InDel marker for distinguishing thickness of chili peel as well as primer and application of InDel marker

Abstract

The invention discloses an InDel marker for distinguishing the thickness of chili peel as well as a primer and application of the InDel marker. The chilli zunla-1 genome is used as a reference genome, the InDel marker is located at the position of a chromosome 1 Chr: 274748905, and the thick-skin chilli has base deletion of 45bp. The marker can distinguish three genotypes (thick skin homozygosis: 199bp; heterozygosis: 199 / 154 bp; and thin-skin homozygosis: 154bp), wherein the phenotype and the genotype are completely co-separated. According to the method, the target band is obtained through PCR amplification, the target band is identified through polypropylene gel electrophoresis, the operation is simple, and the identification efficiency is high. The primer provided by the invention is used for guiding early identification of breeding materials through marker typing and guiding selection of parent materials, and can be applied to purity identification of part of hybrids.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular breeding and relates to an InDel marker for distinguishing the thickness of pepper peel, a primer thereof and an application thereof. Background Art

[0002] Pepper (Capsicum annuum L.) is an important economic crop and vegetable variety in the world. The thickness of its peel directly affects the efficiency of post-harvest transportation, processing adaptability and market shelf life. Although thin-skinned varieties have a fresh and tender taste, they have poor mechanical resistance and are easily damaged during harvesting and transportation, resulting in a high loss rate. Thick-skinned varieties, on the other hand, are more suitable for mechanized harvesting and deep processing industry chains (such as chili powder and seasoning sauce production) due to their dense structure, and the market demand is increasing year by year. However, phenotypic screening for peel thickness in traditional breeding has a significant bottleneck: it relies on manual measurement of mature fruits, which takes several months to a year and is easily affected by environmental factors (such as temperature and moisture). The screening efficiency is low and the cost is high. Although molecular marker-assisted selection (MAS) technology can overcome this limitation, the current development of molecular markers for pepper peel thickness still has key shortcomings.

[0003] Peel thickness in peppers is a quantitative trait controlled by multiple genes and often regulated by multiple genetic loci. Therefore, identifying key genetic variants for molecular analysis of this trait is crucial. In recent years, significant progress has been made in breeding high-quality pepper varieties using ultra-thin-skinned peppers and thick-skinned sweet peppers as parents in the annual pepper (Capsicumannuum L.). Previous work on purity testing of pepper hybrids revealed that molecular markers for distinguishing thick-skinned and thin-skinned peppers are not universally applicable, necessitating the development and application of molecular markers linked to peel thickness.

[0004] In existing studies, molecular markers related to pepper peel thickness are mostly based on SSR (simple sequence repeats) or SNP (single nucleotide polymorphism) technology. For example, Zhang et al. (2021) identified three SNP sites related to peel thickness through genome-wide association analysis (GWAS), but their detection requires high-throughput sequencing or chip platforms, with high equipment barriers and a single sample cost of more than US$50, making it difficult to promote in grassroots breeding units. Although SSR markers have a low detection cost, the SSR abundance in the pepper genome is less than 2%, the development cycle is long (specific primers need to be designed), and the polymorphism is limited, making it difficult to cover the genetic variation of complex traits. In contrast, insertion-deletion (InDel) markers are considered a potential breakthrough in large-scale molecular breeding because of their advantages such as co-dominant inheritance, low detection cost (can be based on ordinary PCR and electrophoresis technology) and high polymorphism.

[0005] Indel markers are a molecular marker technology developed based on genomic insertion / deletion (Insertion-Deletion) variations. They can achieve rapid and accurate genotyping through specific PCR amplification combined with electrophoresis detection. Compared with other molecular markers, this technology has significant advantages such as simple operation, low cost, and high stability. It is especially suitable for early screening of important agronomic traits. However, the distribution characteristics of the InDel region in the pepper genome (accounting for about 1.5%-3%) and its functional association with peel thickness have not been systematically analyzed. At present, there is no Indel marker that can accurately identify the thickness of pepper peel. Summary of the Invention

[0006] The purpose of the present invention is to address the above-mentioned deficiencies in the prior art and to provide an InDel marker for distinguishing the thickness of pepper peel and its application.

[0007] Another object of the present invention is to provide the InDel-labeled primer and its application.

[0008] Another object of the present invention is to provide a method for distinguishing the thickness of pepper peel.

[0009] The purpose of the present invention can be achieved through the following technical solutions:

[0010] An InDel marker for distinguishing pepper peel thickness was developed, using the pepper Zunla 1 genome ((Qin et al., 2014), Whole-genome sequencing of cultivated and wild peppers provides insights into Capsicum domestication and specialization. Proc. Natl. Acad. Sci. USA. 111, 5135–5140) as the reference genome. The InDel marker is located at Chr: 274748905 on chromosome 1, and thick-skinned peppers have a 45 bp base deletion.

[0011] As a preferred embodiment of the present invention, the primers for the InDel marker are shown as SEQ ID NO.1 (TGCATGTCTTTTTCTCTTCA) and SEQ ID NO.2 (ATCCTCTTGCACTACGTGAT). Pepper genomic DNA is amplified using the primers shown in SEQ ID NO.1 and SEQ ID NO.2, and the target PCR product is detected by 8% polyacrylamide gel electrophoresis. If the obtained amplified product is a 154 bp band, it indicates that the 45 bp InDel marker is missing, and the pepper is thick-skinned; if the obtained amplified product is a 199 bp band, it indicates that the 45 bp InDel marker is not missing, and the pepper is thin-skinned; if both 154 bp and 199 bp bands are present, it indicates a heterozygote.

[0012] The InDel marker of the present invention is used to distinguish the thickness of pepper peel. Thick-skinned peppers are peppers with a peel thickness greater than 4.8 mm, and thin-skinned peppers are peppers with a peel thickness less than 3 mm.

[0013] The InDel-labeled primers of the present invention include an upstream primer as shown in SEQ ID NO.1 and a downstream primer as shown in SEQ ID NO.2.

[0014] The InDel-labeled primers of the present invention are used to distinguish the thickness of pepper peels. Thick-skinned peppers are peppers with a peel thickness greater than 4.8 mm, and thin-skinned peppers are peppers with a peel thickness less than 3 mm.

[0015] As a preferred embodiment of the present invention, pepper genomic DNA is amplified using the InDel-labeled primers, and the target PCR product is detected by 8% polyacrylamide gel electrophoresis. If the obtained amplified product is a 154 bp band, it indicates that the 45 bp InDel marker is missing, and the pepper is thick-skinned; if the obtained amplified product is a 199 bp band, it indicates that the 45 bp InDel marker is not missing, and the pepper is thin-skinned; if the 154 bp and 199 bp bands are present at the same time, it indicates a heterozygote.

[0016] The InDel-labeled primers are used in preparing a kit for distinguishing the thickness of pepper peels. Thick-skinned peppers are peppers with a peel thickness greater than 4.8 mm, and thin-skinned peppers are peppers with a peel thickness less than 3 mm.

[0017] As a preferred embodiment of the present invention, the kit further contains reagents for extracting sample DNA and other reagents for performing PCR.

[0018] A method for distinguishing the thickness of pepper peel comprises the following steps:

[0019] (1) Extracting genomic DNA from pepper leaves;

[0020] (2) PCR amplification of pepper genomic DNA using the InDel-labeled primers described in claim 4; (3) Detection of the target PCR product using 8% polyacrylamide gel electrophoresis. If a target band is present at 199 bp, it indicates that the pepper is thin-skinned; if a target band is present at 154 bp, it indicates that the pepper is thick-skinned; if both 154 bp and 199 bp bands are present, it indicates that the pepper is a hybrid.

[0021] As a preferred embodiment of the present invention, the PCR reaction system is: 10 μL 2×Taq Master Mix (Tsingke Biological Technology), 2 μL gDNA template, 0.5 μL (100 μmol / L) of upstream and downstream primers, and 7 μL ddH2O. After mixing, a 20 μL reaction system is obtained; the PCR reaction program is: pre-denaturation at 94°C for 5 minutes; then 35 cycles, including denaturation at 94°C for 20 seconds, annealing at 55°C for 30 seconds, and extension at 72°C for 40 seconds; and finally extension at 72°C for 7 minutes.

[0022] The technical route for the development of InDel markers of the present invention is as follows:

[0023] (1) Trait-gene association analysis: This project located the genes for pepper peel thickness based on the genetic map, obtained the key linkage QTL-qPT1.1, and discovered a genetic variation region containing a 45bp deletion within the interval.

[0024] (2) Linkage marker development: Design specific polymorphic primers for the target interval loci, establish a standardized PCR detection process, and complete marker accuracy verification;

[0025] (3) Industrial application: It can guide the early identification of breeding materials and the selection of parental materials through marker typing, and can also be applied to the purity identification of some hybrids.

[0026] Beneficial effects:

[0027] The present invention uses the zunla genome as the reference genome. The marker is located at Chr: 274748905 on chromosome 1, followed by a 45-bp sequence (ATAGTTGAATAACCAAATTGAGGAAATATAGGGCTTTCTTAACAA) in thin-skinned peppers. This marker can distinguish three genotypes (thick-skin homozygous: 199 bp; heterozygous: 199 / 154 bp; thin-skin homozygous: 154 bp), with complete cosegregation of phenotype and genotype.

[0028] The invention amplifies a target band by PCR and identifies the target band by using polypropylene gel electrophoresis, which has simple operation and high identification efficiency.

[0029] The present invention achieves accurate identification of pepper peel thickness in 120 pepper inbred line materials, and at the same time verifies the accuracy of the marker in 60 hybrids with thin-skinned and thick-skinned peppers as parents.

[0030] This study develops indel markers based on a 45-bp insertion / deletion site in thick-skinned and thin-skinned peppers, enabling accurate prediction of pericarp thickness in seedlings. Using the indel markers described in this study, standardized molecular marker identification protocols can be established for industrial applications. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 Polymorphic bands of 5 primer pairs in thick / thin skin materials Note: 1-24, 25-48, 49-72, 73-96, 97-120 correspond to the detection bands of primers pt14, pt27, pt33, pt49, pt50 in different materials. Among them, among the 24 samples detected by each primer pair, the first 10 samples are thin-skinned pepper inbred line materials, and the last 14 samples are thick-skinned pepper inbred line materials.

[0032] Figure 2 Polymorphic bands of primer pt27 in 120 pepper inbred lines Note: 1-30 and 62-91 are thin-skinned pepper materials, 31-61 and 92-120 are thick-skinned pepper materials

[0033] Figure 3 Polymorphic bands of primer pt27 in 60 F1 materials DETAILED DESCRIPTION

[0034] Example 1

[0035] 1. Test materials and peel thickness identification

[0036] Using thin-skinned pepper P1 (2.25mm) and thick-skinned pepper P2 (5.46mm) as parents, a self-pollinated population containing 469 strains was constructed. The test materials included 120 pepper germplasm resources and 60 F1 hybrids, which were planted at the Liuhe Animal and Plant Experimental Base of Jiangsu Academy of Agricultural Sciences in the spring of 2024. Six plants were planted for each material, and unified seedling transplanting and field management standards (temperature, humidity, fertilization, etc.) were adopted. During the green-ripe fruit stage, 6 paired pepper fruits of each material were selected, and the peel thickness was measured using a standard vernier caliper (3 random sites were measured for each fruit), and the average value was used as the peel thickness value of the material.

[0037] 2. Extraction of Genomic DNA

[0038] DNA was extracted from pepper leaves using the CTAB method (Muray et al., 1980). Specific steps: Grind fresh tissue into powder in liquid nitrogen, transfer to a 2 mL centrifuge tube, add 600 μL CTAB buffer, and place in a 65°C water bath for 30 to 60 minutes (shake several times during the period). Add an equal volume of chloroform / isoamyl alcohol (24:1), mix well, and centrifuge at 12,000 r / min for 10 minutes. Take the supernatant and repeat the extraction once, then take another 200 μL supernatant, add an equal volume of isopropanol to precipitate DNA, let it stand for 30 minutes, and then centrifuge. Rinse the precipitate twice with 75% ethanol, blow dry, and dissolve in 100 μL ddH2O to detect A 260 / A 280 The quality was verified by 1% agarose gel electrophoresis. Finally, the DNA was diluted to 100 ng / μL and stored at -20°C.

[0039] 3. Acquisition and Verification of InDel Molecular Markers

[0040] Marker development: Based on the resequencing data of parents and populations, polymorphic SNP markers were screened to construct a high-density genetic map. Combined with the QTL positioning results of pepper peel thickness in 2022-2023, a stable co-localization interval (301-341cM) was identified on chromosome 1. Within this interval, 20 InDel primers (insertion / deletion ≥ 28bp) were designed for the differential sites of the parents, and finally 5 pairs of polymorphic primers were screened out (Table 1). The accuracy of the primers was further verified using 10 thin-skinned and 14 thick-skinned pepper materials. It was found that only primer 27 was significantly associated with the peel thickness trait, and the other 4 primer pairs had no significant differences ( Figure 1 ).

[0041] Marker verification: To verify the reliability of the marker, 120 pepper samples (60 thin-skin samples, thickness <0.3 mm; 60 thick-skin samples, thickness >0.48 mm) were selected for testing. The results showed that the marker was co-segregated with the peel thickness ( Figure 2 In addition, 60 F1 hybrid combinations were constructed using 5 thin-skinned materials as female parents and 12 thick-skinned materials as male parents. Verification revealed that all combinations showed target bands at 199 bp and 154 bp ( Figure 3 The above results indicate that the InDel marker can be stably used in molecular marker-assisted breeding of pepper peel thickness.

[0042] Table 1 Information of 5 primer pairs with polymorphisms in both parents

[0043]

Claims

1. An InDel marker for distinguishing pepper peel thickness, characterized in that: Taking the pepper Zunla 1 genome as the reference genome, the InDel marker is located at Chr: 274748905 on chromosome 1, and there is a 45bp base deletion in thick-skinned pepper.

2. The InDel marker according to claim 1, characterized in that The primers for the InDel marker are shown in SEQ ID NO. 1 and SEQ ID NO.

2. Genomic DNA of annual pepper is amplified using the primers shown in SEQ ID NO. 1 and SEQ ID NO. 2, and the target PCR product is detected by 8% polyacrylamide gel electrophoresis. If the obtained amplified product is a 154 bp band, it indicates that the 45 bp InDel marker of claim 1 is missing, and the pepper is thick-skinned; if the obtained amplified product is a 199 bp band, it indicates that the 45 bp InDel marker of claim 1 is not missing, and the pepper is thin-skinned; if both the 154 bp and 199 bp bands are present, it indicates a hybrid.

3. Use of the InDel marker according to claim 1 or 2 in distinguishing the thickness of pepper peel, wherein thick-skinned peppers are peppers with a peel thickness greater than 4.8 mm, and thin-skinned peppers are peppers with a peel thickness less than 3 mm.

4. The InDel-labeled primer according to claim 1, characterized in that The upstream primer is shown as SEQ ID NO.1, and the downstream primer is shown as SEQ ID NO.

2.

5. Use of the InDel-labeled primers according to claim 4 in distinguishing the thickness of pepper peel, wherein thick-skinned peppers are peppers with a peel thickness greater than 4.8 mm, and thin-skinned peppers are peppers with a peel thickness less than 3 mm.

6. The use according to claim 5, characterized in that Pepper genomic DNA is amplified using the primers for the InDel marker described in claim 4, and the target PCR product is detected by 8% polyacrylamide gel electrophoresis. If the obtained amplified product is a 154 bp band, it indicates that the 45 bp InDel marker described in claim 1 is missing, and the pepper is thick-skinned; if the obtained amplified product is a 199 bp band, it indicates that the 45 bp InDel marker described in claim 1 is not missing, and the pepper is thin-skinned; if both the 154 bp and 199 bp bands are present, it indicates a hybrid.

7. Use of the InDel-labeled primers according to claim 4 in preparing a kit for distinguishing the thickness of pepper peel, wherein thick-skinned peppers are peppers with a peel thickness greater than 4.8 mm, and thin-skinned peppers are peppers with a peel thickness less than 3 mm.

8. The use according to claim 7, characterized in that The kit also contains reagents for extracting sample DNA and other reagents for performing PCR.

9. A method for distinguishing the thickness of pepper peel, characterized in that: The following steps are involved: (1) Extracting genomic DNA from pepper leaves; (2) performing PCR amplification on pepper genomic DNA using the InDel-labeled primers described in claim 4; (3) The target PCR product was detected by 8% polyacrylamide gel electrophoresis. If there was a target band at 199 bp, it indicated that it was a thin-skinned pepper. If there was a target band at 145 bp, it indicated that it was a thick-skinned pepper. If both 154 bp and 199 bp bands existed, it indicated that it was a hybrid.

10. The method according to claim 9, characterized in that The PCR reaction system consisted of 10 μL 2× Taq MasterMix (Tsingke Biological Technology), 2 μL gDNA template, 0.5 μL (100 μmol / L) of each upstream and downstream primer, and 7 μL ddH2O. A 20 μL reaction system was obtained after mixing the above. The PCR reaction procedure was as follows: initial denaturation at 94°C for 5 min; then 35 cycles of denaturation at 94°C for 20 s, annealing at 55°C for 30 s, and extension at 72°C for 40 s; and a final extension at 72°C for 7 min.

Images