A glutamate decarboxylase multi-site combined mutant and application thereof

Abstract

The application discloses a glutamate decarboxylase multi-site combined mutant and application thereof. The application finds key sites by analyzing the enzyme structure and amino acid sequence of glutamate decarboxylase from Bifidobacterium breve and human GAD65, finally the key amino acid residue sites in the catalytic region and the vicinity of the active center are reformed (C168M, V167F, Y165S, F304Y, Y308F), so that the catalytic activity and specificity of the glutamate decarboxylase are regulated, the reaction type is changed from decarboxylation to incomplete oxidation, and the catalysis of glutamic acid forms the oxidation byproduct succinamic acid. In the process of GAD producing succinamic acid, the side reaction is enhanced, and the main reaction is weakened, so that the produced GABA is further oxidized into succinamic acid. The biological catalysis method can effectively improve the screening probability of the mutant amino acid sites, improve the experimental efficiency and feasibility, and screen the mutant enzyme with enzyme activity obviously superior to the parent enzyme.

Description

Technical Field

[0001] This invention relates to the fields of enzyme engineering and genetic engineering technology, specifically to a multi-site combination mutant of glutamate decarboxylase and its applications. Background Technology

[0002] Enzymes, these biocatalysts, are increasingly demonstrating their irreplaceable importance in synthetic biology and organic synthesis. With the continuous advancement of science and technology, the application scope of enzymes is constantly expanding. Their unique catalytic capabilities and high stereoselectivity have made enzymes a research hotspot in many fields, including drug synthesis, materials science, and green chemistry. Among the many types of enzymes, pyridoxal-5-phosphate (PLP)-dependent enzymes have attracted considerable attention due to their unique catalytic mechanism and multifunctionality.

[0003] PLP, the active form of vitamin B6, is widely present in various organisms and plays a crucial role in many key metabolic processes. PLP-dependent enzymes, through covalent binding of their active sites to PLP, can catalyze a series of complex biochemical reactions. These reactions include, but are not limited to, transamination, decarboxylation, racemization, and the elimination or substitution of β- or γ-carbons. This versatility mainly stems from the fact that, after binding to a substrate, PLP can act as an electrophilic catalyst, stabilizing different types of carbon ion reaction intermediates, thereby guiding the reaction in a specific direction.

[0004] In the field of synthetic biology, the versatility of PLP-dependent enzymes provides researchers with a rich toolkit. By precisely regulating the enzyme's active site and coenzyme-binding pocket, researchers can achieve fine control over substrate selectivity and catalytic efficiency. This capability makes PLP-dependent enzymes extremely promising for constructing complex biosynthetic pathways, optimizing metabolic fluxes, and producing high-value-added compounds.

[0005] In organic synthesis, PLP-dependent enzymes also demonstrate unique advantages. Traditional chemical synthesis methods often suffer from cumbersome steps, low yields, and severe environmental pollution. However, using PLP-dependent enzymes for catalytic synthesis can effectively overcome these problems. Enzyme-catalyzed reactions exhibit high stereoselectivity and regioselectivity, enabling the precise synthesis of target compounds. Furthermore, enzyme-catalyzed reactions typically proceed under mild conditions, such as ambient temperature and pressure, and in aqueous solutions, making the reaction process safer and more environmentally friendly.

[0006] Of particular note is the current research hotspot in enzyme engineering: achieving "multi-purpose enzymes" by utilizing the different catalytic effects of a single enzyme on a single substrate. This strategy not only improves enzyme utilization efficiency but also simplifies synthesis steps and reduces production costs. For example, modifying PLP-dependent enzymes through protein engineering can endow them with new catalytic properties, enabling them to perform reactions beyond their original ones. This realization of the "molecular switch effect" provides new ideas for the diversified application of enzymes.

[0007] Among PLP-dependent enzymes, glutamate decarboxylase (GAD) is a typical example. GAD is primarily responsible for catalyzing the decarboxylation of glutamate to produce γ-aminobutyric acid (GABA). However, by modifying GAD using protein engineering techniques, its side reactions can be enhanced, leading to incomplete oxidation and the production of succinic acid. The key to this modification lies in the fine-tuning of amino acid residues near the coenzyme PLP binding pocket and the catalytic region within the enzyme molecule. By introducing point mutations, deleting or inserting specific amino acids, the spatial conformation and charge distribution of the enzyme molecule can be altered, thereby affecting its substrate recognition and catalytic efficiency, providing new pathways for the biocatalytic synthesis of related compounds. Summary of the Invention

[0008] To address the shortcomings of existing technologies, this invention provides a multi-site combined mutant of glutamate decarboxylase and its application in the preparation of succinic acid, aiming to screen for glutamate decarboxylase mutants that favor the production of byproducts. By studying and altering key amino acid residues near the catalytic region and active site, the applicant engineered the glutamate decarboxylase GAD to change its reaction type from decarboxylation to incomplete oxidation. In this process, L-Glu is first decarboxylated to generate GABA, which then undergoes further incomplete oxidation to form succinic acid. The glutamate decarboxylase is then applied to the production of succinic acid.

[0009] This invention is based on identifying mutation sites by comparing the protein structure and amino acid sequence of glutamate decarboxylase. The modified glutamate decarboxylase enhances the side reaction while weakening the main reaction during L-Glu catalysis, causing the generated GABA to be further oxidized to succinate. GABA, as an intermediate, is completely and instantly converted, rather than being "not generated." In other words, the modified glutamate decarboxylase disrupts the balance between the main and side reactions in the catalytic process, thus causing an apparent cessation of the main reaction.

[0010] This invention compares the size of the pocket formed near the coenzyme binding pocket by different mutation sites, and screens amino acid sites with greater steric hindrance as preferred mutation sites.

[0011] The mutation sites obtained above were characterized, and five beneficial mutants were screened to obtain Y165S (indicating that the tyrosine at position 165 of the wild-type glutamate decarboxylase was mutated to serine, and the rest were similarly mutated), V167F, C168M, F304Y, and Y308F.

[0012] By performing combined mutations at five sites (165, 167, 168, 304, and 308), the mutation sites of the multi-site combined mutant of glutamate decarboxylase obtained are any one of the following:

[0013] (1) Y165S / V167F / C168M / F304Y / Y308F;

[0014] (2) V167F / C168M / F304Y / Y308F;

[0015] (3) Y165S / C168M / F304Y / Y308F;

[0016] (4) C168M / F304Y / Y308F.

[0017] The mutants of the above combined mutations were characterized to reveal a combined mutant with significantly enhanced byproduct catalytic activity, namely the Y165S / C168M / F304Y / Y308F quadruple mutant, which is a mutant in which tyrosine at position 165 of wild-type glutamate decarboxylase is mutated to serine, cysteine ​​at position 168 to methionine, phenylalanine at position 304 to tyrosine, and tyrosine at position 308 to phenylalanine. This mutant exhibits significantly enhanced oxidation activity.

[0018] The present invention also provides a gene encoding the multisite combination mutant of the glutamate decarboxylase.

[0019] Specifically, the gene sequences of the glutamate decarboxylase multisite combination mutants with mutation sites Y165S / V167F / C168M / F304Y / Y308F, V167F / C168M / F304Y / Y308F, Y165S / C168M / F304Y / Y308F and C168M / F304Y / Y308F are shown in SEQ ID NO.3-6, respectively.

[0020] The present invention also provides a recombinant expression plasmid containing the said gene, and a genetically engineered bacterium containing the recombinant expression plasmid. Optionally, the GAD mutant is expressed by the recombinant plasmid pET-28a(+)-GAD. The original vector for this recombinant plasmid is pET-28a(+).

[0021] The present invention also provides the application of the multisite combination mutant of glutamate decarboxylase, the gene, or the genetically engineered bacteria in catalyzing the production of succinic acid from glutamate.

[0022] Compared to the parent enzyme, which generates a small amount of succinic acid under normal conditions (i.e., the parent enzyme naturally possesses the potential for side reactions), the mutant enzyme is more conducive to the production of succinic acid under normal conditions (the mutant enzyme is a directed amplification of the side reactions), accelerating the conversion of GABA to succinic acid, preventing GABA accumulation, and making it more suitable for industrial applications.

[0023] The glutamate decarboxylase mutant described in this invention can also utilize L-glutamate (L-Glu) to catalyze the production of succinic acid while retaining its original function.

[0024] The present invention also provides a method for catalyzing the production of succinic acid from glutamic acid, using glutamic acid as a reaction substrate, pyridoxal phosphate as a coenzyme, and using the multisite combination mutant of the glutamic acid decarboxylase or the genetically engineered bacteria to carry out the catalytic reaction to obtain succinic acid.

[0025] Preferably, during the catalytic reaction, the molar concentration of glutamic acid is 100 mM, and the molar concentration of pyridoxal phosphate is 0.1 mM. The temperature of the catalytic reaction is 37°C, and the reaction time is 40 min.

[0026] This invention is based on identifying amino acid residues near key amino acids in the binding pocket of the coenzyme 5'-pyridoxal phosphate. The desired amino acid residue sites for mutation are determined, and the results are verified experimentally using site-directed mutagenesis via high-performance liquid chromatography (HPLC) screening. The resulting compound is biocatalyzed to produce succinic acid. Compared to chemical synthesis, the biocatalytic synthesis of this compound using glutamate decarboxylase offers milder synthesis conditions, simpler operation, and easier separation and extraction. This method effectively increases the screening probability of mutated amino acid sites, improves experimental efficiency and feasibility, and allows for the screening of mutant enzymes with significantly superior activity compared to the parent enzyme. Attached Figure Description

[0027] Figure 1 The image shows the SDS-PAGE analysis results of the glutamate decarboxylase parent and its mutants M1 (Y165S / V167F / C168M / F304Y / Y308F), M2 (V167F / C168M / F304Y / Y308F), M3 (Y165S / C168M / F304Y / Y308F), and M4 (C168M / F304Y / Y308F) prepared in Example 1.

[0028] Figure 2 The liquid chromatograms show the reaction of the parent glutamate decarboxylase and its mutants at 37°C for the same reaction time with the substrate L-Glu.

[0029] Figure 3 High-resolution mass spectra of the products of L-glutamic acid reaction catalyzed by the glutamate decarboxylase mutants Y165S / V167F / C168M / F304Y / Y308F for 24 h.

[0030] Figure 4 This is a high-resolution mass spectrum of succinic acid standard.

[0031] Figure 5 The product conversion rate of L-Glu to succinic acid catalyzed by the parent glutamate decarboxylase and its mutant under the same reaction time at 37℃ is given.

[0032] Figure 6 The liquid chromatogram of L-Glu to succinic acid catalyzed by wild-type glutamate decarboxylase.

[0033] Figure 7 A schematic diagram of the decarboxylation of L-Glu to generate GABA and the further incomplete oxidation of GABA to form succinic acid.

[0034] Figure 8 The liquid chromatograms show the production of GABA from the substrate L-Glu by wild-type glutamate decarboxylase and its mutants at 37°C for the same reaction time.

[0035] Figure 9 The product conversion rate of glutamate decarboxylase parent and its mutant to produce GABA from substrate L-Glu under the same reaction time at 37℃ is given. Detailed Implementation

[0036] Example 1

[0037] 1. Experimental Materials

[0038] (1) LB liquid medium: 10 g / L trypsin (purchased from Oxoid), 5 g / L yeast extract (purchased from Oxoid), 10 g / L sodium chloride (purchased from Sangon Biotech Co., Ltd.), pH 7.0. LB solid medium: LB liquid medium with 2% ( w / v Agar powder.

[0039] (2) Methanol (MeOH) was purchased from Aladdin Reagent Co., Ltd. Glycine, Tris, sodium dodecyl sulfate, universal protein staining solution, sodium chloride, glycerol, calcium chloride, imidazole, glacial acetic acid, disodium hydrogen phosphate, sodium dihydrogen phosphate, Coomassie Brilliant Blue protein assay kit, Ni-NTA chromatography medium, isopropyl-β-D-thiogalactoside (IPTG), lysozyme, kanamycin sulfate, and PLP were purchased from Shanghai Sangon Biotech Co., Ltd. DNA Marker, protein Marker, protein loading buffer, and nucleic acid dyes were purchased from Beijing TransGen Biotech Co., Ltd. Agar powder and anhydrous ethanol were purchased from Sinopharm Chemical Reagent Co., Ltd. Acetonitrile was purchased from Shanghai Wokai Chemical Reagent Co., Ltd.

[0040] (3) Strains: pET-28a(+) plasmid was used as the cloning vector in the gene synthesis service, with the following restriction enzyme sites: Nde I and Hind III. The recombinant plasmid pET-28a(+)-GAD (glutamate decarboxylase parent, mutants Y165S / C168M / F304Y / Y308F, Y165S / V167F / C168M / F304Y / Y308F, C168M / F304Y / Y308F and V167F / C168M / F304Y / Y308F plasmid) was transformed into... E. coli BL21(DE3) was used to obtain recombinant bacteria.

[0041] 2. Establishment of a high-performance liquid chromatography (HPLC) detection method

[0042] High-performance liquid chromatography (HPLC) conditions (for product detection): Agilent Poroshell HPH.C18 column (4.6 × 150 mm, 4 μm), column temperature 25℃; injection volume 10 μL; flow rate 1 mL / min; mobile phase: phase A (10 mM phosphate buffer, pH 6.5), phase B (pure methanol). The mobile phase was eluted isocratically for 0–10 min, with phase A comprising 95% of the volume.

[0043] High-performance liquid chromatography (HPLC) conditions (for GABA detection): Hypersil ODS25 column (4.6 mm × 250 mm), UV detector 254 mm, column temperature 25℃; injection volume 10 μL; flow rate 1 mL / min; mobile phase A (methanol) and mobile phase B (tetrahydrofuran:methanol:0.05M sodium acetate (pH 6.2) = 1:15:84 (v / v)). Gradient elution method is shown in Table 1.

[0044] Table 1 HPLC gradient elution program

[0045]

[0046] 3. Construction of the screening method

[0047] (1) Transformation of recombinant plasmids

[0048] Take out the -80℃ stored E. coli BL21(DE3) competent cells were thawed on ice and then mixed with 2 μL of pET-28a(+)-GAD dilution (20 ng / μL). The mixture was then placed on ice for 30 min. After heat shock in a 42°C water bath for 90 s, the cells were rapidly cooled on ice for 5 min. 650 μL of LB liquid medium was added to the tubes, and the cells were incubated at 37°C and 180 rpm for 1 h to allow *E. coli* to renature and express the kanamycin resistance gene encoded by the recombinant plasmid. 100 μL of the bacterial suspension was diluted and evenly spread onto an LB agar plate containing 50 μg / mL kanamycin. The plates were placed face up for half an hour until the bacterial suspension was completely absorbed by the medium. The plates were then inverted and incubated at 37°C for 24 h before being stored at 4°C.

[0049] (2) Screening of strains

[0050] Single colonies were picked from the above plates and colony PCR was performed using primers T7 (TAATACGACTCACTATAGG, SEQ ID NO. 29) and T7t (CTAGCATAACCCCTTGGGGCCTCTAAACGGGTCTTGAGGGGTTTTTTG, SEQ ID NO. 30). The PCR products were then subjected to DNA agarose gel electrophoresis to observe whether there were bands at the corresponding positions. Strains with bright bands were selected for glycerol preservation and stored at -80℃.

[0051] 4. Selection of mutation sites

[0052] Based on the comparison between the crystal structure of glutamate decarboxylase and the crystal structure of GAD65 derived from mammals, and combined with the results of amino acid sequence alignment, amino acid residues that need to be mutated were screened.

[0053] Key sites affecting catalytic function, 165, 166, 167, 168, 304, and 308, were selected. These sites were then subjected to combined mutations, resulting in the gene sequences of mutants Y165S / V167F / C168M / F304Y / Y308F (named mutant M1), V167F / C168M / F304Y / Y308F (named mutant M2), Y165S / C168M / F304Y / Y308F (named mutant M3), and C168M / F304Y / Y308F (named mutant M4), as shown in SEQ ID NO.4, 6, 3, and 5, respectively.

[0054] Using the primers in Table 1, the coding gene containing the glutamate decarboxylase mutant (the amino acid sequence of glutamate decarboxylase is shown in SEQ ID NO.2, and the gene sequence is shown in SEQ ID NO.1, with a length of 1407 bp, from Lactobacillus brevis) Lactobacillusbrevis The plasmid cloned from [organism name] (GenBank ID: GU987102) was used as a template for PCR amplification. The PCR product was then subjected to [condition 37℃]. Dpn After digestion with enzyme I, the product was purified using a PCR product purification kit, and then transformed into [a specific enzyme] using chemical transformation. E. coli In BL21(DE3) competent cells, after 1 h, the recovery solution was plated onto LB agar plates containing a final concentration of 50 μg / μL kanamycin to obtain a site-directed mutagenesis library. The recombinant plasmid was sent to Anhui General Biosystems Co., Ltd. for nucleotide sequencing. The correctly sequenced recombinant plasmid was then transformed into... E. coli BL21(DE3) competent cells were used to obtain the target recombinant strain. The site-directed mutagenesis primers corresponding to the GAD mutants are shown in Table 2.

[0055] Table 2. Mutation sites and primer sequences

[0056]

[0057] 5. Construction of mutant libraries and extraction of plasmids

[0058] Take out the -80℃ stored E. coli BL21(DE3) competent cells were thawed on ice and then mixed with 2 μL of pET-28a(+)-GAD and its mutant dilution (20 ng / μL). The mixture was then placed on ice for 30 min. After heat shock in a 42°C water bath for 90 s, the cells were rapidly cooled on ice for 5 min. 650 μL of LB liquid medium was added to the tubes, and the cells were incubated at 37°C and 180 rpm for 1 h to allow *E. coli* to renature and express the kanamycin resistance gene encoded by the recombinant plasmid. 100 μL of the bacterial suspension was diluted and evenly spread onto an LB agar plate containing 50 μg / mL kanamycin. The plates were placed face up for 30 min until the bacterial suspension was completely absorbed by the medium. The plates were then inverted and incubated at 37°C for 24 h before being stored at 4°C.

[0059] Single colonies were randomly selected from the plates and inoculated into 5 mL of LB liquid medium containing 50 μg / mL kanamycin. The culture was carried out at 37°C and 200 rpm until OD500. 600When the value was 0.8, 1 mL of bacterial culture was sent to Hangzhou Youkang Biotechnology Co., Ltd. for nucleotide sequencing. 1 mL of bacterial culture was used to preserve the bacterial strain, and 3 mL of bacterial culture was used for plasmid extraction. Specific steps were followed according to the instructions of the plasmid mini-extraction kit. After verifying the size and purity of the target band using DNA agarose gel electrophoresis, 5 μL of plasmid was transferred into... E. coli BL21(DE3) competent cells were used to obtain the target recombinant strain.

[0060] 6. Enzyme Expression and Purification

[0061] Single colonies of the parental enzyme and the mutant were picked and inoculated into 5 mL of LB liquid medium containing a final concentration of 50 μg / mL kanamycin, and cultured on a shaker at 37°C and 200 rpm for 12 h. The bacterial culture was then transferred at a 2% inoculum (v / v) to 200 mL of LB liquid medium containing a final concentration of 50 μg / mL kanamycin, and cultured for another 2–3 h at 37°C and 200 rpm. When OD... 600 When the concentration reached 0.8, IPTG was added to a final concentration of 0.5 mM, and protein expression was induced at 25°C and 150 rpm. After 20 h of induction, the bacterial cells were collected at 6000 rpm and 4°C.

[0062] Bacterial cells were washed twice with 20 mM PBS buffer (pH 8.0) to remove residual culture medium and then resuspended in 50 mL of cell lysis buffer (50 mM sodium dihydrogen phosphate, 300 mM sodium chloride, 20 mM imidazole, pH 8.0). Cell lysis was performed using a homogenizer under ice bath conditions. The cell lysis buffer was centrifuged at 8000 rpm at 4°C for 1 h, and the supernatant collected was the crude enzyme solution containing glutamate decarboxylase. Subsequently, the crude enzyme solution was purified by Ni-NTA affinity chromatography. After loading, washing, and elution, the crude enzyme was purified into a pure enzyme solution.

[0063] 7. Determination of protein content

[0064] A protein concentration standard curve was established using a modified Bradford protein assay kit to determine the concentration of the purified enzyme. The preparation steps of the protein standard curve were performed according to the manufacturer's instructions. The molecular weight and purity of the purified protein were identified using SDS-PAGE (12% separating gel and 5% stacking gel).

[0065] SDS-PAGE electrophoresis patterns of parental enzymes and mutants are as follows: Figure 1 As shown, the electrophoretic bands of the parent enzyme and the mutant are located on the same horizontal line, with a molecular weight of approximately 56 kDa, consistent with the theoretical molecular weight (56.2 kDa), laying the foundation for subsequent experiments.

[0066] Example 2

[0067] Characterization of mutants and determination of product conversion rate.

[0068] The enzymes expressed by each mutant (single-point mutations including C168M, V167F, Q166H, Y165S, Q166A, V167M, C168S, and combined mutants F304Y / Y308F, M1, M2, M3, and M4) were isolated and purified. The concentration of each purified protein was adjusted to 1 mg / mL. 200 μL of purified GAD and its mutants were mixed with 800 μL of a solution containing 100 mM L-glutamate and 0.1 mM pyridoxal phosphate. The mixture was reacted at 37℃ and 400 rpm for 40 min. Immediately afterwards, 100 μL of the reaction solution was added to 900 μL of NaHCO3 solution (0.2 M, pH 10). The reaction was terminated in step 9.8. After mixing the above mixture, centrifuged and filtered, the reactants and products (succinic acid) were analyzed by HPLC. The product of the reaction of L-glutamic acid catalyzed by M1 mutant after 24 h and the succinic acid standard (Aladdin, catalog number: S914342-1g) were verified by high resolution mass spectrometry (HRMS) using a mass spectrometer.

[0069] Among them, by Figure 3 and 4 As shown, the molecular ion peak ([M+H]+) of the product is 116.9892, which is consistent with the standard succinamide acid, confirming the product structure.

[0070] The product conversion rate is the ratio of the product molar concentration to the initial substrate molar concentration. Results are as follows: Figure 2 , Figure 5 and Figure 6 As shown, the experiment showed that the succinic acid conversion rate of wild-type GAD was 20%, indicating that GAD naturally has an oxidation side reaction pathway; compared with the parent enzyme GAD, the product conversion rates of mutants M1, M2, M3 and M4 were 75.7%, 65.3%, 77.4% and 66.9%, respectively.

[0071] Recombinant strains produce GABA through whole-cell catalytic production:

[0072] The parental enzymes and their mutants (M1, M2, M3, and M4) were induced through amplification, and the harvested bacterial cells were resuspended in 100 mL of purified water. Cell density OD 600 Adjust the temperature to 20 with water. Add 100 mL of the resuspended bacterial solution and 3 M sodium chloride to a 500 mL Erlenmeyer flask. LGABA was reacted in a conical flask with Glu and 0.1 mM pyridoxal phosphate powder at 37 °C and 180 rpm in a shaker. During the reaction, 100 μL of the reaction solution was added to 900 μL of NaHCO3 (0.2 M, pH 9.8) to terminate the reaction. The mixture was then thoroughly mixed, centrifuged, filtered, and the yield of GABA was determined by high-performance liquid chromatography (HPLC).

[0073] The product conversion rate is the ratio of the product molar concentration to the initial substrate molar concentration. Results are as follows: Figure 8 and Figure 9 As shown, the conversion rate of GABA product was 40.09% for the parent enzyme GAD, while the conversion rates of mutants M1, M2, M3, and M4 were all 0%.

[0074] As can be seen, the above data directly proves that the mutant completely blocks the GABA accumulation pathway; GABA, as an intermediate product, is rapidly oxidized to succinic acid (by enhanced side reactions), preventing accumulation. The schematic diagram of L-Glu decarboxylation to GABA and the further incomplete oxidation of GABA to succinic acid is shown below. Figure 7 As shown, in vitro and whole-cell data demonstrate that the conversion rates of the main reaction (GABA generation) and the side reaction (succinic acid generation) should logically be negatively correlated: that is, when the side reaction is enhanced, the main reaction should be weakened, resulting in a decrease in GABA generation and an increase in succinic acid generation.

Claims

1. A glutamate decarboxylase multisite combinatorial mutant, characterized in that, The glutamate decarboxylase multi-site combined mutant is obtained by multi-site combined mutation based on the amino acid sequence of SEQ ID NO. 2, and the mutation site of the glutamate decarboxylase multi-site combined mutant is any of the following: (1) Y165S / C168M / F304Y / Y308F; (2) Y165S / V167F / C168M / F304Y / Y308F; (3) C168M / F304Y / Y308F; (4) V167F / C168M / F304Y / Y308F.

2. A gene encoding the multisite combinatorial mutant of glutamate decarboxylase according to claim 1, wherein, The gene sequences of the glutamate decarboxylase multi-site combined mutants with the mutation sites of Y165S / C168M / F304Y / Y308F, Y165S / V167F / C168M / F304Y / Y308F, C168M / F304Y / Y308F and V167F / C168M / F304Y / Y308F are shown in SEQ ID NO. 3-6, respectively.

3. A recombinant expression plasmid comprising the gene of claim 2.

4. A genetically engineered bacterium comprising the recombinant expression plasmid of claim 3.

5. Use of the glutamate decarboxylase multi-site combined mutant of claim 1, the gene of claim 2, or the genetically engineered bacterium of claim 4 in catalyzing glutamic acid to produce succinamic acid.

6. A method for catalyzing the production of succinamic acid from glutamic acid, characterized by, Succinamic acid is obtained by using the glutamate decarboxylase multi-site combined mutant of claim 1 or the genetically engineered bacterium of claim 4 to catalyze the reaction with glutamic acid as the reaction substrate and pyridoxal phosphate as the coenzyme.

7. The method for catalyzing the production of succinic acid from glutamic acid as described in claim 6, characterized in that, In the catalytic reaction, the molar concentration of the glutamic acid is 100 mM, and the molar concentration of the pyridoxal phosphate is 0.1 mM.

8. The method for catalyzing the production of succinic acid from glutamic acid as described in claim 6, characterized in that, In the catalytic reaction, the temperature of the catalytic reaction is 37℃, and the time of the catalytic reaction is 40 min.

Images