas9 protein and recognizing the target site of the target gene through base pairing and PAM, thereby achieving the target DNA double-strand break. The pGRB plasmid is constructed by recombination of a DNA fragment containing the target sequence with a linearized vector fragment. The specific steps are described in steps a to f below.

[0047] a. Target sequence design: Use CRISPR RGEN Tools to design the target sequence (PAM: 5'-NGG-3'); b. Preparation of DNA fragments containing the target sequence: Design primers: 5'-linearized vector end sequence (15 bp)-restriction site-target sequence (excluding PAM sequence)-linearized vector end sequence (15 bp)-3' and its reverse complementary primer. Prepare DNA fragments containing the target sequence by annealing single-stranded DNA; c. Preparation of linear vector: The vector is linearized by inverse PCR amplification; d. Recombination reaction; e. Plasmid transformation: Add 10 μL of the reaction solution to 100 mL of DH5α competent cells. Mix gently, then incubate on ice for 20 minutes. Heat shock at 42°C for 45-90 seconds, then immediately incubate on ice for 2-3 minutes. Add 900 μL of SOC and resuspend the cells at 37°C for 1 hour. Centrifuge at 8000 rpm for 2 minutes, discard the supernatant, and resuspend the cells in approximately 200 μL of the supernatant. Spread the cells onto a plate containing 100 mg / L ampicillin, invert the plate, and incubate at 37°C overnight. Once a single colony grows on the plate, identify the positive recombinants by colony PCR. f. Clone identification: Inoculate PCR-positive colonies into LB medium containing 100 mg / L ampicillin and culture overnight. Incubate the colonies and extract the plasmids for identification by enzyme digestion.

[0048] (2) Preparation of recombinant DNA fragments: For example, the recombinant fragment used for promoter replacement is prepared by ydgI and hisG The upstream and downstream homology arms of the gene are composed of upstream homology arms and downstream homology arms. ydgI and hisG Using the upstream and downstream sequences of the gene as templates, design upstream and downstream homology primers (amplification length approximately 400-500 bp). PCR is then used to amplify the upstream and downstream homology arms and the target gene fragment, respectively. Overlap PCR is then used to generate recombinant fragments. The PCR system and methods are shown in Tables 4-6.

[0049] (3) Transformation of plasmids and recombinant DNA fragments a. Transformation with pREDCas9: Use electroporation to transfer the pREDCas9 plasmid into the electroporation-competent cell of the starting strain. After resuscitation, plate the cells onto LB plates containing spectinomycin and incubate at 32°C overnight. Single colonies growing on the resistant plates are screened for positive recombinants using colony PCR using identification primers. b. Preparation of electroporation competent strain containing pREDCas9: Culture at 32°C until OD 600=0.1~0.2, add 0.1 M IPTG (to make the final concentration 0.1 mM) and continue to culture until OD 600 =0.6-0.7 for competent cell preparation. The purpose of adding IPTG is to induce the expression of the recombinase on the pREDCas9 plasmid. The culture medium and preparation process required for competent cell preparation refer to conventional standard operations; c. Transformation of pGRB and recombinant DNA fragments: Simultaneously electroporate pGRB and the donor DNA fragment into electrocompetent cells containing pREDCas9. Recovered cells from electroporate are plated onto LB plates containing ampicillin and spectinomycin and incubated overnight at 32°C. Colony PCR is performed using specially designed identification primers to screen for positive recombinants and maintain the cells. (4) Elimination of plasmids a. Elimination of pGRB: Culture positive recombinants overnight in LB medium containing 0.2% arabinose. Dilute appropriately and spread onto LB plates containing spectinomycin resistance. Incubate overnight at 32°C. Spot the LB plates containing ampicillin and spectinomycin resistance. Select single colonies that do not grow on the ampicillin plate but grow on the spectinomycin resistance plate.

[0050] b. Elimination of the pREDCas9 plasmid: Transfect positive recombinants into non-resistance LB liquid medium, culture overnight at 42°C, dilute appropriately, and plate onto non-resistance LB plates, culture overnight at 37°C. For each LB plate containing spectinomycin resistance and non-resistance, select single colonies that do not grow on the spectinomycin-resistant plate but grow on the non-resistance plate.

[0051] 1.2 Construction of genetically engineered strain HCBHIS1 Wild-type strain Escherichia coli MG1655 is used as a template. purF The upstream homology arm primers were designed based on the upstream and downstream sequences of the gene (NCBI GeneID:946794). purF -UPS, purF-prpB- UP - A) and downstream homology arm primers ( prpB - purF -DN-S, purF -DN-A), where the upstream and downstream homology arms contain prpB The promoter sequence was obtained by PCR amplification of its upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P purF ::P prpB Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB- purF :The DNA fragment containing the target sequence is used through the primer gRNA- purF-S and gRNA- purF -A was obtained by annealing.

[0052] Further, according to E.coli MG1655 genome hisG The upstream homology arm primers were designed based on the upstream and downstream sequences of the gene (NCBI GeneID: 946549) hisG -UPS, hisG-ydgI- UP-A)、 ydgI Promoter primers ( [[ID= -S, ​ -A) and downstream homology arm primers ( ​ - ​ -DN-S, ​ -DN-A), where the upstream and downstream homology arms contain ​ The promoter sequence was obtained by PCR amplification of its upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P hisG ::P ydgI Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB- ​ :The DNA fragment containing the target sequence is used through the primer gRNA- ​ -S and gRNA- ​ -A was obtained by annealing.

[0053] Preparation of wild-type strains ​ MG1655 competent cells were constructed according to the method shown in steps (3) and (4) of 1.1 above, and the P purF ::P prpB and P hisG ::P ydgI Genetically engineered bacteria HCBHIS1 with regulated gene expression. Positive transformants were verified by PCR.

[0054] Example 2: This example is used to illustrate the construction of the L-histidine-producing Escherichia coli of the present invention, specifically the construction of the genetically engineered bacterium HCBHIS5.

[0055] Wild-type strain ​ W3110 was used as a template, and upstream homology arm primers were designed according to the upstream and downstream sequences of the nucleotide sequence corresponding to the PurF protease (NCBI-ProteinID: BAA16158) ​ -UPS, ​ UP - A) and downstream homology arm primers ( ​ - ​ -DN-S, ​-DN-A), where the upstream and downstream homology arms contain ​ The promoter sequence was obtained by PCR amplification of its upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P purF ::P prpB Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB- ​ :The DNA fragment containing the target sequence is used through the primer gRNA- ​ -S and gRNA- ​ -A was obtained by annealing.

[0056] Further, according to ​ Upstream homology arm primers were designed based on the upstream and downstream sequences of the nucleotide sequence corresponding to HisG protease (NCBI-ProteinID: BAA15850) in the MG1655 genome ( ​ -UPS, ​ UP-A)、 ​ Promoter primers ( ​ -S, ​ -A) and downstream homology arm primers ( ​ - ​ -DN-S, ​ -DN-A), where the upstream and downstream homology arms contain ​ The promoter sequence was obtained by PCR amplification of its upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P hisG ::P ydgI Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB- ​ :The DNA fragment containing the target sequence is used through the primer gRNA- ​ -S and gRNA- ​ -A was obtained by annealing.

[0057] Preparation of wild-type strains ​ The competent cells of W3110 were operated according to the method shown in steps (3) and (4) of 1.1 of Example 1, and the competent cells with P purF ::P prpB and P hisG ::P ydgI Genetically engineered strain HCBHIS5 with regulated gene expression. Positive transformants were verified by PCR.

[0058] Example 3: This example is used to illustrate the construction of the L-histidine-producing Escherichia coli of the present invention, specifically the construction of the genetically engineered bacteria HCBHIS7 or HCBHIS8.

[0059] Wild type​ MG1655 genome was used as a template. ​ The upstream homology arm primers were designed based on the upstream and downstream sequences of the gene (NCBI-GeneID: 2847696) ​ -UPS, ​ -UP-A) and downstream homology arm primers ( ​ -DN-S, ​ -DNA-A) and PCR amplify its upstream and downstream homology arm fragments. ​ Gene (NCBIGeneID: 946549) sequence design amplification primers ( ​ -trc-S, ​ -trc-A), PCR amplification of P trc - ​ The target gene was obtained by fusion of the above fragments through overlapping PCR ​ ::P trc - ​ Recombinant fragment (upstream homology arm-target gene-downstream homology arm). Construct pGRB- ​ :The DNA fragment containing the target sequence is used through the primer gRNA- ​ -S and gRNA- ​ -A was obtained by annealing.

[0060] The recombinant fragment ​ ::P trc - ​ and plasmid pGRB- ​ Electroporation into wild-type strain ​ ​ Competent cells of MG1655 were used to screen for positive strains and then eliminate the plasmid to obtain the genetically engineered strain HCBHIS7. Positive transformants were verified by PCR.

[0061] Furthermore, the wild-type strain ​ MG1655 is used as a template. ​ The upstream homology arm primers were designed based on the upstream and downstream sequences of the gene (NCBIGeneID: 946794) ​ -UPS, ​ UP - A) and downstream homology arm primers ( ​ - ​ -DN-S, ​ -DN-A), where the upstream and downstream homology arms contain ​ The promoter sequence was obtained by PCR amplification of its upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P purF ::P prpBPromoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB- ​ :The DNA fragment containing the target sequence is used through the primer gRNA- ​ -S and gRNA- ​ -A was obtained by annealing.

[0062] Further, according to ​ MG1655 genome ​ The upstream homology arm primers were designed based on the upstream and downstream sequences of the gene (NCBI GeneID: 946549) ​ -UPS, ​ UP-A)、 ​ Promoter primers ( ​ -S, ​ -A) and downstream homology arm primers ( ​ - ​ -DN-S, ​ -DN-A), where the upstream and downstream homology arms contain ​ The promoter sequence was obtained by PCR amplification of its upstream and downstream homology arm fragments. The above fragments were fused by overlapping PCR to obtain P hisG ::P ydgI Promoter replacement fragment (upstream homology arm-downstream homology arm). Construction of pGRB- ​ :The DNA fragment containing the target sequence is used through the primer gRNA- ​ -S and gRNA- ​ -A was obtained by annealing.

[0063] Prepare competent cells of the genetically engineered strain HCBHIS7, and operate according to the method shown in steps (3) and (4) of 1.1 of Example 1, and iteratively construct the P purF ::P prpB and P hisG ::P ydgI Genetically engineered strain HCBHIS8 with regulated gene expression. Positive transformants were verified by PCR.

[0064] The sources and descriptions of the genetically engineered bacteria constructed in Examples 1-3 are summarized in Table 7: Table 7

[0065] Example 4 This embodiment is used to illustrate the use of P purF ::P prpB and P hisG ::P ydgI A method for producing L-histidine by fermentation using engineered bacteria with regulated gene expression.

[0066] (1) Slant culture: Take the -80℃ stored strain and streak it onto the activated slant, culture it at 37℃ for 12 h, and subculture it once; (2) Shake flask seed culture: scrape a ring of slant seeds with an inoculating loop and inoculate it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, seal it with nine layers of gauze, and culture it at 37°C and 200 rpm for 7-10 h. (3) Shake flask fermentation: 10% of the volume of the seed culture was inoculated into a 500 mL Erlenmeyer flask containing fermentation medium (final volume 30 mL), sealed with nine layers of gauze, and cultured at 37°C and 200 r / min with shaking. During the fermentation process, ammonia water was added to maintain the pH at 7.0-7.2; 60% (m / v) glucose solution was added to maintain the fermentation process; the fermentation cycle was 26-30 h; during the fermentation process, ammonia water was used to adjust the pH to 6.8-7.2, and the DO was controlled at 30%-40%. After the base sugar was exhausted, 60% glucose containing 1 g / L betaine was added. The glucose concentration was controlled below 5 g / L during the entire fermentation process.

[0067] Example 5: This example is used to illustrate the use of genetically engineered bacteria HCBHIS1 and its starting strain ​ ​ Differences in the performance of MG1655 in producing L-histidine.

[0068] The method in Example 4 was used to treat HCBHIS1 and ​ MG1655 was cultured in shake flasks and the concentration of L-histidine in the fermentation supernatant was determined. The results are shown in Table 8.

[0069] Table 8

[0070] From the data in Table 8, we can see that after promoter modification, P purF ::P prpB and P hisG ::P ydgI The concentration of L-histidine in the genetically engineered strain HCBHIS1 was increased from 0.05 g / L to 0.14 g / L, which was 1.8 times higher than that of the starting strain. prpB Regulation ​ Gene expression and P ydgI Regulation ​ Gene expression, by adding betaine to trigger dynamic regulation of fermentation production of L-histidine, significantly improved the L-histidine production performance of genetically engineered bacteria.

[0071] Example 6: This example is used to illustrate the use of genetically engineered bacteria HCBHIS5 and its starting strain ​ ​ Differences in the performance of W3110 in producing L-histidine.

[0072] The method in Example 4 was used to treat HCBHIS5 and ​ W3110 was fermented in shake flasks. The concentration of L-histidine in the fermentation supernatant was determined. The results are shown in Table 9.

[0073] Table 9

[0074] From the data in Table 9, we can see that the promoter modified P purF ::P prpB and P hisG ::P ydgI The concentration of L-histidine in the genetically engineered strain HCBHIS5 was increased from 0.04 g / L to 0.12 g / L, which was 2 times higher than that of the starting strain. prpB Regulation ​ Gene expression and P ydgI Regulation ​ Gene expression, by adding betaine to trigger dynamic regulation of fermentation production of L-histidine, significantly improved the L-histidine production performance of genetically engineered bacteria.

[0075] Example 7: This example is used to illustrate the performance differences in producing L-histidine using the genetically engineered strain HCBHIS8 and its starting strain HCBHIS7.

[0076] HCBHIS8 and HCBHIS7 were cultured in shake flasks using the culture method described in Example 4. The L-histidine concentration in the fermentation supernatant was determined, and the results are shown in Table 10.

[0077] Table 10

[0078] From the data in Table 10, we can see that the promoter modification P purF ::P prpB and P hisG ::P ydgI The growth of the engineered strain was not significantly affected; at the same time, the L-histidine concentration in HCBHIS8 increased from 1.26 g / L to 1.52 g / L, and the L-histidine production increased by 20.6%. prpB Regulation ​ Gene expression and PydgI Regulation ​ Gene expression, by adding betaine to trigger dynamic regulation of fermentation production of L-histidine, significantly improved the L-histidine production performance of genetically engineered bacteria.

[0079] The preferred embodiments of the present invention are described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the technical concept of the present invention, various simple modifications can be made to the technical solution of the present invention, and these simple modifications all fall within the scope of protection of the present invention.

[0080] It should also be noted that the various specific technical features described in the above specific embodiments can be combined in any appropriate manner without contradiction. In order to avoid unnecessary repetition, the present invention will not further describe various possible combinations.

[0081] In addition, the various embodiments of the present invention may be arbitrarily combined, and as long as they do not violate the concept of the present invention, they should also be regarded as the contents disclosed by the present invention.

Claims

1. An Escherichia coli for producing L-histidine, characterized in that The Escherichia coli contains a growth-dependent promoter P as shown in the base sequence of SEQ ID NO:

1. ydgI and / or a stationary phase dependent promoter P as shown in SEQ ID NO: 2 ydgI .

2. The Escherichia coli according to claim 1, characterized in that The glutamine phosphoribosyl pyrophosphate amidotransferase gene of Escherichia coli purF The original promoter P purF Replaced with the growth-dependent promoter P shown in SEQ ID NO: 1 prpB ; and / or the ATP phosphoribosyltransferase gene of the Escherichia coli hisG The original promoter P hisG Replaced with the stationary phase dependent promoter P shown in SEQ ID NO: 2 ydgI .

3. Use of the Escherichia coli according to claim 1 or 2 in producing L-histidine.

4. A method for producing L-histidine, characterized in that: The method comprises: slant culture and seed culture of the bacterial strain, inoculating the bacterial strain onto a fermentation medium, shaking the culture, and adding glucose containing betaine after the base sugar is exhausted; wherein the bacterial strain is the Escherichia coli according to claim 1 or 2.

5. The method according to claim 4, characterized in that The slant culture step includes: taking a strain preserved at -80°C and streaking it onto an activated slant, culturing it at 37°C for 12 hours, and subculturing it once to obtain slant seeds.

6. The method according to claim 5, characterized in that The seed culture step includes: scraping a ring of the slant seeds with an inoculating loop and inoculating it into a 500 mL Erlenmeyer flask containing 30 mL of seed culture medium, sealing it with nine layers of gauze, and culturing it at 37° C. and 200 rpm for 7-10 hours to obtain a seed culture solution.

7. The method according to claim 6, characterized in that The shaking culture conditions include: inoculating a 500 mL Erlenmeyer flask containing fermentation medium at an inoculum volume of 10% of the volume of the seed culture solution, sealing the flask with nine layers of gauze, 37°C, 200 rpm, pH 7.0-7.2, a fermentation cycle of 26-30 hours, and a dissolved oxygen content of 30%-40%.

8. The method according to claim 7, characterized in that The final volume of the fermentation medium after inoculation was 30 mL.

9. The method according to any one of claims 4 to 8, characterized in that The mass concentration of betaine in the betaine-containing glucose is 1 g / L, and the mass fraction of the glucose is 60%.

10. The method according to any one of claims 4 to 9, characterized in that The mass concentration of glucose in the shaking culture is less than 5 g / L.

Images