Cosmetic composition, preparation method and application of cosmetic composition in anti-aging and anti-wrinkle skin

Abstract

The invention relates to the technical field of cosmetics, and discloses a cosmetic composition, a preparation method and application of the cosmetic composition in anti-aging and anti-wrinkle skin. The preparation method comprises the following steps: expressing SKAP2 protein through prokaryote escherichia coli, extracting milk exosome, wrapping the SKAP2 protein into the milk exosome, and mixing the milk exosome containing the SKAP2 protein with trehalose dihydrate, water and CMC (Carboxymethyl Cellulose) to prepare a hydrogel preparation which can be used as a cosmetic composition applied to gel coating agents, masks, toner and dry powder patches. The anti-wrinkle effect is achieved by inhibiting the activity of matrix metalloproteinase 1 (MMP1).

Description

TECHNICAL FIELD

[0001] The present application relates to the field of cosmetics, in particular to a cosmetic composition, a preparation method and application in skin anti-aging and wrinkle resistance. BACKGROUND

[0002] Type I collagen is the most abundant collagen in the human body, and is expressed in almost all connective tissues and interstitial membranes. It is the main protein in the skeleton, skin, tendon, ligament, sclera, cornea and blood vessels. Human dermal fibroblasts can continuously stimulate the synthesis of new type I collagen, and type I collagen itself plays a supporting role in the skin. Its network structure makes the skin tissue more dense.

[0003] MMP-1 (matrix collagenase) can degrade type I collagen, causing collagen loss in the human body, weakening its supporting effect on the skin, and ultimately leading to reduced skin elasticity. The present application develops a hydrogel preparation as a cosmetic composition, which inhibits the activity of matrix metalloproteinase 1 (MMP1) to achieve anti-wrinkle effect. SUMMARY

[0004] The present application aims to overcome the shortcomings of the prior art and provide a cosmetic composition, a preparation method and application in skin anti-aging and wrinkle resistance. The SKAP2 protein is expressed by constructing a plasmid expression vector, and milk exosomes are extracted. Then the SKAP2 protein is wrapped into the milk exosomes. The exosomes containing the SKAP2 protein are mixed with trehalose dihydrate, water and CMC to prepare a hydrogel preparation, which can be used as a cosmetic composition for gel coating, facial mask, toner and dry powder patch. By inhibiting the activity of matrix metalloproteinase 1 (MMP1), the anti-wrinkle effect is achieved.

[0005] To achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0006] A cosmetic composition, characterized in that it comprises the following components: mEXOs wrapped SKAP2 protein, trehalose dihydrate, water and CMC.

[0007] Preferably, in the components of the cosmetic composition, the ratio of trehalose dihydrate, water and mEXOs wrapped SKAP2 protein is 4g:80mL:2mL; the content of CMC in the cosmetic composition is 0.1-4wt%.

[0008] A preparation method of a cosmetic composition, comprising the following steps: dissolving trehalose dihydrate and water by stirring, adding mEXOs wrapped SKAP2 protein and continuing to stir, adding CMC and stirring, then standing, repeating multiple times to obtain a hydrogel preparation, which is a cosmetic composition.

[0009] Preferably, the preparation of the mEXOs encapsulating SKAP2 protein in the components of the cosmetic composition comprises the following steps:

[0010] Step one, construction of recombinant plasmid;

[0011] The SKAP2 gene is connected with the PEGX-6P-1 carrier by a recombinant method to obtain a recombinant plasmid;

[0012] Step two, plasmid transformation;

[0013] The plasmid is added to the competent cells to obtain competent cells containing the plasmid, and after bacterial culture and induction expression, the supernatant is collected by centrifugation;

[0014] Step three, protein purification;

[0015] The collected supernatant is added to GST-beads, washed and eluted to obtain an eluate containing SKAP2 protein, which is treated to obtain SKAP2 protein;

[0016] Step four, preparation of mEXOs encapsulating SKAP2 protein;

[0017] The milk exosome mEXOs and the SKAP2 protein are mixed in PBS to obtain a mixture, the mixture is subjected to sonication and incubation to obtain mEXOs encapsulating SKAP2 protein.

[0018] Preferably, in the step one, the sequence of the SKAP2 gene is shown as SEQ ID NO. 1:

[0019]

[0020] Preferably, in the preparation of mEXOs encapsulating SKAP2 protein, the specific step of recombinant connection in step one includes:

[0021] S1, the SKAP2 gene is amplified by PCR to obtain a fragment PCR product;

[0022] Add MIX mixed solution to the working solution and mix well to obtain the first round reaction system;

[0023] The MIX mixed solution is a full-length fragment (1104bp) of the SKAP2 gene;

[0024] The first round reaction system is subjected to PCR amplification to obtain a first round product;

[0025] Mix the first primer, the tail primer, the first round product, and the working solution to obtain the second round reaction system;

[0026] The sequence of the first primer is shown in SEQ ID NO. 2: GATCTGGAAGTTCTGTTCCAG GGGCCCCTGGGATCCCCTAATCCGAGCAGTACCAGCAGTCC,

[0027] The sequence of the tail primer is shown in SEQ ID NO. 3: ATATCGGCGGTAGCCATCATCATCA TCACCATTAACTCGAGCGGCCGCATCGTGACTGACTGACGATCTGC;

[0028] The second round reaction system is subjected to PCR amplification to obtain a fragment PCR product;

[0029] S2, the fragment PCR product is recombined into the vector pGEX-6P-1 (BamHI-XhoI enzyme-digested vector) by recombination to obtain a full-length SKAP2 gene construction recombinant plasmid.

[0030] Preferably, in the preparation of mEXOs encapsulating SKAP2 protein, the process of plasmid transformation in step two specifically includes:

[0031] S1, competent cell transformation;

[0032] The full-length SKAP2 gene construction recombinant plasmid is added to the melted competent cells on ice, mixed uniformly, placed on ice, heat shocked, and transferred to ice to obtain the competent cells containing the plasmid;

[0033] The high-pressure treated LB medium is added to the competent cells containing the plasmid, and the cells are cultured at 37°C on a 220 rpm shaker for 1 h. After the culture is completed, the SKAP2 protein expression bacterial solution is obtained;

[0034] S2, bacterial culture and collection

[0035] The SKAP2 protein expression bacterial solution is plated and cultured. After the culture is completed, the culture is continued. When the OD value of the bacterial solution rises to a specified range, the inducer IPTG is added, and the culture is again incubated at 22°C on a 210 rpm shaker for 18 h. After the culture is completed, the solution is centrifuged, the centrifugation precipitate is collected, resuspended, broken, centrifuged again, and the supernatant is collected.

[0036] Preferably, in the step two S1, the competent cells are competent cells BL21 (DE3) when preparing mEXOs encapsulating SKAP2 protein.

[0037] Preferably, in the step two S2, the OD value of the bacterial solution is in the range of 0.6-0.8, and the final concentration of the inducer IPTG is 0.5 mM when preparing mEXOs encapsulating SKAP2 protein.

[0038] Preferably, in the step four, the mass ratio of the milk exosome mEXOs to the SKAP2 protein is 1:1, and the final concentration of the mEXOs in the mixture is 4 μg / mL when preparing mEXOs encapsulating SKAP2 protein.

[0039] Preferably, in the step four, the sonication is set as an amplitude of 20%, 6 cycles of 30 s on and 2 min off, and the incubation condition is 37°C for 60 min to restore the exosome membrane when preparing mEXOs encapsulating SKAP2 protein.

[0040] Preferably, in the step four, the milk exosome mEXOs are prepared by the following steps when preparing mEXOs encapsulating SKAP2 protein.

[0041] The milk is pretreated by centrifugation, and the pretreated milk is sequentially subjected to low-speed centrifugation, high-speed centrifugation, and ultracentrifugation, washed and resuspended to obtain milk exosome mEXOs.

[0042] Preferably, in the step four, the low-speed centrifugation operation includes centrifugation at 4°C and 3000g for 10 min to obtain the middle layer clear solution, the high-speed centrifugation operation includes centrifugation at 4°C and 10000g for 30 min to discard the precipitate and obtain the supernatant, and the ultracentrifugation operation includes centrifugation at 4°C and 100000g for 60-90 min to precipitate the exosomes when preparing milk exosome mEXOs.

[0043] The washing and resuspension operation comprises resuspending the precipitate with PBS, centrifuging again at a centrifugal force of 100000g for 60min, removing impurities, and resuspending the obtained precipitate again with PBS for washing.

[0044] The cosmetic composition as described above is applied to skin anti-aging and wrinkle resistance, characterized in that the cosmetic comprises any one of gel coating, facial mask, skin toner, and dry powder patch.

[0045] Compared with the prior art, the water gel preparation prepared by the application can be applied to gel coating, facial mask, skin toner, and dry powder patch as a cosmetic composition, and the activity of matrix metalloproteinase 1 (MMP1) is inhibited to achieve the anti-wrinkle effect. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 is the HE staining result diagram of the frozen testicular tissue section of the control group, the lead poisoning group, and the lead poisoning group + smearing group of mice after the experiment in Example 2;

[0047] Figure 2 is the average level column chart of the epididymal sperm quality parameters of the control group, the lead poisoning group, and the lead poisoning + smearing intervention group of mice when the sperm parameters of mice are detected in Example 2;

[0048] Figure 3 is the average level column chart of the epididymal sperm quality parameters of the control group, the DBP poisoning group, and the DBP poisoning + smearing intervention group of mice when the sperm parameters of mice are detected in Example 2;

[0049] Figure 4 is the average level column chart of the epididymal sperm quality parameters of the control group, the high temperature group, and the high temperature + treatment group of mice when the sperm parameters of mice are detected in Example 2;

[0050] Figure 5 is the average level column chart of the epididymal sperm quality parameters of the control group, the aging group, and the aging + treatment group of mice when the sperm parameters of mice are detected in Example 2;

[0051] Figure 6 is the SKAP2 gene PCR amplification result in Example 1;

[0052] Figure 7 is the SKAP2 gene bacterial liquid PCR identification result in Example 1;

[0053] Figure 8 is the double enzyme digestion identification result of the recombinant plasmid in Example 1;

[0054] Figure 9 is the analysis and detection column chart of cytotoxicity in Example 4;

[0055] Figure 10 is the analysis detection histogram of the MMP-1 content in Example 4. DETAILED DESCRIPTION

[0056] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only some of the embodiments of the present application, rather than all the embodiments. Based on the embodiments in the present application, all other embodiments obtained by those of ordinary skill in the art without creative work fall within the protection scope of the present application.

[0057] Example 1

[0058] The present embodiment discloses a preparation method of a hydrogel preparation, comprising the following steps:

[0059] Step one, constructing a recombinant plasmid;

[0060] The SKAP2 gene is connected with the pEGX-6P-1 vector by using a recombination method to obtain a SKAP2 full-length construction recombinant plasmid;

[0061] The SKAP2 gene sequence is shown in SEQ ID NO. 1:

[0062]

[0063] The specific steps of recombination connection include:

[0064] 1.1 The SKAP2 gene is amplified by PCR to obtain a fragment PCR product;

[0065] Mix 34.5 μL of sterile water, 10 μL of 5x Buffer, and 1 μL of 10 mM dNTPs to obtain a working solution; add 2 μL of MIX mixture to the working solution and mix to obtain a first round reaction system;

[0066] The MIX mixture is a full-length fragment (1104 bp) of the SKAP2 gene.

[0067] The first round reaction system is subjected to PCR amplification to obtain a first round product.

[0068] The PCR reaction program is as follows:

[0069]

[0070]

[0071] Mix 2 μL of the first primer, 2 μL of the tail primer, 2 μL of the first round product, and 94 μL of the working solution to obtain a second round reaction system.

[0072] The sequence of the first primer is shown in SEQ ID NO. 2: GATCTGGAAGTTCTGTTCC AGGGGCCCCTGGGATCCCCTAATCCGAGCAGTACCAGCAGTCC.

[0073] The sequence of the tail primer is shown in SEQ ID NO. 3: ATATCGGCGGTAGCCATCATCATCATCACCATTAACTCGAGCGGCCGCATCGTGACTGACTGACGATCTGC.

[0074] The second round reaction system is subjected to PCR amplification to obtain a fragment PCR product.

[0075] The PCR reaction program is as follows:

[0076]

[0077] Further, the band brightness and size of the PCR product are detected by agarose gel electrophoresis, and the product size is 1104 bp.

[0078] 1.2 Recombination of the fragment PCR product into the vector pGEX-6P-1 (BamHI-XhoI enzyme-digested vector) by a recombination method to obtain a full-length SKAP2 gene construction recombinant plasmid;

[0079] The preparation of the BamHI-Xho enzyme-digested vector includes the following steps:

[0080] The pGEX-6P-1 plasmid 3 μL, BamHI 0.5 μL, XhoI 0.5 μL, 10x enzyme digestion buffer 1 μL, ddH2O 5.5 μL are mixed uniformly to obtain an enzyme digestion system; the enzyme digestion system is reacted at 37°C for 20 min to obtain the BamHI-Xho enzyme-digested vector;

[0081] Further, whether the enzyme-digested band is correct is judged by gel electrophoresis according to a Snapgene simulated enzyme digestion map;

[0082] The recombination method includes the following steps:

[0083] 5 μL of the fragment PCR product, 5 μL of the vector pGEX-6P-1, and 10 μL of 2x recombination enzyme Mix (seamless assembly MIX) are mixed to obtain a reaction system with a total volume of 20 μL, which is connected at 52°C for 30 min to obtain a recombinant plasmid containing the SKAP2 gene of the plasmid vector pGEX-6P-1 with a concentration of 100 ng / μL;

[0084] 2 μL of the recombinant plasmid containing the SKAP2 gene with a plasmid concentration of 100 ng / μL is added to 100 μL of competent cells DH5α, mixed, placed on ice for 3 min, subjected to water bath at 42°C for 90 s, transferred to ice bath for 3 min, and then 800 μL of 37°C LB medium is added, which is subjected to 200 rpm shaking at 37°C for 40 min to obtain a "ampicillin-resistant" bacterial solution;

[0085] Further, the verification of the recombinant includes the following steps:

[0086] An ampicillin-resistant agar plate (containing ampicillin 1:1000) is prepared; 100 μL of the recombinant plasmid containing the SKAP2 gene of the plasmid vector pGEX-6P-1 with a concentration of 100 ng / μL is plated on the ampicillin-resistant agar plate, and the bacterial solution is coated on the surface of the plate with a sterile glass spreader; the plate is placed at 37°C for 15 min, and then inverted and cultured at 37°C for 14 h; after the culture is completed, the plate is picked, shaken at 250 r / min at 37°C for 14 h, and the bacterial solution is subjected to PCR; and the positive clone bacterial solution is sent for sequencing;

[0087] Further, the identification of the cloning plasmid includes the following steps: the SKAP2 gene fragment is amplified by PCR, positive clones are screened by "ampicillin-resistant" bacterial liquid PCR method, and the obtained positive bacterial liquid is obtained;

[0088] The sequence of the upstream primer is shown in SEQ ID NO. 4: CCTAATCCGAGCAGTACC AGCAGT,

[0089] The sequence of the downstream primer is shown in SEQ ID NO. 5: TAGCCATCATCATCATCACCATT AA;

[0090] The length of the amplified fragment is 1104bp;

[0091] The components of the PCR reaction system are: 20μL system, including 0.5μL of upstream primer and downstream primer, 2μL of "ampicillin-resistant" bacterial liquid, 0.5μL of 5U / μL polymerase, 2μL of 10×PCRBuffer, and 15μL of ddH2O;

[0092] The PCR reaction program is as follows: (1) 96℃ pre-denaturation for 3min, (2) 95℃ denaturation for 15s, (3) 58℃ annealing for 15s, (4) 72℃ extension for 20s, (5) cycle (2)-(4) for 23 cycles, (6) 72℃ terminal extension for 1min;

[0093] The positive bacterial liquid is shaken at 37℃, the cloning plasmid is extracted, sequenced, and then double-digested with restriction endonuclease BamHI-XhoI, the Bamh 1 digestion site is GGATCC, and the Xhol digestion site is CTCGAG, to obtain two fragments of 4960bp and 1110bp, and detection;

[0094] Step two, plasmid transformation;

[0095] 2.1, competent cell transformation;

[0096] 1ug / μL of SKAP2 gene full-length recombinant plasmid 1μL is taken and added to 100μL of ice-melted competent cell BL21(DE3) to mix evenly, placed on ice for 30min, then transferred to a 42℃ water bath for heat shock for 90s, and quickly transferred to ice for 3min to obtain the competent cell containing the plasmid;

[0097] 800μL of high-pressure treated LB medium is added to the competent cell containing the plasmid in the super-clean bench, and cultured at 37℃ constant temperature, 220rpm shaking bed for 1h, and then the SKAP2 protein expression bacterial liquid is obtained after the culture is completed;

[0098] 2.2, bacterial culture and collection;

[0099] Take LB agar plates in the super-clean table, pour 10 mL of agar medium (containing ampicillin 1:1000) into each plate, and let it solidify to get solidified LB agar plates;

[0100] Take 100 μL of SKAP2 protein expression bacterial solution and apply it to the solidified LB agar plates. When the bacterial solution is almost dry, invert it in a 37°C constant temperature incubator and incubate for 12 h. After incubation, pick the bacteria and place them in a 20 ml test tube containing 5 ml of LB medium (containing ampicillin 1:1000), and incubate at 37°C with constant temperature and 220 rpm shaking for 3 h to obtain a small shaking bacterial solution.

[0101] Add 1 mL of the small shaking bacterial solution to 100 mL of LB medium (containing ampicillin 1:1000), incubate at 37°C with constant temperature and 220 rpm shaking for 3 h. When the OD value of the bacterial solution reaches the specified range, add the inducer IPTG to a final concentration of 0.5 mM, and incubate at 22°C with constant temperature and 210 rpm shaking for 18 h. After incubation, centrifuge at 18,000 g for 20 min to collect the centrifugation precipitate. Resuspend the precipitate with resuspension solution, break it, centrifuge at 18,000 g for 20 min, and collect the supernatant.

[0102] The OD value of the bacterial solution is specified to be in the range of 0.6-0.8. The resuspension solution contains 50 mM Kcl and 25 mM Tris, with a pH value of 8.0. 3.5 mL of resuspension solution is used for 100 mL of bacterial solution.

[0103] Step three, protein purification;

[0104] Take the collected supernatant and add GST-beads. For 1 L of bacterial solution, add 1 mL of solid beads. Pass the column, and after the column is finished, use 10 times the column volume of the wash solution to wash the impurities. After the impurities are washed, use 10 times the column volume of the eluent to elute, and obtain the eluent containing SKAP2 protein. After treatment, the SKAP2 protein is obtained.

[0105] The wash solution contains 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, with a pH value of 7.4. The wash solution is prepared by filtering with a 0.22 or 0.45 needle filter. The eluent is GST eluent, which is mixed and configured from the equilibrium solution and reduced glutathione. The eluent contains 10 mM reduced glutathione.

[0106] Step four, preparation of mEXOs wrapped SKAP2 protein;

[0107] 4.1, preparation of milk exosomes mEXOs;

[0108] The fat and cell debris in the milk are removed at a temperature of 4℃ by centrifugation to obtain pretreated milk;

[0109] The pretreated milk is sequentially subjected to low-speed centrifugation, high-speed centrifugation, and ultracentrifugation, resuspended after washing, filtered, and milk exosomes mEXOs are obtained;

[0110] The low-speed centrifugation operation includes centrifugation at 4℃, 3000g centrifugal force for 10min, and taking the middle layer supernatant; the high-speed centrifugation operation includes centrifugation at 4℃, 10000g centrifugal force for 30min, discarding the precipitate, and taking the supernatant; and the ultracentrifugation operation includes centrifugation at 4℃, 100000g centrifugal force for 60-90min, and precipitating the exosomes;

[0111] The resuspension and washing operation includes resuspending the precipitate with PBS, centrifuging again at 100000g centrifugal force for 60min to remove impurities, and resuspending and washing the obtained precipitate again with PBS;

[0112] 4.2, Preparation of milk exosome mEXOs encapsulating SKAP2 protein;

[0113] The milk exosome mEXOs and the SKAP2 protein prepared in step three are mixed in PBS with a pH value of 7.4 at a mass ratio of 1:1, and the final concentration of mEXOs in the obtained mixture is 4μg / mL;

[0114] The mixture is subjected to sonication treatment, and the sonication treatment is set as follows: amplitude 20%, 6 cycles of 30s on and 2min off; after the sonication treatment is completed, the supernatant is measured for unencapsulated SKAP2 protein at 260nm using a microplate reader, and incubated at 37℃ for 60min to restore the exosome membrane, and mEXOs encapsulating SKAP2 protein is obtained;

[0115] Step five, preparation of SKAP2 hydrogel preparation;

[0116] 4g of trehalose dihydrate, 80mL of water are dissolved under sterile conditions, 2mL of mEXOs encapsulating SKAP2 protein is added, stirred for 10min, 0.6g of CMC is added 5 times, stirred for 30min, and then placed for 30min, repeated 4 times, until there are no visible bubbles in the solution and it is transparent, viscous and colorless, and SKAP2 hydrogel preparation is obtained;

[0117] The total protein concentration of mEXOs encapsulating SKAP2 protein in the cosmetic composition is 225ug / mL.

[0118] Example 2

[0119] The embodiment discloses a method for establishing a mouse lead and DBP chronic poisoning model, and comprises the following steps:

[0120] Step (1), reagent configuration;

[0121] 1.1, lead acetate poisoning solution configuration: 167.00 g of anhydrous lead acetate is weighed and dissolved in 1 L of water to obtain a 167 g / L lead acetate solution;

[0122] 1.2, DBP solution configuration: 2.83 g of butyl phthalate (DBP) is weighed and dissolved in 25 mL of corn oil to obtain a DBP solution;

[0123] Step (2), chronic lead poisoning model and DBP poisoning model establishment;

[0124] 2.1, selecting experimental objects;

[0125] SPF level (5 months old) C57 mice with a body weight of 25-32 g are used for experiments, and the environmental conditions in the laboratory environment are maintained at room temperature of 25°C, the relative humidity is maintained at 40-60%, and the light-dark cycle is 12 h (light on at 8:00 in the morning and light off at 8:00 in the evening); animal feeding strictly follows the manual of the Experimental Animal Experimental Committee of the Army Medical University;

[0126] 2.2, lead poisoning and DBP poisoning model construction;

[0127] The mice selected in 2.1 are randomly divided into five groups, each group having 6 mice; lead acetate is added to the drinking water, a 0.5 g / Kg body weight dose is used for poisoning, and intragastric administration is performed once a day for 21 consecutive days to establish a chronic lead poisoning model; DBP dissolved in corn oil is added to the drinking water, a 500 mg / Kg body weight dose is used for poisoning, and intragastric administration is performed once a day for 21 consecutive days to establish a DBP poisoning model; the five groups of poisoning experiments are respectively: a control group, a lead poisoning group, a lead poisoning+smearing intervention group, a DBP poisoning group and a DBP poisoning+smearing intervention group;

[0128] The blood lead concentration is used as an exposure index, and the diet and growth and development of the mice are observed and recorded;

[0129] The weights of the heart, liver, spleen, lung, kidney, brain, testis and epididymis of the mice are observed, and the weights of the mouse tissues and organs are shown in Table 1:

[0130] Table 1. Organ weights and organ coefficients of lead and DBP poisoning model mice

[0131]

[0132]

[0133] Note: single factor variance analysis was used for normal distribution, and non-parametric test was used for non-normal distribution.

[0134] i: control group, Pb, Pb+TC; o: control group, DBP, DBP+TC

[0135] As shown in Table 1, the results obtained by variance analysis show that, although there are differences in the weights of these organs compared with the control group, such differences do not reach statistical significance (all p>0.05); the spleen weight of mice in the DBP poisoning + smearing intervention group is greater than that of mice in the DBP poisoning group, and is significantly greater than that of mice in the control group (although p=0.074); the visceral coefficient of mice is analyzed, and the calculation formula of the visceral coefficient is: visceral coefficient = tissue / organ weight / animal body weight; the results show that the bilateral epididymal coefficients of mice in the DBP poisoning group and the DBP poisoning + smearing intervention group are significantly smaller than that of the control group (p=0.008), which shows that the damage of DBP to the epididymis is greater than that of lead, resulting in a relative decrease in the weight of the epididymis, and the kidney coefficients of mice in the lead poisoning group and the lead poisoning + smearing intervention group are greater than that of the control group (although p=0.095);

[0136] Further, the mice after the poisoning experiment are detected and analyzed, including:

[0137] (1) Testicular tissue section, HE staining

[0138] 1.1, tissue fixation: fresh testicular tissue of mice after the poisoning experiment is respectively taken out, immediately put into the tissue fixing solution or the corresponding special fixing solution, fixed for 24h, and stored and transported at room temperature; the tissue is taken out from the fixing solution, and the target tissue is trimmed flat with a scalpel;

[0139] Fresh testicular tissue of mice after the poisoning experiment is respectively taken out, the water on the surface of the tissue is absorbed with filter paper or gauze, and the tissue is quickly frozen in liquid nitrogen for 15s, then transferred to a-80℃ refrigerator for storage, and dry ice is transported to ensure that the sample is in dry ice throughout the process before reaching the laboratory, and the tissue is not thawed; the tissue is taken out from the dry ice or-80℃ refrigerator, and the target tissue is trimmed flat with a scalpel;

[0140] 1.2, dehydration: the trimmed fixed tissue is placed in a 15wt% sucrose solution, and after dehydration and sinking in a 4℃ refrigerator, it is transferred to a 30wt% sucrose solution for dehydration and sinking in a 4℃ refrigerator;

[0141] Fresh tissue does not need to be dehydrated;

[0142] 1.3, embedding: the dehydrated tissue is taken out, the surface water is slightly absorbed with filter paper, and then the tissue is placed on the embedding table with the section facing up. OCT embedding agent is dropped around the tissue, the embedding table is placed on the quick-freezing table for rapid freezing and embedding, and the OCT becomes white and hard. Then, the sectioning can be performed;

[0143] Fresh tissue direct frozen section does not need to be fixed and dehydrated. The target tissue is smoothed with a scalpel, and then embedded and sectioned with OCT embedding agent;

[0144] 1.4, frozen sectioning: the embedding table is fixed on the sectioning machine. The tissue surface is smoothed by rough cutting, and then the sectioning can be started. The sectioning thickness is 8-10 μm. A clean glass slide is placed above the cut tissue section, and the tissue is attached to the glass slide. After labeling, it is stored at -20°C for later use;

[0145] 1.5, HE staining:

[0146] The section is deparaffinized and hydrated, and then stained with hematoxylin and eosin, dehydrated, transparentized, and mounted. The staining is completed;

[0147] In the staining result, the cell nucleus is dark blue, and the cytoplasm and collagen fibers are pink;

[0148] The HE staining result of the frozen testis tissue section of the mice after the poisoning experiment is shown in Figure 1 ;

[0149] As shown in Figure 1 , in the control group, 5-7 layers of spermatogenic cells can be seen in the seminiferous tubules, the cells are polar, and the arrangement is neat. A small amount of short spindle-shaped Sertoli cells can be seen between the spermatogenic cells. Spermatogenesis can be seen in the lumen. In the lead poisoning group, the number of spermatogenic cells in the seminiferous tubules is significantly reduced, and there are only 3-4 layers. A small amount of sperm can be seen in the lumen. In the lead poisoning group + smearing group, compared with the lead poisoning group, the number of spermatogenic cells in the seminiferous tubules increases, and there are 5-6 layers. The wall of the seminiferous tubules is slightly increased, and spermatogenesis can be seen in the lumen;

[0150] (2) Detection of mouse semen parameters

[0151] After the mice are sacrificed, the bilateral epididymal tails are cut longitudinally and placed in a 6-well plate containing 1 mL of HTF. The plate is placed on a constant temperature platform at 37°C for 2 min, and a pipette is used to gently blow the epididymal tail five times to obtain the sample;

[0152] The above operation is to ensure that the sperm can be completely separated from the epididymal tail;

[0153] Take 20 μL of epididymal tail liquid sample into 1 mL of HTF culture solution, put it into an EP tube, and prepare in advance in a 37℃ water bath; after shaking and mixing, take out 40 μL of the mixed solution into a disposable sperm analysis plate, then use the sperm automatic detection and analysis system (CASA) to detect the sperm, count 500 sperm per mouse;

[0154] Among them, the sperm motility related indexes are: percentage of forward moving sperm PR, percentage of forward moving and non forward moving sperm PR+NP, percentage of super-activated sperm, average curve speed VCL (μm / s), average straight line speed VSL (μm / s), average path speed VAP (μm / s), moving forward STR (%), average lateral swing amplitude ALH (μm) and average whipping frequency BCF (Hz).

[0155] After the detection is completed, the obtained results are comprehensively statistically analyzed by using statistical software SPSS 26.0 and R 4.2.1; for continuous variables conforming to normal distribution, mean ± standard deviation (Mean ± SD) is used for description, and t test is used for comparing the differences between two groups; on this basis, further pairwise comparison between groups is carried out; if the variances between groups are equal, LSD method is used for comparison; if the variances are not equal, Dunnett-t method is used; for data not conforming to normal distribution, median (M) and quartile (P25, P75) are used for description, and Kruskal-Wallis H statistical method is used to compare the differences between two groups; the results are shown in Tables 2 and Figure 2 、 Figure 3

[0156] Table 2 Average level of epididymal sperm quality parameters of lead and DBP exposed model mice

[0157]

[0158] Note: single factor variance analysis is used for data conforming to normal distribution, and non-parametric test is used for data not conforming to normal distribution

[0159] a: compared with the control group; c: pairwise comparison between dose groups; i: control group, Pb, Pb+TC; o: control group, DBP, DBP+TC

[0160] **P<0.01, *P<0.05

[0161] ​As shown in Table 2, the results of the epididymal sperm quality parameter analysis of the mice showed that the percentage of forward-moving sperm of the lead-doped group, the lead-doped + smearing intervention group and the DBP-doped group was significantly lower than that of the control group (all p<0.05); the percentage of non-forward-moving sperm of the lead-doped group, the lead-doped + smearing intervention group and the DBP-doped group was significantly lower than that of the control group (all p<0.01); the multiple sperm quality parameters of the mice in the DBP-doped group were significantly lower than those of the control group (all p<0.01); the multiple sperm quality parameters of the mice in the DBP-doped + smearing intervention group were significantly higher than those of the control group (all p<0.01).

[0162] Example 3

[0163] The present embodiment discloses a method for establishing a mouse high-temperature model and a mouse aging model, comprising the following steps:

[0164] Step (1), selecting experimental objects;

[0165] The control group of mice were 5-month-old mice, which were bred in an animal room at 25℃, and were provided with sufficient water and food without any intervention; the high-temperature intervention group and the high-temperature treatment group of mice were 5-month-old; the aging treatment group and the aging group of mice were 19-month-old;

[0166] Step (2), constructing a high-temperature model and an aging model;

[0167] 2.1, constructing a high-temperature model;

[0168] The temperature and humidity of the HOPE-MED 8050D small extreme environment simulation cabin were set to 37.5℃ and 60%, and the light was set to 50%. When the temperature was preheated to 37.5℃ and the humidity reached 60%, the mice were placed in the small extreme environment simulation cabin for 2h, during which sufficient water and real objects were provided for the mice to freely eat. The mice were placed in the cabin once a day from Monday to Saturday, with an interval of 24 hours each time. After high temperature, the mice were immediately taken out and allowed to recover at room temperature for one hour. The scrotal skin area of the high-temperature intervention group was smeared with gel, and the high-temperature group was not smeared. Then the mice were put back into the animal room for breeding. After four weeks of high-temperature intervention, the high-temperature intervention was stopped, and the high-temperature treatment group continued to be smeared for 3 weeks. The high-temperature group did not receive any other intervention. Each group of mice consisted of 6-8 mice. One mouse in the high-temperature group died during the high-temperature process.

[0169] 2.2, constructing a high-temperature model;

[0170] The scrotal skin of the aging treatment group was smeared with the hydrogel preparation prepared in Example 1 once a day from Monday to Saturday, with an interval of 24h each time. The mice were put back into the animal room after treatment. Three mice in the aging treatment group and two mice in the aging group died due to aging.

[0171] Table 3: Organ weights and organ coefficients of high-temperature and aging groups of mice

[0172]

[0173]

[0174] Note: ANOVA was used for normal distribution, and Kruskal-waills was used for non-normal distribution; there was a difference in the level of sperm hyperactivation among the three groups in the aging treatment study (P = 0.081), and the hyperactivation in the aging treatment group was significantly higher than that in the aging group (P < 0.05), and the VSL in the aging treatment group was significantly higher than that in the aging group (P < 0.05), but the difference in VSL level among the three groups was not significant (P = 0.108); there were significant differences in hyperactivation, VSL, STR, and BCF among the three groups in the high temperature treatment study (P < 0.05), and the hyperactivation, VSL, STR, and BCF in the high temperature group were significantly higher than those in the control group (P < 0.05), and there were differences in PR, PRNP, VCL, VAP, and ALH among the three groups (P < 0.1), and the levels of PR, PRNP, VCL, VAP, and ALH in the high temperature group were higher than those in the control group (P < 0.05).

[0175] Table 4 Average level of epididymal sperm quality parameters in high temperature and aging groups

[0176]

[0177] Note: ANOVA was used for normal distribution, and Kruskal-waillstest was used for non-normal distribution.

[0178] a: compared with the control group; c: pairwise comparison of dose groups; i: control group, aging treatment group, aging group; o: control group, high temperature treatment group, high temperature group

[0179] **P < 0.01, *P < 0.05

[0180] As shown in Table 4, Figures 4-5 It can be seen from Table 4 that compared with the control group of mice, the percentage of forward-moving sperm PR, PR+NP, hyperactivation, VCL, VSL, VAP, STR and other indicators in the high temperature group were significantly reduced (all p < 0.01); compared with the high temperature group, the sperm indicators of the high temperature treatment group were improved, especially the sperm hyperactivation rate and STR were significantly increased (all p < 0.05). The sperm indicators of the aging group were lower than those of the control group, and the hyperactivation rate of sperm in the aging treatment group was significantly higher than that in the aging group, and the difference was statistically significant (p < 0.05).

[0181] Example 4

[0182] The present embodiment discloses a method for analyzing and detecting cytotoxicity, comprising the following steps:

[0183] 5 x 103 The cells (human skin fibroblasts HFF) were inoculated into 96-well plates at a seeding density of 5x103cells / well, and incubated in an incubator (37°C, 5% CO2) overnight. After the cell confluence reached 45-60%, the original culture solution in the wells was discarded, 200 μL of culture medium containing a concentration gradient of the hydrogel preparation prepared in Example 1 was added to each well, and normal culture medium was added to the blank control group. The culture medium was high-sugar DMEM medium. The culture plates were incubated in an incubator (37°C, 5% CO2) for 24 h. After the incubation was completed, 20 μL of thiazolyl blue solution was added to each well, and the culture plates were incubated in the incubator for another 4 h. After the incubation was completed, the liquid in the wells was removed, and 100 μL of dimethyl sulfoxide solution was added to each well. The absorbance was measured at a wavelength of 490 nm on an enzyme-labeled instrument.

[0184] The standard deviation (SD) of the optical density of each group of duplicate wells measured by the enzyme-labeled instrument was statistically analyzed, and the coefficient of variation (C.V) was calculated. The test results are shown in Table 5 and Figure 9

[0185] Table 5 Cytotoxicity analysis

[0186]

[0187] Example 5

[0188] This example discloses an analysis and detection method for the content of MMP-1 (matrix collagenase), which comprises the following steps:

[0189] Step (1), plating:

[0190] Human skin fibroblasts HFF were inoculated into 24-well plates at a seeding density of 5x103cells / well, 1 mL per well, and cultured for 24 h (the confluence reached 45-60% 24 h after inoculation); 4

[0191] Step (2), experimental grouping:

[0192] The experiment set up a blank control group, a positive control group (TGF-β1, 100 ng / mL) and a sample group, with 3 parallel wells in each group.

[0193] The sample group contained the hydrogel preparation prepared in Example 1, with a concentration of 3% (m / m);

[0194] Step (3), solution preparation:

[0195] The complete culture medium containing 2% FBS was used to prepare solutions according to the experimental grouping.

[0196] Step (4), sample loading: ​​

[0197] Discard the culture solution in the 24-well plate, load according to the experimental grouping, 1 mL per well, after the administration is completed, place the 24-well plate in the incubator (37℃, 5% CO2, 95% RH) and culture for 24 h;

[0198] Step (5), sample collection and detection:

[0199] After the culture is completed, centrifuge the supernatant at 1000 r / min for 5 min, take the supernatant, and measure the MMP-1 content by using an MMP-1 kit.

[0200] The test results are shown in Table 6 and Figure 10 ;

[0201] Table 6 Data analysis of MMP-1 content

[0202]

[0203] Note: When using the t-test method for statistical analysis, both the sample group and the positive control group (PC) are compared with the blank control group (BC), and the significance is indicated by “*”, p-value < 0.05 is indicated by “*”, 0.001 < p-value ≤ 0.01 is indicated by “**”, and p-value < 0.001 is indicated by “***”.

[0204] MMP-1 (matrix collagenase) can degrade type I collagen, causing the loss of collagen in the human body, weakening its supporting effect on the skin, and ultimately leading to a decrease in skin elasticity. By measuring the change in MMP-1 content after the sample acts on the cells, it can be determined whether the sample has anti-wrinkle efficacy. As can be seen from Table 6 and Figure 10 , the MMP-1 content of the positive control group is significantly decreased compared with the blank control group, and the p-value < 0.05, proving that the experimental model is effective. Compared with the blank control, the MMP-1 content of the sample group at a test concentration of 3% (m / m) of the hydrogel preparation is significantly reduced, indicating that the hydrogel preparation has anti-wrinkle efficacy at a concentration of 3% (m / m).

[0205] Although embodiments of the present application have been shown and described, it will be understood by those of ordinary skill in the art that various changes, modifications, substitutions and alterations can be made thereto without departing from the principles and spirit of the present application, the scope of which is defined by the appended claims and their equivalents.

Images