Mutant and genetically engineered bacterium thereof for catalytic synthesis of D-chiro-inositol

Abstract

The invention discloses a mutant and a genetically engineered bacterium for catalytic synthesis of D-chiral inositol by using the mutant, and relates to the technical field of biology, inositol dehydrogenase is subjected to site-directed saturation mutagenesis at N154 and C269 sites and then is subjected to combined mutagenesis at M123, V157, A171 and Y277 to obtain the inositol dehydrogenase mutant, so that a conversion reaction is carried out in a forward direction, and the conversion rate of D-chiral inositol is greatly improved.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a mutant and a genetically engineered bacterium for catalyzing the synthesis of D-chiro-inositol. Background Art

[0002] D-chiro-inositol (DCI) is an isomer of myo-inositol (MI) found primarily in nature, such as buckwheat and legumes. D-chiro-inositol has numerous physiological functions and can be used to treat conditions such as type 2 diabetes, polycystic ovary syndrome, and inhibit liver fibrosis. It is also used as a health supplement ingredient and dietary supplement. Currently, multiple brands of D-chiro-inositol health supplements are available in the United States, demonstrating broad market prospects.

[0003] Currently, D-chiro-inositol is typically produced through plant extraction, chemical synthesis, or hydrolysis of kasugamycin. Plant-derived D-chiro-inositol is typically extracted from plants such as buckwheat and carob. However, due to the low content of D-chiro-inositol in these plants, the cost of separation and extraction is high. Chemical synthesis of D-chiro-inositol is complex, by-products are difficult to separate, and residual organic solvents are unavoidable, affecting product quality. Large amounts of organic solvents are required, which is environmentally unfriendly. Furthermore, D-chiro-inositol can be produced by hydrolyzing D-pinitol or kasugamycin, but these raw materials are expensive, making them uneconomical. At present, the biotransformation method will become the most promising route for the preparation of D-chiro-inositol due to its advantages such as mildness, safety and environmental protection. However, the current biotransformation route converts inositol into scyllo-inositol (2KMI) through inositol dehydrogenase (ioIG), then converts scyllo-inositol into 1-keto-chiro-inositol (1KDCI) through ketoisomerase (ioII), and finally converts 1-keto-chiro-inositol into D-chiro-inositol through inositol dehydrogenase (ioIG). Since the two-enzyme three-step conversion reaction is reversible, the conversion rate of D-chiro-inositol is low. Summary of the Invention

[0004] The first technical problem to be solved by the present invention is: to address the deficiencies in the prior art and provide a mutant that allows the reaction to proceed in the forward direction, thereby increasing the conversion rate of D-chiro-inositol.

[0005] In order to solve the above-mentioned first technical problem, the technical solution of the present invention is:

[0006] A mutant, which is obtained by site-directed saturation mutation of inositol dehydrogenase at N154 and C269 sites and then combined mutation at M123, V157, A171 and Y277, specifically, on the basis of replacing the 154th asparagine in the amino acid sequence with alanine and the 269th cysteine with serine, combined mutation is made, and the mutation sequence is as follows:

[0007] (1) the 123rd methionine in the amino acid sequence is replaced with alanine;

[0008] (2) the 157th valine in the amino acid sequence is replaced with serine;

[0009] (3) the 157th valine in the amino acid sequence is replaced with alanine;

[0010] (4) the 171st alanine in the amino acid sequence is replaced with tyrosine;

[0011] (5) the 277th tyrosine in the amino acid sequence is replaced with alanine;

[0012] (6) the 157th valine in the amino acid sequence is replaced with alanine, and the 171st alanine is replaced with tyrosine. The nucleotide sequence of the inositol dehydrogenase is shown in SEQ ID NO. 1, and the amino acid sequence is shown in SEQ ID NO. 2.

[0013] The inositol dehydrogenase (ioIG) gene sequence is derived from Clostridium sp. and artificially synthesized (synthesized by Nanjing Kingsrui Biotechnology Co., Ltd.). SEQ ID NO. 1 is:

[0014] atgctaaatg taggagttat agggtgtggt ggcatgggta aggaccacat taagcgcttgaccgaaaaga tccagggcgc tcaagtggtg gcagttagcg atgtgtttga agagtcggcgaaacaggccgcggcaatctg cggtgccaaa gtatacaccg acgctaatgc gcttatcaacgattccaacg ttgacgcggtcttcatcgtg agcccgggtt tcgcccacgt ggactctctg ttggaagcga ttaaggctgg caagcgcattttctgcgaga aaccactgtg tactacggct gaggattgtc tgaaagttgt tgaggccgag gtgaaagcaggcaagcacct gattcaactg ggtttcatgc gccgttacga caaaggctac atgcaggtta aagaagcgttgatctccggt gagtatggtg aaccgctgat gttacactgc acccatcgtg caccggaagt gggtacaaattataacaccc cgatggcagt gcacgatacg gcgatccatg agattgatgt tctgcattgg ctggtggacgatgaatatga gagcgcacaa gtgatcctgc cgaaggtcac caagtacagc catagcgaat tgaaggaccctcagattatg ctgctccgta ccaaaaaagg tgtttgcatt gatgtcgagg tttttgtgaa ttgcaaattcggctacgaca tcaactgcga ggtggtttgt gaggacggcgcgatcaagat gccgagcccg atttacccgtctatccgtaa aaacgcggcg gtggctacga ccatcgacac cgatagcttt gttcgtttta aagacgcgtatgacgcagaa gtccaggcgtgggttgacga tgcggcgcag ggcgttatta acggtccgaa tgcgtgggatggctacctgg cggccatcaccgcagatgcg ctggttaagg cgcaacaaac cggtggtatt gaaaccatcaaggcggctgt agagaagccg gaattttata aa

[0015] SEQ ID NO. 2 is:

[0016] Met Leu Asn Val Gly Val Ile Gly Cys Gly Gly Met Gly Lys Asp

[0017] His Ile Lys Arg Leu Thr Glu Lys Ile Gln Gly Ala Gln Val Val

[0018] Ala Val Ser Asp Val Phe Glu Glu Ser Ala Lys Gln Ala Ala Ala

[0019] Ile Cys Gly Ala Lys Val Tyr Thr Asp Ala Asn Ala Leu Ile Asn

[0020] Asp Ser Asn Val Asp Ala Val Phe Ile Val Ser Pro Gly Phe Ala

[0021] His Val Asp Ser Leu Leu Glu Ala Ile Lys Ala Gly Lys Arg Ile

[0022] Phe Cys Glu Lys Pro Leu Cys Thr Thr Ala Glu Asp Cys Leu Lys

[0023] Val Val Glu Ala Glu Val Lys Ala Gly Lys His Leu Ile Gln Leu

[0024] Gly Phe Met Arg Arg Tyr Asp Lys Gly Tyr Met Gln Val Lys Glu

[0025] Ala Leu Ile Ser Gly Glu Tyr Gly Glu Pro Leu Met Leu His Cys

[0026] Thr His Arg Ala Pro Glu Val Gly Thr Asn Tyr Asn Thr Pro Met

[0027] Ala Val His Asp Thr Ala Ile His Glu Ile Asp Val Leu His Trp

[0028] Leu Val Asp Asp Glu Tyr Glu Ser Ala Gln Val Ile Leu Pro Lys

[0029] Val Thr Lys Tyr Ser His Ser Glu Leu Lys Asp Pro Gln Ile Met

[0030] Leu Leu Arg Thr Lys Lys Gly Val Cys Ile Asp Val Glu Val Phe

[0031] Val Asn Cys Lys Phe Gly Tyr Asp Ile Asn Cys Glu Val Val Cys

[0032] Glu Asp Gly Ala Ile Lys Met Pro Ser Pro Ile Tyr Pro Ser Ile

[0033] Arg Lys Asn Ala Ala Val Ala Thr Thr Ile Asp Thr Asp Ser Phe

[0034] Val Arg Phe Lys Asp Ala Tyr Asp Ala Glu Val Gln Ala Trp Val

[0035] Asp Asp Ala Ala Gln Gly Val Ile Asn Gly Pro Asn Ala Trp Asp

[0036] Gly Tyr Leu Ala Ala Ile Thr Ala Asp Ala Leu Val Lys Ala Gln

[0037] Gln Thr Gly Gly lie Glu Thr lie Lys Ala Ala Val Glu Lys Pro

[0038] Glu Phe Tyr Lys

[0039] Preferably, the method for preparing the mutant comprises the following steps:

[0040] S1. Primer

[0041]

[0042] S2. Inositol dehydrogenase is cloned into vector pet28a by BamHI / SpeI, and pet28a-ioIG is obtained;

[0043] S3. N154A is used as primer, pet28a-ioIG is used as template, N154A mutant plasmid is obtained by mutation PCR, DpnI digestion of template, chemical transformation of cloning strain and screening of positive clones of cloning strain;

[0044] S4. C269S is used as primer, N154A mutant plasmid is used as template, N154A / C269S mutant plasmid is obtained by mutation PCR, DpnI digestion of template, chemical transformation of cloning strain and screening of positive clones of cloning strain;

[0045] S5. M123A, V157S, V157A, A171Y and Y277A are used as primers respectively, N154A / C269S mutant plasmid is used as template, and M123A / N154A / C269S mutant, N154A / V157S / C269S mutant, N154A / V157A / C269S mutant, N154A / A171Y / C269S mutant and N154A / C269S / Y277A mutant are obtained respectively by mutation PCR, DpnI digestion of template, chemical transformation of cloning strain and screening of positive clones of cloning strain;

[0046] A171Y is used as primer, N154A / V157A / C269S mutant is used as template, N154A / V157A / A171Y / C269S mutant is obtained by mutation PCR, DpnI digestion of template, chemical transformation of cloning strain and screening of positive clones of cloning strain.

[0047] Preferably, the mutation PCR system and procedure are as follows:

[0048] 5× Phusion HF buffer 2 μL, dNTP (2.5 mmol / L) 0.8 μL, DNA template 0.2 μL, F / R 0.3 μL each, DMSO 0.3 μL, Phu high-fidelity DNA polymerase (2 U / μl) 0.1 μL, ddH2O 6 μL, total volume 10 μL;

[0049] Pre-denaturation: denaturation at 98°C for 3 min; amplification cycle: denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 4.5 min, 32 cycles; finishing: extension at 72°C for 10 min.

[0050] Preferably, the DpnI digestion template system and reaction conditions are:

[0051] 10× buffer 1 μL, DNA PCR product 8 μL, DpnI 1 μL; 37°C, 1 h.

[0052] Preferably, the cloning strain is chemically transformed:

[0053] After the PCR product was digested with DpnI at 37°C for 1 h, 10 μL was added to competent Escherichia coli DH 5α, incubated on ice for 30 min, heat-shocked in a 42°C water bath for 90 s, and placed on ice for 5 min;

[0054] Add 600 μL LB liquid culture medium and spread it on an LB (Kan 50 μg / mL) plate until the bacterial liquid is completely absorbed. Invert the plate and culture at 37°C for 12 to 16 hours until corresponding colonies are visible.

[0055] The second technical problem to be solved by the present invention is: to address the deficiencies in the existing technology, to provide a method for preparing a genetically engineered bacterium that catalyzes the synthesis of D-chiro-inositol, which is applied to the conversion of D-chiro-inositol and improves the conversion rate of the product.

[0056] In order to solve the above second technical problem, the technical solution of the present invention is:

[0057] The invention discloses a method for preparing a genetically engineered bacterium capable of catalyzing the synthesis of D-chiro-inositol. The method comprises the following steps: adding a mutant to a competent Escherichia coli BL21 (DE3), placing the mutant on ice for 30 minutes, heat-shocking the mutant in a 42°C water bath for 90 seconds, and allowing the mutant to stand on ice for 5 minutes. 600 μL of LB liquid culture medium is added and the mutant is spread on an LB (Kan 50 μg / mL) plate until the bacterial liquid is completely absorbed. The plate is then inverted and cultured at 37°C for 12 to 16 hours to obtain a genetically engineered bacterium capable of catalyzing the synthesis of D-chiro-inositol.

[0058] The third technical problem to be solved by the present invention is: to address the deficiencies in the prior art and to provide a method for converting D-chiro-inositol, which has a high conversion rate of D-chiro-inositol.

[0059] To solve the third technical problem, the technical solution of the present application is:

[0060] A method for converting D-chiro-inositol, comprising the following steps:

[0061] A multi-enzyme reaction system is constructed by adding a genetically engineered bacteria enzyme solution for catalytically synthesizing D-chiro-inositol, an inosose isomerase, an NADH oxidase, and a formate dehydrogenase to myo-inositol as a substrate, and D-chiro-inositol is obtained by reaction.

[0062] Preferably, the preparation step of the conversion enzyme solution is:

[0063] A single colony of the genetically engineered bacteria for catalytically synthesizing D-chiro-inositol is selected and cultured in 4 mL of LB test tube (Kan 50 μg / mL) at 37°C and 200 rpm for 10-12 h, the seed solution is transferred to a flask containing 50 mL of TB medium (Kan 50 μg / mL) at a seeding amount of 1%, and the flask is cultured at 37°C and 200 rpm until the OD600 of the bacterial solution is 0.6-0.8, then 0.2 mM of IPTG is added, and the flask is induced at 16°C and 200 rpm for 20 h to express the target protein, and the fermentation bacteria are obtained; wherein the composition of the LB medium (1 L) is: yeast extract 5 g, peptone 10 g, and sodium chloride 10 g, and the composition of the TB medium (1 L) is: yeast extract 24 g, peptone 12 g, sodium chloride 10 g, dipotassium hydrogen phosphate 12.54 g, potassium dihydrogen phosphate 2.31 g, and glycerol 5 mL, and the medium is sterilized by high-pressure steam at 121°C for 20 min.

[0064] The fermentation bacteria are centrifuged, the fermentation solution is removed, and the bacteria are resuspended in 50 mM of HEPES buffer to obtain a bacterial concentration of 180-200 OD 600 , and the enzyme solution is obtained by homogenization, centrifugation, and purification.

[0065] Preferably, the conversion system is: 0.5 mL of reaction system containing 50 mM of HEPES buffer (pH 9.0), 2 mg / mL of inositol dehydrogenase, 1 mg / mL of NADH oxidase, 9 g / L of myo-inositol, and 0.5 mM of NAD + , and the catalytic reaction is carried out at 25°C for 8 h.

[0066] After the reaction is completed, the reaction solution is incubated at 90°C for 15 min, denatured proteins are removed by centrifugation, the pH of the reaction solution is adjusted to 7.5 by adding HCl, 222 μL of the reaction solution after pH adjustment is taken, 4 mg / mL of inosose isomerase is added and reacted for 1 h, and then 0.1 mM of NAD +A 2-mg / mL solution of genetically engineered bacterial enzyme for catalyzing the synthesis of D-chiro-inositol was prepared using 1 mg / mL formate dehydrogenase, 150 mM sodium formate, and 2 mg / mL of the enzyme. This solution was made up to 0.5 mL with 50 mM HEPES buffer (pH 7.5). The reaction was carried out at 25°C, 800 rpm, and a reaction time of 2 hours. After completion of the reaction, the reaction solution was incubated at 90°C for 15 minutes, centrifuged to remove denatured proteins, and filtered through an aqueous filter to obtain the D-chiro-inositol conversion solution.

[0067] Due to the adoption of the above technical solution, the beneficial effects of the present invention are:

[0068] 1. Mutation modification was performed on the reversible inositol dehydrogenase (ioIG). Site prediction was performed using AlphaFold, and the predicted key sites were M123, N154, V157, A171, C269, and Y277. Preliminary screening was performed through site-directed saturation mutagenesis, and the sites N154A and C269S were first identified. On this basis, combined mutations were performed on the sites M123A, V157S, V157A, A171Y, and Y277A that were screened to have positive catalytic effects. Compared with the first-generation mutant N154A / C269S, the M123A / N154A / C269S mutant, N154A / V157S / C269S mutant, N154A / V157A / C269S mutant, N154A / A171Y / C269S mutant, N154A / C269S / Y277A mutant and N154A / V157A / A171Y / C269S mutant increased the D-chiro-inositol conversion rate by 65.0%, 51.3%, 52.5%, 51.3%, 81.3% and 50.0%, respectively.

[0069] 2. Through directed evolution, the inositol dehydrogenase mutation was made to proceed in the forward direction, and the conversion rate was greatly improved. DETAILED DESCRIPTION

[0070] The present invention will be further described below with reference to the embodiments.

[0071] Example 1

[0072] S1. Mutation primers

[0073] Inositol dehydrogenase mutation primers

[0074]

[0075] S2. Mutation PCR system and procedure: 5× Phusion HF buffer 2μL, dNTP (2.5mmol / L) 0.8μL, DNA template 0.2μL, F / R 0.3μL each, DMSO 0.3μL, Phu high-fidelity DNA polymerase (2U / μl) 0.1μL, ddH2O 6μL, total volume 10μL; pre-denaturation: denaturation at 98°C for 3 min; amplification cycle: denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 4.5 min, 32 cycles; fill-in: extension at 72°C for 10 min.

[0076] S3. DpnI digestion template system (10 μL) and reaction conditions

[0077] 10× buffer 1 μL, DNA PCR product 8 μL, DpnI 1 μL; 37°C, 1 h.

[0078] S4. Chemical transformation of clonal strains

[0079] After digesting the template plasmid with DpnI at 37°C for 1 hour, 10 μL of the PCR product was added to competent E. coli DH5α cells. The cells were incubated on ice for 30 minutes, heat-shocked in a 42°C water bath for 90 seconds, and allowed to stand on ice for 5 minutes. Add 600 μL of LB liquid medium and spread onto LB plates (Kan 50 μg / mL) until the bacterial solution was completely absorbed. Invert the plates and incubate at 37°C for 12–16 hours until colonies were visible.

[0080] S5. Screening of positive clones of clonal strains: Extract plasmids and send them to BGI for sequencing verification.

[0081] S6. Obtaining mutant and combination mutant plasmids

[0082] Inositol dehydrogenase was cloned into the pet28a vector via BamHI / SpeI to generate pet28a-ioIG;

[0083] N154A: Using N154A primers and pet28a-ioIG as a template, the N154A mutant plasmid was obtained through steps S2 to S5, which is plasmid 1;

[0084] N154A / C269S: Using C269S primers and plasmid 1 as a template, the N154A / C269S mutant plasmid was obtained through steps S2 to S5, which is plasmid 2;

[0085] M123A / N154A / C269S: Using M123A primers and plasmid 2 as a template, the M123A / N154A / C269S mutant plasmid was obtained through steps S2 to S5, which is plasmid 3;

[0086] N154A / V157S / C269S: Using the V157S primer and plasmid 2 as a template, the N154A / V157S / C269S mutant plasmid was obtained through steps S2 to S5, which is plasmid 4;

[0087] N154A / V157A / C269S: Using the V157A primer and plasmid 2 as a template, the N154A / V157A / C269S mutant plasmid was obtained through steps S2 to S5, which is plasmid 5;

[0088] N154A / A171Y / C269S: Using A171Y primers and plasmid 2 as a template, the N154A / A171Y / C269S mutant plasmid was obtained through steps S2 to S5, which is plasmid 6;

[0089] N154A / C269S / Y277A: Using Y277A primers and plasmid 2 as a template, the N154A / C269S / Y277A mutant plasmid was obtained through steps S2 to S5, which is plasmid 7;

[0090] N154A / V157A / A171Y / C269S: Using the A171Y primer and plasmid 5 as a template, the N154A / V157A / A171Y / C269S mutant plasmid was obtained through steps S2 to S5, which is plasmid 8.

[0091] S7. Preparation of expression strain

[0092] Add 1 μL of plasmids 2-8 to competent E. coli BL21(DE3) cells, incubate on ice for 30 minutes, heat shock the cells in a 42°C water bath for 90 seconds, and then place on ice for 5 minutes. Add 600 μL of LB liquid medium and spread the solution onto an LB plate (Kan 50 μg / mL) until the bacterial solution is completely absorbed. Invert the plate and incubate at 37°C for 12-16 hours until corresponding colonies become visible. Successfully transformed strains were designated M0, M1, M2, M3, M4, M5, and M6 and stored at -80°C.

[0093] S8. Fermentation enzyme production

[0094] LB medium (1 L): 5 g yeast extract, 10 g peptone, and 10 g sodium chloride.

[0095] TB medium (1 L): 24 g yeast extract, 12 g peptone, 10 g sodium chloride, 12.54 g dipotassium hydrogen phosphate, 2.31 g potassium dihydrogen phosphate, 5 mL glycerol, sterilize by high-pressure steam at 121°C for 20 min.

[0096] Induce expression: Pick a single colony into a 4 mL LB tube (Kan 50 μg / mL) and culture at 37°C, 200 rpm for 10-12 h. Transfer the seed solution to a shake flask containing 50 mL TB medium (Kan 50 μg / mL) at a 1% inoculum volume and culture at 37°C, 200 rpm until the bacterial solution OD reaches 0. 600 =0.6-0.8, add IPTG with a final concentration of 0.2 mM, and induce at 16°C and 200 rpm for 20 h to express the target protein.

[0097] S9. D-chiro-inositol conversion

[0098] Myo-inositol is used as a substrate, and an inositol dehydrogenase, a genetically engineered bacterial enzyme solution for catalyzing the synthesis of D-chiro-inositol, inositol monoketone isomerase, NADH oxidase, and formate dehydrogenase are added to construct a multi-enzyme reaction system to obtain D-chiro-inositol. The inositol dehydrogenase is derived from Clostridium sp. and has a Uniprot number of N1ZPH0; the inositol monoketone isomerase is derived from Geobacillus kaustophilus and has a Uniprot number of Q5KYQ9; the NADH oxidase is derived from Streptococcus mutans and has a Uniprot number of I6L920; and the formate dehydrogenase is derived from Candidaboidinii and has a Uniprot number of O13437.

[0099] Enzyme solution preparation: After fermentation and enzyme production, the M0, M1, M2, M3, M4, M5, and M6 bacteria were collected by centrifugation, the fermentation liquid was removed, and the bacteria were resuspended in 50mM HEPES buffer to a bacterial concentration of 180-200OD 600 After homogenization, centrifugation and purification, a genetically engineered bacterial enzyme solution for catalyzing the synthesis of D-chiro-inositol was obtained.

[0100] Conversion system: 0.5 mL reaction system contains 50 mM HEPES buffer (pH 9.0), 2 mg / mL inositol dehydrogenase, 1 mg / mL NADH oxidase, 9 g / L myo-inositol, 0.5 mM NAD + The catalytic reaction was carried out at 25°C for 8 hours. After the reaction, the reaction solution was incubated at 90°C for 15 minutes and then centrifuged to remove denatured proteins. The pH of the reaction solution was adjusted to 7.5 with HCl. 222 μL of the pH-adjusted reaction solution (2KMI≈20 mM) was taken and first added with 4 mg / mL inositol monoketone isomerase for 1 hour, and then 0.1 mM NAD was added. +, 1 mg / mL formate dehydrogenase, 150 mM sodium formate, 2 mg / mL enzyme solution of genetically engineered bacteria catalyzing synthesis of D-chiro-inositol (M0-M6), supplemented with 50 mM HEPES buffer (pH 7.5) to 0.5 mL, and subjected to catalytic reaction at 25°C, 800 rpm, for 2 h. After the reaction, the reaction solution was incubated at 90°C for 15 min, centrifuged to remove denatured proteins, filtered through a water phase membrane, and subjected to HPLC to detect the product concentration, and the space-time yield was calculated as shown in Table 1.

[0101] Table 1: Space-time yield of DCI synthesized by different inositol dehydrogenase mutants

[0102]

[0103]

[0104] It should be understood that these examples are merely illustrative of the present application and do not limit the scope of the present application. Furthermore, it should be understood that various modifications and changes can be suggested to those skilled in the art, and it is intended that the present application encompass such modifications or changes as fall within the scope of the appended claims.

Claims

1. A mutant, characterized in that: The mutant is obtained by subjecting inositol dehydrogenase to site-directed saturation mutagenesis at N154 and C269 and then subjecting it to combined mutagenesis at M123, V157, A171 and Y277. The nucleotide sequence of the inositol dehydrogenase is shown in SEQ ID NO.1, and the amino acid sequence is shown in SEQ ID NO.

2.

2. The method for preparing a mutant according to claim 1, wherein: The following steps are involved: S1. Primers S2. Inositol dehydrogenase was cloned into the pet28a vector using BamHI / SpeI to generate pet28a-ioIG. S3. Using N154A as primer and pet28a-ioIG as template, the N154A mutant plasmid was obtained by mutation PCR, DpnI digestion of the template, chemical transformation of the cloning strain, and screening of positive clones of the cloning strain; S4. Using C269S as primer and N154A mutant plasmid as template, the N154A / C269S mutant plasmid was obtained by mutation PCR, DpnI digestion of the template, chemical transformation of the cloning strain, and screening of positive clones of the cloning strain; S5. Using M123A, V157S, V157A, A171Y, and Y277A as primers, and the N154A / C269S mutant plasmid as a template, the M123A / N154A / C269S mutant, N154A / V157S / C269S mutant, N154A / V157A / C269S mutant, N154A / A171Y / C269S mutant, and N154A / C269S / Y277A mutant were obtained by mutation PCR, template digestion with DpnI, chemical transformation of the cloning strain, and screening of positive clones. Using A171Y as primer and N154A / V157A / C269S mutant as template, the N154A / V157A / A171Y / C269S mutant was obtained by mutating PCR, digesting the template with DpnI, chemically transforming the cloning strain, and screening the positive clones of the cloning strain.

3. The method for preparing a mutant according to claim 2, wherein: The mutation PCR system and procedure are as follows: 5× Phusion HF buffer 2 μL, dNTP (2.5 mmol / L) 0.8 μL, DNA template 0.2 μL, F / R 0.3 μL each, DMSO 0.3 μL, Phu high-fidelity DNA polymerase (2 U / μl) 0.1 μL, ddH2O 6 μL, total volume 10 μL; Pre-denaturation: denaturation at 98°C for 3 min; amplification cycle: denaturation at 98°C for 10 s, annealing at 55°C for 30 s, extension at 72°C for 4.5 min, 32 cycles; finishing: extension at 72°C for 10 min.

4. The method for preparing a mutant according to claim 2, wherein: DpnI digestion template system and reaction conditions: 1 μL 10× buffer, 8 μL DNA PCR product, 1 μL DpnI; 37°C, 1 h.

5. The method for preparing a mutant according to claim 2, wherein: Chemical transformation of cloning strains: After the PCR product was digested with DpnI at 37°C for 1 h, 10 μL was added to competent Escherichia coli DH 5α, incubated on ice for 30 min, heat-shocked in a 42°C water bath for 90 s, and placed on ice for 5 min; Add 600 μL LB liquid culture medium and spread it on an LB (Kan 50 μg / mL) plate until the bacterial liquid is completely absorbed. Invert the plate and culture at 37°C for 12 to 16 hours until corresponding colonies are visible.

6. A method for preparing a genetically engineered bacterium that catalyzes the synthesis of D-chiro-inositol, characterized in that: The mutant of any one of claims 1 to 5 is added to the competent Escherichia coli BL21 (DE3), ice-bathed for 30 minutes, heat-shocked in a 42° C. water bath for 90 seconds, and allowed to stand on ice for 5 minutes. 600 μL of LB liquid medium is added and spread on an LB (Kan 50 μg / mL) plate until the bacterial liquid is completely absorbed. The plate is inverted and cultured at 37° C. for 12 to 16 hours to obtain a genetically engineered bacterium that catalyzes the synthesis of D-chiro-inositol.

7. A method for converting D-chiro-inositol, characterized in that: The following steps are involved: Myo-inositol is used as a substrate, and the genetically engineered bacterial enzyme solution for catalyzing the synthesis of D-chiro-inositol according to claim 6, inositol monoketone isomerase, NADH oxidase, and formate dehydrogenase are added to construct a multi-enzyme reaction system to react and obtain D-chiro-inositol.

8. A method for converting D-chiro-inositol as claimed in claim 7, characterized in that, The preparation steps of the invertase solution are: Select a single colony of genetically engineered bacteria that catalyzes the synthesis of D-chiro-inositol and place it in a 4 mL LB tube (Kan 50 μg / mL) and culture it at 37°C and 200 rpm for 10-12 h. Transfer the seed solution to a 50 mL tube containing 1% inoculum. The cells were cultured in a shake flask containing TB medium (Kan 50 μg / mL) at 37°C and 200 rpm until the OD600 of the culture solution reached 0.6-0.

8. IPTG was added to a final concentration of 0.2 mM and induced at 16°C and 200 rpm for 20 h to express the target protein, thereby obtaining fermented bacteria. LB medium (1 L) contained 5 g of yeast extract, 10 g of peptone, and 10 g of sodium chloride. TB medium (1 L) contained 24 g of yeast extract, 12 g of peptone, 10 g of sodium chloride, 12.54 g of dipotassium hydrogen phosphate, 2.31 g of potassium dihydrogen phosphate, and 5 mL of glycerol. The cells were sterilized by high-pressure steam at 121°C for 20 min. The fermented bacteria were centrifuged, the fermentation liquid was removed, and the bacteria were resuspended in 50 mM HEPES buffer to a bacterial concentration of 180-200 OD 600 After homogenization, centrifugation and purification, a genetically engineered bacterial enzyme solution for catalyzing the synthesis of D-chiro-inositol was obtained.

9. A method for converting D-chiro-inositol as claimed in claim 7, characterized in that, The conversion system is as follows: 0.5 mL reaction system contains 50 mM HEPES buffer (pH 9.0), 2 mg / mL inositol dehydrogenase, 1 mg / mL NADH oxidase, 9 g / L myo-inositol, 0.5 mM NAD + , the catalytic reaction was carried out at 25 ° C, and the reaction time was 8 h; After the reaction, the reaction solution was incubated at 90°C for 15 min, centrifuged to remove denatured proteins, and the pH of the reaction solution was adjusted to 7.5 with HCl. 222 μL of the reaction solution after pH adjustment was taken, 4 mg / mL inositol monoketone isomerase was added, and the reaction was allowed to proceed for 1 h, followed by the addition of 0.1 mM NAD. + A 2-mg / mL solution of genetically engineered bacterial enzyme for catalyzing the synthesis of D-chiro-inositol was prepared using 1 mg / mL formate dehydrogenase, 150 mM sodium formate, and 2 mg / mL of the enzyme. This solution was made up to 0.5 mL with 50 mM HEPES buffer (pH 7.5). The reaction was carried out at 25°C, 800 rpm, and a reaction time of 2 hours. After completion of the reaction, the reaction solution was incubated at 90°C for 15 minutes, centrifuged to remove denatured proteins, and filtered through an aqueous filter to obtain the D-chiro-inositol conversion solution.

Images