Escherichia coli for synthesizing heme and heme derivative by using glycerol and acetic acid as raw materials

Abstract

The invention provides recombinant escherichia coli for synthesizing heme and derivatives thereof. The recombinant escherichia coli is subjected to genetic engineering modification: genes such as pyruvate oxidase (poxB) and the like are knocked out; meanwhile, the expression of genes such as glycerol 3-phosphate dehydrogenase (glpD) and acetyl coenzyme A synthetase (acs) is enhanced; and genes such as exogenous ferrous chelating enzyme (hemH) and the like are introduced. The modified strain can be used for efficiently synthesizing the heme and the derivatives thereof by taking glycerol, acetic acid and the like as raw materials at the same time, and has a wide industrial application prospect in the field of biological manufacturing.

Description

Technical Field

[0001] The present invention relates to the fields of gene editing, gene recombination-edited microbial strains, synthetic biology, and microbial biosynthesis technology, and in particular to a recombinant Escherichia coli strain for synthesizing heme derivatives and a preparation method thereof. Background Art

[0002] Heme is a key food ingredient. As a key color and flavor component in cultured meat, heme plays a central role in simulating the "meaty" aroma and rosy appearance of traditional meat, while also enhancing its overall taste and texture. By binding to plant proteins, heme significantly enhances the sensory authenticity of cultured meat products. Heme is metabolized in the body to produce a series of high-value derivatives, of which bilirubin is particularly important. Bilirubin is not only the primary pigment in bile and a crucial antioxidant in the body, but also a key pharmaceutical ingredient for treating conditions such as neonatal jaundice, creating significant demand in the pharmaceutical and diagnostic fields. Currently, the production of heme and its derivatives (such as bilirubin) primarily relies on chemical synthesis or extraction from animal and plant tissues (such as animal blood). These methods are generally plagued by complex processes, low product purity, numerous byproducts, and significant environmental pollution. High-value derivatives like bilirubin are particularly rare in nature, making traditional extraction methods extremely costly and limited by the availability of raw materials (such as animal bile). Consequently, production falls far short of meeting rapidly growing market demand.

[0003] Glycerol is a byproduct of the biodiesel industry, readily available and inexpensive. Acetic acid can be obtained in large quantities through various fermentation or chemical processes. Both are significantly cheaper than traditional sugar feedstocks. Glycerol molecules are highly reduced, and their metabolic pathways generate abundant reducing power (NADH / NADPH), which is crucial for the synthesis of reduced products such as heme and bilirubin, effectively improving carbon flow conversion efficiency. Acetate, on the other hand, is the direct precursor of acetyl-coenzyme A (Acetyl-CoA), a central molecule in cellular metabolism. Acetyl-CoA is not only a crucial precursor of 5-aminolevulinic acid (ALA), the starting molecule for heme synthesis, but also a hub in cellular energy metabolism and the tricarboxylic acid (TCA) cycle, providing sufficient energy and carbon backbone for biosynthesis. Therefore, developing heme biosynthesis routes using glycerol and acetate as mixed or sole carbon sources has the potential to overcome bottlenecks in the production of heme and its derivatives, and holds significant significance for supporting the development of industries such as artificial meat and meeting the needs of the pharmaceutical sector. Summary of the Invention

[0004] The present invention aims to solve the following technical problem: how to metabolically engineer Escherichia coli to efficiently synthesize heme and its derivatives using glycerol and acetic acid as precursors. Specifically, the present invention addresses key issues in existing technologies, such as high raw material costs, insufficient precursor supply, and low synthesis efficiency.

[0005] In order to solve the above technical problems, in a first aspect, the present invention provides a recombinant Escherichia coli, which is a recombinant bacterium obtained by carrying out the following transformations (1) to (27) in Escherichia coli;

[0006] (1) Knockout of the gene encoding pyruvate oxidase (poxB);

[0007] (2) knockout of the gene encoding pyruvate formate lyase (pflB);

[0008] (3) Knockout of the gene encoding malate synthase (aceB);

[0009] (4) Knockout of the gene encoding porphyrinogen peroxidase (yfeX);

[0010] (5) Enhance the expression of phosphoenolpyruvate carboxylase gene (ppc);

[0011] (6) Enhance the expression of the glycerol transporter gene (glpF);

[0012] (7) Enhance the expression of glycerol-3-phosphate dehydrogenase gene (glpD);

[0013] (8) Enhance the expression of acetyl-CoA synthetase gene (acs);

[0014] (9) Enhance the expression of acetate kinase gene (ackA);

[0015] (10) Enhance the expression of isocitrate lyase gene (aceA);

[0016] (11) Enhance the expression of porphobilinogen synthase gene (hemB);

[0017] (12) Enhance the expression of hydroxymethylcholine synthase gene (hemC);

[0018] (13) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE)

[0019] (14) Enhance the expression of coproporphyrinogen oxidase gene (hemF);

[0020] (15) Enhance the expression of protoporphyrinogen oxidase gene (hemG);

[0021] (16) Introduction of glycine dehydrogenase (GYDH);

[0022] (17) Introduction of the 5-aminolevulinic acid synthase gene (hemA);

[0023] (18) Introducing the ferrochelatase gene (hemH).

[0024] The modifications of (3) and (10) above can be specifically as follows: replacing the coding region of the malate synthase gene (aceB) and the upstream region of the isocitrate lyase gene (aceA) with the P119 promoter;

[0025] The modifications of (5)-(9) and (11)-(15) mentioned above can be specifically as follows: replacing the promoters of the phosphoenolpyruvate carboxylase gene (ppc), glycerol transporter gene (glpF), 3-phosphoglycerate dehydrogenase gene (glpD), acetyl-CoA synthetase gene (acs), acetate kinase gene (ackA), porphobilinogen synthase gene (hemB), hydroxymethylbilinogen synthase gene (hemC), uroporphyrinogen decarboxylase gene (hemE), coproporphyrinogen oxidase gene (hemF), and protoporphyrinogen oxidase gene (hemG) with the P119 promoter.

[0026] The modifications of (16) and (17) above can be specifically as follows: introduction in the form of pS-GH plasmid.

[0027] The modification of (18) mentioned above can be specifically as follows: introduction in the form of pY-H plasmid.

[0028] Furthermore, the glycine dehydrogenase (GYDH) may be derived from Mycobacterium tuberculosis.

[0029] Furthermore, the 5-aminolevulinic acid synthase gene (hemA) may be derived from Cereibacter sphaeroides.

[0030] Furthermore, the ferrochelatase gene (hemH) may be derived from Pantoea ananatis.

[0031] In a second aspect, the present invention provides a recombinant Escherichia coli, wherein the transformations (1) to (18) and the following transformations are performed in the Escherichia coli:

[0032] (19) Strengthen the cytochrome c maturation protein A gene (ccmA).

[0033] The modification of the above (19) can be specifically as follows: replacing the promoter of the cytochrome c maturation protein A gene (ccmA) with the P119 promoter.

[0034] In a third aspect, the present invention provides a recombinant Escherichia coli, wherein the transformations (1) to (18) and the following transformations are performed in the Escherichia coli:

[0035] (20) Introduction of the heme oxygenase gene (ho1);

[0036] (21) Introduce the biliverdin reductase gene (bvr).

[0037] The modifications of (18), (20), and (21) mentioned above can be specifically: introduced in the form of pY-HHB plasmid.

[0038] Furthermore, the heme oxygenase gene (ho1) may be derived from Prochlorococcus marinus.

[0039] Furthermore, the biliverdin reductase gene (bvr) may be derived from Mycobacterium paraintracellulare.

[0040] In a fourth aspect, the present invention provides a method for constructing a recombinant Escherichia coli with improved hemoglobin production, comprising the following steps: performing the transformation according to the transformation methods (1)-(18) in the first aspect and (19) in the second aspect.

[0041] In a fifth aspect, the present invention provides a method for constructing a recombinant Escherichia coli with improved bilirubin production, comprising the following steps: performing the transformation according to the transformation methods (1)-(18) in the first aspect and (20) and (21) in the third aspect.

[0042] In a sixth aspect, the present invention provides a method for producing or increasing hemoglobin production, comprising the following steps: culturing the recombinant Escherichia coli described in the second aspect with glycerol as a carbon source, collecting the bacteria, and obtaining hemoglobin; and a method for producing or increasing bilirubin production, comprising the following steps: culturing the recombinant Escherichia coli described in the third aspect with glycerol and acetic acid as carbon sources, collecting the bacteria, and obtaining bilirubin.

[0043] In a seventh aspect, the present invention provides use of the recombinant Escherichia coli described in the second aspect in producing or increasing heme production; and use of the recombinant Escherichia coli described in the third aspect in producing or increasing bilirubin production.

[0044] In an eighth aspect, the present invention provides a product for producing or increasing hemoglobin production, the active ingredient of which is the recombinant Escherichia coli described in the second aspect; and a product for producing or increasing bilirubin production, the active ingredient of which is the recombinant Escherichia coli described in the third aspect.

[0045] The above-mentioned product may be a bacterial agent containing the recombinant bacteria and / or a culture of the recombinant bacteria.

[0046] The term "culture" refers to any liquid or solid product (i.e., fermentation product) containing a microbial population after artificial inoculation and cultivation. This refers to a product obtained by growing and / or amplifying microorganisms. It can be a biologically pure culture of the microorganism or contain a certain amount of culture medium, metabolites, or other components produced during the cultivation process.

[0047] In a specific embodiment of the present invention, the glycerol medium composition and final concentrations are as follows: Na2HPO4: 25 mM, KH2PO4: 25 mM, NH4Cl: 50 mM, Na2SO4: 5 mM, MgSO4: 2 mM, glycerol: 1.5% (g / 100 mL), sodium acetate: 1.5% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol and sodium acetate may be added to a final concentration of 1% (g / 100 mL).

[0048] In a specific embodiment of the present invention, the starting Escherichia coli can be Escherichia coli MG1655, Escherichia coli BW25113, or Escherichia coli MC02.

[0049] In the present invention, the nucleotide sequence of the P119 promoter is SEQ ID No.3.

[0050] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate oxidase (poxB) is CAD6018048.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate oxidase (poxB) is Gene ID: 946132 (2025.6.25).

[0051] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the pyruvate formate lyase (pflB) is NP_415423.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the pyruvate formate lyase (pflB) is Gene ID: 945514 (2025.6.25).

[0052] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the porphyrinogen peroxidase (yfeX) is NP_416926.4, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the porphyrinogen peroxidase (yfeX) is Gene ID: 946913 (2023.4.14).

[0053] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the phosphoenolpyruvate carboxylase (ppc) is NP_418391.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948457 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4153099-4153200(-)).

[0054] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol transporter (glpF) is NP_418362.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 948422 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4118091-4118280(-)).

[0055] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycerol-3-phosphate dehydrogenase (glpD) is NP_417884.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947934 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (3561941-3562012(+)).

[0056] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the porphobilinogen synthase (hemB) is NP_414903.4, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 945017 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (389728- 389777 (-)).

[0057] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the hydroxymethylcholine synthase (hemC) is YP_026260.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 947759 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (3990767-3990773 (-)).

[0058] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the uroporphyrinogen decarboxylase (hemE) is NP_418425.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948497 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (4197691- 4197715 (+)).

[0059] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the coproporphyrinogen oxidase (hemF) is NP_416931.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946908 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (2553222- 2553224 (+)).

[0060] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the protoporphyrinogen oxidase (hemG) is NP_418292.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948331 (2023.4.14), and the replaced promoter sequence is NC_000913.3 (4034605-4034607(+)).

[0061] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the cytochrome c mature protein A gene (ccmA) is NP_416705.2, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946714 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (2297645-2297656 (-)).

[0062] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the glycine dehydrogenase (GYDH) is NP_217296.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the glycine dehydrogenase (GYDH) is Gene ID: 888493 (2017.12.14).

[0063] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the 5-aminolevulinic acid synthase (hemA) is WP_011337894.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 3720398 (2024.12.19).

[0064] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the ferrochelatase (hemH) is WP_014605551.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 57267780 (2023.9.29).

[0065] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the heme oxygenase (ho1) is WP_011821074.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding it is Gene ID: 60201361 (2023.4.10).

[0066] In the present invention, the NCBI reference sequence number (NCBI Reference Sequence) of the biliverdin reductase (bvr) is WP_008256343.1, and the NCBI reference sequence number (NCBI Reference Sequence) of its encoding gene is AP022584.1 (708882-709289 (-)) (2020.2.6).

[0067] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the acetyl-CoA synthetase (acs) is NP_418493.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948572 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (4287372-4287500(-)).

[0068] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the acetate kinase (ackA) is NP_416799.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 946775 (2025.6.25), and the replaced promoter sequence is NC_000913.3 (2413391-2413469 (+)).

[0069] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the malate synthase (aceB) is NP_418438.1, and the NCBI Reference Sequence Number (NCBI Reference Sequence) of the gene encoding the malate synthase (aceB) is Gene ID: 948512 (2025.6.25).

[0070] In the present invention, the NCBI Reference Sequence Number (NCBI Reference Sequence) of the isocitrate lyase (aceA) is NP_418439.1, the NCBI Reference Sequence Number (NCBI Reference Sequence) of its encoding gene is Gene ID: 948517 (2025.6.25), and the replaced upstream sequence is NC_000913.3 (4215478-4217108 (+)).

[0071] The beneficial technical effects achieved by the present invention are as follows:

[0072] The present invention provides a recombinant Escherichia coli that can synthesize heme and its derivatives at a high level using glycerol and acetic acid as raw materials, thereby providing a new technical route for synthesizing heme and its derivatives, which can be used for the mass production of heme and its derivatives. BRIEF DESCRIPTION OF THE DRAWINGS

[0073] In order to more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the specific embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0074] Figure 1 HPLC peak profile of bilirubin (sample). DETAILED DESCRIPTION

[0075] The present disclosure is further described in detail below in conjunction with specific embodiments. The examples provided are intended only to illustrate the present disclosure and are not intended to limit the scope of the present disclosure. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0076] The liquid LB medium (pH 7.0) in the following examples contained 1 g / 100 mL NaCl, 1 g / 100 mL tryptone, 0.5 g / 100 mL yeast extract, and the balance was water. Solid culture medium is obtained by adding agarose to liquid culture medium.

[0077] The starting E. coli in the following examples can specifically be one of E. coli MG1655, BW25113, and MC02. E. coli MG1655 (CGSC#: 6300), BW25113 (CGSC#: 76376), and plasmid pKD46 (CGSC#: 7739) are products of the Yale University E. coli Genetic Collection (CGSC). E. coli MC02 is deposited with the China General Microorganism Culture Collection (CGMCC) (CGMCC No. 34378). The sequence information of the pSB1s and pYB1k plasmids is disclosed in Patent CN119799606A. pKD46 plasmid: Contains the temperature-sensitive replication origin oriR101, which can replicate normally when cultured at 30°C and will automatically be lost when cultured above 37°C; Escherichia coli carrying the pKD46 plasmid is cultured at 30°C, and Gam, Exo, and Beta are efficiently expressed after induction with arabinose. Once the exogenous dsDNA is electroporated into the cells, homologous recombination with the genomic target sequence can occur; it carries an ampicillin resistance gene as a selection marker. The gene sequence of the pSCre plasmid is shown in SEQ ID NO.9, and the public can obtain it through gene synthesis: Escherichia coli carrying the pSCre plasmid can express the recombinase (Cre) gene when cultured at 30°C, causing the lox66 sequence and lox71 sequence on the chromosome to recombine, thereby eliminating the DNA sequence located between the lox66 sequence and lox71 sequence. In this patent, the kanamycin resistance gene located between the lox66 sequence and lox71 sequence in the sequence of SEQ ID NO.1 can be eliminated; Escherichia coli carrying the pSCre plasmid will automatically lose the pSCre plasmid when cultured at 42°C; and the streptomycin resistance gene is carried as a selection marker.

[0078] Table 1. List of sequence fragments

[0079] Serial number Fragment name Sequence (5'-3') SEQIDNO.1 pSCre aatgtgcctgtcaaatggacgaagcagggattctgcaaaccctatgctactccgtcaagccgtcaattgtctgattcgttaccaattatgacaacttgacggctacatcattcactttttcttcacaaccggcacggaactcgctcgggctggccccggtgcattttttaaatacccgcgagaaatagagttgatcgtcaaaaccaacattgcgaccgacggtggcgataggcatccgggtggtgctcaaaagcagcttcgcctggctgatacgttggtcctcgcgccagcttaagacgctaatccctaactgctggcggaaaagatgtgacagacgcgacggcgacaagcaaacatgctgtgcgacgctggcgatatcaaaattgctgtctgccaggtgatcgctgatgtactgacaagcctcgcgtacccgattatccatcggtggatggagcgactcgttaatcgcttccatgcgccgcagtaacaattgctcaagcagatttatcgccagcagctccgaatagcgcccttccccttgcccggcgttaatgatttgcccaaacaggtcgctgaaatgcggctggtgcgcttcatccgggcgaaagaaccccgtattggcaaatattgacggccagttaagccattcatgccagtaggcgcgcggacgaaagtaaacccactggtgataccattcgcgagcctccggatgacgaccgtagtgatgaatctctcctggcgggaacagcaaaatatcacccggtcggcaaacaaattctcgtccctgatttttcaccaccccctgaccgcgaatggtgagattgagaatataacctttcattcccagcggtcggtcgataaaaaaatcgagataaccgttggcctcaatcggcgttaaacccgccaccagatgggcattaaacgagtatcccggcagcaggggatcattttgcgcttcagccatacttttcatactcccgccattcagagaagaaaccaattgtccatattgcatcagacattgccgtcactgcgtcttttactggctcttctcgctaaccaaaccggtaaccccgcttattaaaagcattctgtaacaaagcgggaccaaagccatgacaaaaacgcgtaacaaaagtgtctataatcacggcagaaaagtccacattgattatttgcacggcgtcacactttgctatgccatagcatttttatccataagattagcggatcctacctgacgctttttatcgcaactctctactgtttctccatacccgttttttgggctaacaggaggaattaaccatgggatccaatttactgaccgtacaccaaaatttgcctgcattaccggtcgatgcaacgagtgatgaggttcgcaagaacctgatggacatgttcagggatcgccaggcgttttctgagcatacctggaaaatgcttctgtccgtttgccggtcgtgggcggcatggtgcaagttgaataaccggaaatggtttcccgcagaacctgaagatgttcgcgattatcttctatatcttcaggcgcgcggtctggcagtaaaaactatccagcaacatttgggccagctaaacatgcttcatcgtcggtccgggctgccacgaccaagtgacagcaatgctgtttcactggttatgcggcggatccgaaaagaaaacgttgatgccggtgaacgtgcaaaacaggctctagcgttcgaacgcactgatttcgaccaggttcgttcactcatggaaaatagcgatcgctgccaggatatacgtaatctggcatttctggggattgcttataacaccctgttacgtatagccgaaattgccaggatcagggttaaagatatctcacgtactgacggtgggagaatgttaatccatattggcagaacgaaaacgctggttagcaccgcaggtgtagagaaggcacttagcctgggggtaactaaactggtcgagcgatggatttccgtctctggtgtagctgatgatccgaataactacctgttttgccgggtcagaaaaaatggtgttgccgcgccatctgccaccagccagctatcaactcgcgccctggaagggatttttgaagcaactcatcgattgatttacggcgctaaggatgactctggtcagagatacctggcctggtctggacacagtgcccgtgtcggagccgcgcgagatatggcccgcgctggagtttcaataccggagatcatgcaagctggtggctggaccaatgtaaatattgtcatgaactatatccgtaccctggatagtgaaacaggggcaatggtgcgcctgctggaagatggcgattagctcgagggtagatctggtactagtggtgaattcggtgagctcggtctgcagctggtgccgcgcggcagccaccaccaccaccaccactaatacagattaaatcagaacgcagaagcggtctgataaaacagaatttgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgtcgaccagacccgccataaaacgccctgagaagcccgtgacgggcttttcttgtattatgggtagtttccttgcatgaatccataaaaggcgcctgtagtgccatttacccccattcactgccagagccgtgagcgcagcgaactgaatgtcacgaaaaagacagcgactcaggtgcctgatggtcggagacaaaaggaatattcagcgatttgcccgagcttgcgagggtgctacttaagcctttagggttttaaggtctgttttgtagaggagcaaacagcgtttgcgacatccttttgtaatactgcggaactgactaaagtagtgagttatacacagggctgggatctattctttttatctttttttattctttctttattctataaattataaccacttgaatataaacaaaaaaaacacacaaaggtctagcggaatttacagagggtctagcagaatttacaagttttccagcaaaggtctagcagaatttacagatacccacaactcaaaggaaaaggactagtaattatcattgactagcccatctcaattggtatagtgattaaaatcacctagaccaattgagatgtatgtctgaattagttgttttcaaagcaaatgaactagcgattagtcgctatgacttaacggagcatgaaaccaagctaattttatgctgtgtggcactactcaaccccacgattgaaaaccctacaaggaaagaacggacggtatcgttcacttataaccaatacgttcagatgatgaacatcagtagggaaaatgcttatggtgtattagctaaagcaaccagagagctgatgacgagaactgtggaaatcaggaatcctttggttaaaggctttgagattttccagtggacaaactatgccaagttctcaagcgaaaaattagaattagtttttagtgaagagatattgccttatcttttccagttaaaaaaattcataaaatataatctggaacatgttaagtcttttgaaaacaaatactctatgaggatttatgagtggttattaaaagaactaacacaaaagaaaactcacaaggcaaatatagagattagccttgatgaatttaagttcatgttaatgcttgaaaataactaccatgagtttaaaaggcttaaccaatgggttttgaaaccaataagtaaagatttaaacacttacagcaatatgaaattggtggttgataagcgaggccgcccgactgatacgttgattttccaagttgaactagatagacaaatggatctcgtaaccgaacttgagaacaaccagataaaaatgaatggtgacaaaataccaacaaccattacatcagattcctacctacgtaacggactaagaaaaacactacacgatgctttaactgcaaaaattcagctcaccagttttgaggcaaaatttttgagtgacatgcaaagtaagcatgatctcaatggttcgttctcatggctcacgcaaaaacaacgaaccacactagagaacatactggctaaatacggaaggatctgaggttcttatggctcttgtatctatcagtgaagcatcaagactaacaaacaaaagtagaacaactgttcaccgttagatatcaaagggaaaactgtccatatgcacagatgaaaacggtgtaaaaaagatagatacatcagagcttttacgagtttttggtgcatttaaagctgttcaccatgaacagatcgacaatgtaacagatgaacagcatgtaacacctaatagaacaggtgaaaccagtaaaacaaagcaactagaacatgaaattgaacacctgagacaacttgttacagctcaacagtcacacatagacagcctgaaacaggcgatgctgcttatcgaatcaaagctgccgacaacacgggagccagtgacgcctcccgtggggaaaaaatcatggcaattctggaagaaatagcgctttcagccggcaaacctgaagccggatctgcgattctgataacaaactagcaacaccagaacagcccgtttgcgggcagcaaaacccgcggccgcctatttgtttatttttctaaatacattcaaatatgtatccgctcatgagacaataaccctgataaatgcttcaataatattgaaaaaggaagagtatgagggaagcggtgatcgccgaagtatcgactcaactatcagaggtagttggcgtcatcgagcgccatctcgaaccgacgttgctggccgtacatttgtacggctccgcagtggatggcggcctgaagccacacagtgatattgatttgctggttacggtgaccgtaaggcttgatgaaacaacgcggcgagctttgatcaacgaccttttggaaacttcggcttcccctggagagagcgagattctccgcgctgtagaagtcaccattgttgtgcacgacgacatcattccgtggcgttatccagctaagcgcgaactgcaatttggagaatggcagcgcaatgacattcttgcaggtatcttcgagccagccacgatcgacattgatctggctatcttgctgacaaaagcaagagaacatagcgttgccttggtaggtccagcggcggaggaactctttgatccggttcctgaacaggatctatttgaggcgctaaatgaaaccttaacgctatggaactcgccgcccgactgggctggcgatgagcgaaatgtagtgcttacgttgtcccgcatttggtacagcgcagtaaccggcaaaatcgcgccgaaggatgtcgctgccgactgggcaatggagcgcctgccggcccagtatcagcccgtcatacttgaagctagacaggcttatcttggacaagaagaagatcgcttggcctcgcgcgcagatcagttggaagaatttgtccactacgtgaaaggcgagatcaccaaggtagtcggcaaataatgtctaacaattcgttcaagccgaggggccgcaagatccggccacgatgacccggtcgtcggttcagggcagggtcgttaaatagccgcttatgtctattgctggtttaccggtttattgactaccggaagcagtgtgaccgtgtgcttctcaaatgcctgaggtttcaggcatgc SEQIDNO.2 LKL aaaaatgatttgtcgttagtgttatacctagccctaccgttcgtataatgtatgctatacgaagttatagagcgcttttgaagctcacgctgccgcaagcactcagggcgcaagggctgctaaaggaagcggaacacgtagaaagccagtccgcagaaacggtgctgaccccggatgaatgtcagctactgggctatctggacaagggaaaacgcaagcgcaaagagaaagcaggtagcttgcagtgggcttacatggcgatagctagactgggcggttttatggacagcaagcgaaccggaattgccagctggggcgccctctggtaaggttgggaagccctgcaaagtaaactggatggctttcttgccgccaaggatctgatggcgcaggggatcaagatctgatcaagagacaggatgaggatcgtttcgcatgattgaacaagatggattgcacgcaggttctccggccgcttgggtggagaggctattcggctatgactgggcacaacagacaatcggctgctctgatgccgccgtgttccggctgtcagcgcaggggcgcccggttctttttgtcaagaccgacctgtccggtgccctgaatgaactgcaggacgaggcagcgcggctatcgtggctggccacgacgggcgttccttgcgcagctgtgctcgacgttgtcactgaagcgggaagggactggctgctattgggcgaagtgccggggcaggatctcctgtcatctcaccttgctcctgccgagaaagtatccatcatggctgatgcaatgcggcggctgcatacgcttgatccggctacctgcccattcgaccaccaagcgaaacatcgcatcgagcgagcacgtactcggatggaagccggtcttgtcgatcaggatgatctggacgaagagcatcaggggctcgcgccagccgaactgttcgccaggctcaaggcgcgcatgcccgacggcgaggatctcgtcgtgacccatggcgatgcctgcttgccgaatatcatggtggaaaatggccgcttttctggattcatcgactgtggccggctgggtgtggcggaccgctatcaggacatagcgttggctacccgtgatattgctgaagagcttggcggcgaatgggctgaccgcttcctcgtgctttacggtatcgccgctcccgattcgcagcgcatcgccttctatcgccttcttgacgagttcttctaataaggggatcttataacttcgtataatgtatgctatacgaacggtaaaatgggaaatttactgagccaatccc SEQIDNO.3 P119 atggcttgtcatgcttaattgacagctagctcagtcctaggtataatgctagcagggagaccacaacggtttccctctacaaataattttgtttaactttcgcgcgcgtaacaggaggaattaacc SEQIDNO.4 RBS aggaggaattaacc SEQIDNO.5 TrrnB tgcctggcggcagtagcgcggtggtcccacctgaccccatgccgaactcagaagtgaaacgccgtagcgccgatggtagtgtggggtctccccatgcgagagtagggaactgccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctt SEQIDNO.6 linker gagggaaaaggcggcagtggctctggtagtgagggcggcgcgaaaggtggaggctct SEQIDNO.7 poxBup tcccatcccttccccctccgtcagatgaactaaacttgttaccgttatcacattcaggagatggagaacc SEQIDNO.8 poxBdown aaagggtggcatttcccgtcataataaggacatgccatgattgatttacgcagtgataccgttacccgac SEQIDNO.9 pflBup aaacgaccaccattaatggttgtcgaagtacgcagtaaataaaaaatccacttaagaaggtaggtgttac SEQIDNO.10 ppcup cgtaaattcctgctatttattcgtttgctgaagcgatttcgcagcatttgacgtcaccgcttttacgtgg SEQIDNO.11 ppcdown atgaacgaacaatattccgcattgcgtagtaatgtcagtatgctcggcaaagtgctgggagaaaccatca SEQIDNO.12 glpFup ccttctcctggtgacataatccacatcaatcgaaaatgttaataaatttgttgcgcgaatgatctaacaa SEQIDNO.13 glpFdown atgagtcaaacatcaaccttgaaaggccagtgcattgctgaattcctcggtaccgggttgttgattttct SEQIDNO.14 glpDup tacgtcgaagcggcagataaacgccataatgttatacatatcactctaaaatgttttttcaatgttacct SEQIDNO.15 glpDdown atggaaaccaaagatctgattgtgatagggggcggcatcaatggtgctggtatcgcggcagacgccgctg SEQIDNO.16 acsup ttcaacagcatgcataactgcatgttcctcaaagaattaatcaacttttgttgctgaccttcaaaaatta SEQIDNO.17 acsdown atgagccaaattcacaaacacaccattcctgccaacatcgcagaccgttgcctgataaaccctcagcagt SEQIDNO.18 ackAup gcaaaatggcatagactcaagatatttcttccatcatgcaaaaaaaatttgcagtgcatgatgttaatca SEQIDNO.19 ackAdown atgtcgagtaagttagtactggttctgaactgcggtagttcttcactgaaatttgccatcatcgatgcag SEQIDNO.20 aceup aacgaaaagagcacaacgatccttcgttcacagtggggaagttttcggatccatgacgaggagctgcacg SEQIDNO.21 acedown atgaaaacccgtacacaacaaattgaagaattacagaaagagtggactcaaccgcgttgggaaggcatta SEQIDNO.22 yfeXup cgaaaaaacacgtaaaatagcgctcaacaatgccacggattgcgtggcattattattttcaggaggaaca SEQIDNO.23 yfeXdown gcgtttctgattcattgattaaaggccaggcagtaacattactgactggcctcagattgttgaccaagtg SEQIDNO.24 hemBup aaagatgtcctggcctctcttccattctcttcttgtcaacatcgcgacaactttcgtaaaacatccctac SEQIDNO.25 hemBdown atgacagacttaatccaacgccctcgtcgcctgcgcaaatctcctgcgctgcgcgctatgtttgaagaga SEQIDNO.26 hemCup tacgtttcaccacaacactgacatcactctggcaaggatgttaggatggaccacggatgataatgacggt SEQIDNO.27 hemCdown atgttagacaatgttttaagaattgccacacgccaaagcccacttgcactctggcaggcacactatgtca SEQIDNO.28 hemEup tagcgcgccgtctgatagaagatacggtggcgatgtgtcgggcagagtatgagtgatgatacactgaccg SEQIDNO.29 hemEdown atgaccgaacttaaaaacgatcgttatctgcgggcgctgctgcgccagcccgttgatgtcactccagtat SEQIDNO.30 hemFup tgctgaaggcgtgatcagttatttccactggttcgacaaccagaaagcacattcgaaaaagcgataa SEQIDNO.31 hemFdown atgaaacccgacgcacaccaggttaaacagtttctgctcaaccttcaggatacgatttgtcagcagctga SEQIDNO.32 hemGup gtcgtctcgaggtctttacattgctggtgctctttaccccgactttctggcgtgaatgatggagtaa SEQIDNO.33 hemGdown atgaaaacattaattcttttctcaacaagggacggacaaacgcgcgagattgcctcctacctggcttcgg SEQIDNO.34 ccmAup ctgtattgattgccataaagggatagcgcacaagctgcccgatatgcgtgaagtcgagccaggtttttaa SEQIDNO.35 ccmAdown atgggtatgcttgaagccagagagttactttgtgagcgggatgaacgaaccttatttagtggcttgtcat GYDH Gene ID: 888493 (December 14, 2017) hemA Gene ID: 3720398 (December 19, 2024) hemH Gene ID: 57267780 (September 29, 2023) ho1 Gene ID: 60201361 (April 10, 2023) bvr Gene ID: 66745074 (June 6, 2024)

[0080] Table 2 Primer sequences

[0081] Primer or Sequence Name Nucleotide Sequence (5' to 3') kan-R tcgtcaagaaggcgatagaa poxB-1 tcccatcccttccccctccgtcagatgaac [[ID=1十七]]poxB-2 gtcgggtaacggtatcactgcgtaaatcaa poxB-3 ggctatttaaccgttagtgcctcctttctc pflB-1 aaacgaccaccattaatggttgtcgaag pflB-2 ctaaaaaaggccccactttcgtggagc pflB-3 ccggaaaatttttctcacctgacc [[ID=2十七]]yfeX-1 cgaaaaaacacgtaaaatagcgctcaacaa yfeX-2 cacttggtcaacaatctgaggccagtcagt yfeX-3 gttaatttgcgtctgaacaaaccgccgccg ppc-1 cgtaaattcctgctatttattcgtttgctg ppc-2 tgatggtttctcccagcactttgccgagca ppc-3 cgcttatttaaagcgtcgtgaatttaatga glpF-1 ccttctcctggtgacataatccacatcaat glpF-2 agaaaatcaacaacccggtaccgaggaatt glpF-3 ttgcagattacggtttgccacacttttcat glpD-1 tacgtcgaagcggcagataaacgccataat glpD-2 cagcggcgtctgccgcgataccagcaccat glpD-3 caaacaagtgggcaaatttaccgcacagtt acs-1 ttcaacagcatgcataactgcatgttcctc acs-2 actgctgagggtttatcaggcaacggtctg acs-3 It should be noted that in the provided text, "poxB-17", "pflB-17", "yfeX-17", "ppc-2", "glpD-2", "acs-2" etc. seem to have incorrect numbering in the original text. I translated them as they are presented for the purpose of following the rules. You may want to double-check the accuracy of these designations in the original source. actttagagttagtcagtatcttcctcttt ackA-1 gcaaaatggcatagactcaagatatttctt ackA-2 ctgcatcgatgatggcaaatttcagtgaag ackA-3 atatacattatgccattggctgaaaattac ace-1 aacgaaaagagcacaacgatccttcgttca ace-2 taatgccttcccaacgcggttgagtccact ace-3 cattttaaatgagtagtcttagttgtgctg hemB-1 aaagatgtcctggcctctct hemB-2 tctcttcaaacatagcgcgc hemB-3 ccaaaaaataataaccaacagc hemC-1 tacgtttcaccacaacactgac hemC-2 tgacatagtgtgcctgccag hemC-3 acctcattttacggtttgcg hemE-1 tagcgcgccgtctgatagaa hemE-2 atactggagtgacatcaacggg hemE-3 gctatgacgatttgccgttac hemF-1 tgctgaaggcgtgatcagtt hemF-2 tcagctgctgacaaatcgtatc hemF-3 ggcgtttcgtcagaaaatcg hemG-1 gtcgtctcgaggtctttacattg hemG-2 ccgaagccaggtaggagg hemG-3 aatggatcctgattgccaacat ccmA-1 ctgtattgattgccataaagggatagcgca ccmA-2 atgacaagccactaaataaggttcgttcat ccmA-3 gcatgaccaggcggtgaaagatgggcaaac pSY-F ggttaattcctcctgttagcccaaaaaacg pSY-R tgcctggcggcagtagcgcggtggtcccac GYDH-1 gctaacaggaggaattaaccatgcgcgtcggtattccgaccgagaccaaa hemA-2 cgcgctactgccgccaggcatcaggcaacgacctcggcgcgattcag hemH-1 gctaacaggaggaattaaccatgacgaataaacagggtgttttaatt hemH-2 cgcgctactgccgccaggcactatttcgcgccctctgccagctgtc HHB-2 cgcgctactgccgccaggcattacgcgccccggtccaaaagatccga ara-F ctactgtttctccatacccgttttttgggc rrn-R gttccctactctcgcatggggagaccccac

[0082] Example 1. Construction of Escherichia coli strain HGC01-19

[0083] The preparation method of the relevant strains is obtained according to the following steps (1)-(2):

[0084] (1) Starting from Escherichia coli MC02, the gene poxB encoding pyruvate oxidase was knocked out in the strain to obtain the HGC01 strain.

[0085] The specific steps are as follows:

[0086] (1-a) Preparation of targeting fragment HGC-1

[0087] The following DNA fragments were synthesized (GenScript): from 5' to 3', they consisted of: poxBup, LBL (from 5' to 3', they consisted of lox66, the Kan resistance gene, and lox71), and poxBdown. PCR amplification was performed using poxB-1 / poxB-2 primers and the synthesized DNA fragments as templates to generate the targeting fragment HGC-1.

[0088] (1-b) Preparation of host bacteria containing the pKD46 plasmid

[0089] The pKD46 plasmid was transformed into the starting E. coli MC02 using the calcium chloride method. After overnight culture at 30°C on LB plates containing ampicillin, clones were selected to obtain recombinant E. coli MC02 / pKD46 containing the plasmid pKD46. After induction with arabinose, MC02 / pKD46 expressed the three recombinant proteins of phage λ, conferring homologous recombination capability to the host bacteria. MC02 / pKD46 competent cells were then prepared by washing with 10% glycerol.

[0090] (1-c) Homologous recombination

[0091] The targeting fragment HGC-1 prepared in (1-a) was electroporated into the MC02 / pKD46 competent cells prepared in (1-b) and incubated overnight at 37°C on LB plates containing kanamycin (50µg / ml). Genomic DNA was extracted from selected clones and amplified using PCR with primers poxB-3 / Kan-R. A positive clone was identified by amplifying a target band of approximately 1000bp. Sequencing analysis confirmed that the target sequence on the MC011-kan genome was correct, and the coding region of the poxB gene was deleted. HGC01-kan was cultured overnight at 42°C to eliminate the temperature-sensitive plasmid pKD46.

[0092] (1-d) Elimination of resistance

[0093] The pSCre plasmid was transformed into the HGC01-kan strain, which had been depleted of pKD46, using the calcium chloride method. The strain was cultured overnight at 30°C on LB plates containing 50 mg / L streptomycin and 0.2% L-arabinose. The kanamycin resistance fragment was eliminated using the Cre recombinase on the pSCre plasmid. The temperature-sensitive pSCre plasmid was eliminated by culturing overnight at 42°C. The resulting strain was named HGC01.

[0094] (2) Obtaining strains HGC02, HGC03, HGC04, HGC05, HGC06, HGC07, HGC08, HGC09, HGC10, HGC11, HGC12, HGC13, HGC14, and HGC15

[0095] Using the same method as Example 1 (1), starting from the HGC01 strain, the HGC02, HGC03, HGC04, HGC05, HGC06, HGC07, HGC08, HGC09, HGC10, HGC11, HGC12, HGC13, HGC14, and HGC15 strains were obtained in sequence.

[0096] The difference between each strain construction process and Example 1 (1) is that different starting strains, different targeting fragments, and different primers are used. The specific starting strains, targeting fragments (the specific sequences of the sequence fragments are shown in Table 1), primers, modified targets, and obtained strain information used in each step are shown in Table 3.

[0097] Table 3. Construction process of HGC01-HGB20

[0098] Step number Starting strain Target practice clip name The targeting fragment contains the sequence fragment (5'-3') Modified targets Amplification primers Identification primers Obtain strains 1 MC02 HGC-1 poxBup、LKL、poxBdown Knockout of the pyruvate oxidase (poxB) gene poxB-1 / poxB-2 poxB-3 / KanR HGC01 2 HGC01 HGC-2 pflBup, LKL, pflBdown Knockout of the pyruvate formate lyase (pflB) gene pflB-1 / pflB-2 pflB-3 / KanR HGC02 3 HGC02 HGC-3 aceup、LKL、P119、acedown The citrate synthase (aceB) gene and the upstream region of isocitrate lyase (aceA) were deleted and replaced with the P119 promoter. ace-1 / ace-2 ace-3 / KanR HGC03 HGC03 HGC-5 ppcup、LKL、P119、ppcdown Replace the promoter of the phosphoenolpyruvate carboxylase (ppc) gene with the P119 promoter ppc-1 / ppc-2 ppc-3 / KanR HGC04 HGC04 HGC-6 glpFup, LKL, P119, glpFdown Replace the promoter of the glycerol transporter (glpF) gene with the P119 promoter glpF-1 / glpF-2 glpF-3 / KanR HGC05 HGC05 HGC-7 glpDup, LKL, P119, glpDdown Replace the promoter of the glycerol-3-phosphate dehydrogenase (glpD) gene with the P119 promoter glpD-1 / glpD-2 glpD-3 / KanR HGC06 HGC07 HGC-8 yfeXup, LKL, yfeXdown Knockout of porphyrinogen peroxidase (yfeX) yfeX-1 / yfeX-2 yfeX-3 / KanR HGC08 HGC08 HGC-9 hemBup, LKL, P119, hemBdown Replacement of the promoter of the porphobilinogen synthase (hemB) gene with the P119 promoter hemB-1 / hemB-2 hemB-3 / KanR HGC09 HGC09 HGC-10 hemCup, LKL, P119, hemCdown Replace the promoter of the hydroxymethylcholine synthase (hemC) gene with the P119 promoter hemC-1 / hemC-2 hemC-3 / KanR HGC10 HGC10 HGC-11 hemEup,LKL,P119,hemEdown Replacement of the promoter of the uroporphyrinogen decarboxylase (hemE) gene with the P119 promoter hemE-1 / hemE-2 hemE-3 / KanR HGC11 HGC11 HGC-12 hemFup,LKL,P119,hemFdown Replace the promoter of the coproporphyrinogen oxidase (hemF) gene with the P119 promoter hemF-1 / hemF-2 hemF-3 / KanR HGC12 HGC12 HGC-13 hemGup, LKL, P119, hemGdown Replace the promoter of the protoporphyrinogen oxidase (hemG) gene with the P119 promoter hemG-1 / hemG-2 hemG-3 / KanR HGC13 HGC13 HGC-14 ccmAup, LKL, P119, ccmAdown Replace the promoter of the cytochrome c maturation protein A gene (ccmA) with the P119 promoter ccmA-1 / ccmA-2 ccmA-3 / KanR HGC14 MC02 HGC-14 ccmAup, LKL, P119, ccmAdown Replace the promoter of the cytochrome c maturation protein A gene (ccmA) with the P119 promoter ccmA-1 / ccmA-2 ccmA-3 / KanR HGC15

[0099] Example 2 Construction of plasmids pS-H, pY-H, and pY-HHB

[0100] (1) Preparation of backbone fragments

[0101] Preparation of backbone fragment pS: It was obtained by PCR amplification using plasmid pSB1s as template and universal primers pSY-F / pSY-R.

[0102] Preparation of backbone fragment pY: It was obtained by PCR amplification using plasmid pYB1k as template and universal primers pSY-F / pSY-R.

[0103] (2) Preparation of target gene fragments

[0104] Preparation of the target gene fragment GH: A DNA fragment containing GH was synthesized by Qingke Biotechnology. The 5'-3' sequence contains GYDH, RBS, and hemA (Table 1). This DNA fragment was used as a template for PCR amplification using primers GYDH-1 / hemA-2.

[0105] Preparation of the target gene fragment hemH: A DNA fragment containing hemH was synthesized by Qingke Biotechnology with the sequence hemH (Table 1). This DNA fragment was used as a template for PCR amplification using primers hemH-1 / hemH-2.

[0106] Preparation of the target gene fragment HHB: A DNA fragment containing HHB was synthesized by Qingke Biotechnology. The 5'-3' sequence contains hemH (without TAA), linker, ho1, RBS, and bvr. This DNA fragment was used as a template for PCR amplification using primers hemH-1 / HHB-2.

[0107] The above PCRs were all amplified using high-fidelity TransStart FastPfu DNA polymerase (Beijing Quanshijin Biotechnology Co., Ltd., product catalog number AP221), and the target fragments were recovered by agarose gel electrophoresis.

[0108] (3) Obtaining recombinant plasmid using Gibson assembly method

[0109] The backbone fragments were ligated with the target gene fragment using the Gibson assembly method (Gibson DG, Young L, et al. Enzymatic assembly of DNA molecules up to selpxMeral hundred kilobases. Nat. methods. 2009; 6(5):343-345) to generate a recombinant expression vector. Competent Escherichia coli DH5α cells (purchased from Beijing Quanshijin Biotechnology Co., Ltd., product catalog number CD201) were transformed using the CaCl2 method. The cells were evenly plated on LB plates containing streptomycin or kanamycin and cultured overnight at 37°C. Clones were selected and identified using the universal primers ara-F / rrn-R. Clones capable of amplifying the target fragment were sequenced and selected for plasmid extraction. Positive clones were then selected for plasmid extraction to obtain a positive plasmid.

[0110] Plasmids pS-GH, pY-H, and pY-HHB were constructed using the same method, differing only in the backbone fragments and target gene fragments. Detailed information is shown in Table 4.

[0111] Table 4. Plasmid construction information

[0112] Serial number plasmids Skeleton fragments Target gene fragment Antibiotics used for screening 1 pS-GH pS GH Streptomycin 2 pY-H pY hemH Kanamycin 3 pY-HHB pY HHB Kanamycin

[0113] Example 3: Production of heme and bilirubin using recombinant Escherichia coli

[0114] The test bacteria were recombinant E. coli HGC20 and HGC21, and the control bacteria were HGC22 and HGC23. The relevant strain information is shown in Table 5.

[0115] (1) Recombinant Escherichia coli HGC20, HGC21, HGC22, and HGC23.

[0116] The plasmid obtained in Example 2 was transformed into the recombinant bacteria obtained in Example 1 using the calcium chloride transformation method. After overnight culture at 37°C on LB plates containing streptomycin and kanamycin, clones were selected and frozen at -80°C. Information on the relevant strains used in the construction process is shown in Table 5.

[0117] Table 5 Strain information

[0118] strain Recipient bacteria plasmids HGC20 HGC14 pS-GH, pY-H HGC21 HGC13 pS-GH、pY-HHB HGC22 HGC15 pS-GH, pY-H HGC23 MC02 pS-GH、pY-HHB

[0119] (2) Using glycerol and acetic acid as raw materials, heme is synthesized using recombinant Escherichia coli HGC20

[0120] The composition and final concentrations of the glycerol medium used are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 1.5% (g / 100 mL), sodium acetate: 1.5% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol and sodium acetate may be added to a final concentration of 1% (g / 100 mL).

[0121] The recombinant bacteria HGC20 and the control strain HGC22 cultured overnight were inoculated at a 1% inoculum into a shake flask containing 200 ml of LB medium containing streptomycin and kanamycin. The culture was carried out at 37°C for 3-4 h until the OD600nm reached 0.6-0.8. After that, arabinose at a final concentration of 0.2 g / L was added. The culture was continued at 37°C for 12 h, and the cells were collected by centrifugation at 8000 rpm for 10 min.

[0122] The collected cells were resuspended in shake flasks containing 10 mL of glycerol medium and transformed at 120 rpm and 37°C for 24 h. The supernatant was centrifuged and filtered. The heme content was determined by HPLC. The yield was calculated as g / L of heme per liter of the shake flask. The HPLC analysis was performed using a Waters C18 column (250 mm × 4.6 mm, 5 μm) with a mobile phase of methanol / phosphoric acid (40 / 60) at a flow rate of 0.5 mL / min and a column temperature of 35°C. A heme standard was purchased from Aladdin (Cat. No. H104216). The retention time of the heme standard was 16.9 min.

[0123] The results showed that the heme production of the control strain HGC22 was 0, while the average heme production of the recombinant strain HGC20 was 0.75±0.05 g / L. The constructed strain can effectively utilize glycerol and acetic acid to synthesize heme.

[0124] (3) Synthesis of bilirubin using recombinant Escherichia coli HGC21 using glycerol and acetic acid as raw materials

[0125] The composition and final concentrations of the glycerol medium used are as follows: Na₂HPO₄: 25 mM, KH₂PO₄: 25 mM, NH₄Cl: 50 mM, Na₂SO₄: 5 mM, MgSO₄: 2 mM, glycerol: 1.5% (g / 100 mL), sodium acetate: 1.5% (g / 100 mL), yeast extract: 0.5% (g / 100 mL). During the transformation process, glycerol and sodium acetate may be added to a final concentration of 1% (g / 100 mL).

[0126] The recombinant bacteria HGC21 and the control strain HGC23 cultured overnight were inoculated at a 1% inoculum into a shake flask containing 200 ml of LB medium containing streptomycin and kanamycin. The culture was carried out at 37°C for 3-4 h until the OD600nm reached 0.6-0.8. After that, arabinose at a final concentration of 0.2 g / L was added. The culture was continued at 37°C for 12 h, and the cells were collected by centrifugation at 8000 rpm for 10 min.

[0127] The collected cells were resuspended in a shake flask containing 10 mL of glycerol culture medium, transformed at 120 rpm and 37 ° C for 24 h, and the cells were centrifuged and recorded as 24 h samples. The cells before transformation were taken and recorded as 0 h samples. The cells were resuspended in 0.1 M potassium phosphate buffer (pH 7.0) and ultrasonically disrupted before centrifugation to obtain the precipitate. The precipitate was extracted with dichloromethane and centrifuged to obtain the organic phase, and the bilirubin content was detected by HPLC. The HPLC results of the samples are as follows: Figure 1The difference in bilirubin content between the 24-hour sample and the 0-hour sample was calculated and converted to bilirubin production per liter (g / L) in the shake flask. HPLC was performed using a Waters C18 column (250 mm × 4.6 mm, 5 μm); the mobile phase consisted of DMSO / acetonitrile / 0.5 M ammonium phosphate buffer (5:7:7) at a flow rate of 0.5 mL / min; the column temperature was 30°C. Bilirubin standards were purchased from Aladdin (Cat. No. B104211). The retention time of the bilirubin standard was 20 minutes.

[0128] The results showed that the bilirubin accumulation of the control strain HGC23 was zero during the 0-24h period, while that of the recombinant strain HGC21 was 1.77±0.14 g / L. The constructed strain was able to effectively utilize glycerol to synthesize bilirubin.

[0129] The production characteristics of related strains are shown in Table 6.

[0130] Table 6 Comparison of yield of each strain

[0131] strain Hemoglobin (g / L) Bilirubin accumulation in 0-24 hours (g / L) HGC20 0.75±0.05 - HGC22 0 - HGC21 - 1.77±0.14 HGC23 - 0

Claims

1. A recombinant Escherichia coli comprising the following modifications: (1) Knockout of the gene encoding pyruvate oxidase (poxB); (2) knockout of the gene encoding pyruvate formate lyase (pflB); (3) Knockout of the gene encoding malate synthase (aceB); (4) Knockout of the gene encoding porphyrinogen peroxidase (yfeX); (5) Enhance the expression of phosphoenolpyruvate carboxylase gene (ppc); (6) Enhance the expression of the glycerol transporter gene (glpF); (7) Enhance the expression of glycerol-3-phosphate dehydrogenase gene (glpD); (8) Enhance the expression of acetyl-CoA synthetase gene (acs); (9) Enhance the expression of acetate kinase gene (ackA); (10) Enhance the expression of isocitrate lyase gene (aceA); (11) Enhance the expression of porphobilinogen synthase gene (hemB); (12) Enhance the expression of hydroxymethylcholine synthase gene (hemC); (13) Enhance the expression of uroporphyrinogen decarboxylase gene (hemE) (14) Enhance the expression of coproporphyrinogen oxidase gene (hemF); (15) Enhance the expression of protoporphyrinogen oxidase gene (hemG); (16) Introduction of glycine dehydrogenase (GYDH); (17) Introduction of the 5-aminolevulinic acid synthase gene (hemA); (18) Introducing the ferrochelatase gene (hemH).

2. A recombinant Escherichia coli, comprising the steps of performing the transformations (1) to (18) of claim 1 and the following transformations in Escherichia coli: (19) Strengthen the cytochrome c maturation protein A gene (ccmA).

3. A recombinant Escherichia coli, comprising the steps of performing the transformations (1) to (18) of claim 1 and the following transformations in Escherichia coli: (20) Introduction of the heme oxygenase gene (ho1); (21) Introduce the biliverdin reductase gene (bvr).

4. A method for constructing a recombinant Escherichia coli with improved hemoglobin production, comprising the following steps: performing the transformation according to the transformation (1) to (19) in any one of claims 1 and 2.

5. A method for constructing a recombinant Escherichia coli with improved bilirubin production, comprising the following steps: performing the transformation according to the transformation (1)-(18), (20), and (21) in any one of claims 1 and 3.

6. A method for producing or increasing hemoglobin production, comprising the following steps: culturing the recombinant Escherichia coli according to any one of claims 1 and 2 using glycerol or acetic acid as carbon sources, collecting the bacteria, and obtaining hemoglobin.

7. A method for producing or increasing bilirubin production, comprising the following steps: culturing the recombinant Escherichia coli according to any one of claims 1 and 3 using glycerol or acetic acid as carbon sources, and collecting the bacteria; and obtaining bilirubin.

8. Use of the recombinant Escherichia coli according to any one of claims 1 and 2 in producing or increasing hemoglobin production.

9. Use of the recombinant Escherichia coli according to any one of claims 1 and 3 in producing or increasing bilirubin production.

10. A product for producing or increasing hemoglobin production, wherein the active ingredient is the recombinant Escherichia coli according to any one of claims 1 and 2.

11. A product for producing or increasing bilirubin production, wherein the active ingredient is the recombinant Escherichia coli according to any one of claims 1 and 3.

Images