Hydrogel preparation, preparation method and application in repairing sperm injury

Abstract

The invention relates to the technical field of hydrogel preparations, and discloses a hydrogel preparation, a preparation method and application in repairing sperm injury. The method comprises the following steps: step 1, constructing recombinant plasmids; step 2, plasmid transformation; step 3, protein purification; step 4, preparing the SKAP2 protein wrapped by the mEXOs; step 5, preparing an SKAP2 hydrogel preparation; according to the invention, the SKAP2 protein is expressed through prokaryotic escherichia coli, the milk exosome is extracted, then the SKAP2 protein is wrapped in the milk exosome, and then the exosome containing the SKAP2 protein is fused into the hydrogel preparation, so that the sperm motility of a mouse with asthenospermia can be remarkably improved in a skin smearing manner; comprising the effect of improving sperm motility decline of asthenospermia caused by heavy metal lead, organic endocrine disrupter phthalate and high temperature and aging, and the problem that no effective repairing preparation for asthenospermia exists in the prior art is solved.

Description

TECHNICAL FIELD

[0001] The present application relates to the technical field of hydrogel preparation, in particular to a hydrogel preparation, a preparation method and application in repairing sperm damage. BACKGROUND

[0002] There are many reasons for the decline in semen quality, including heavy metal and organic pollutant pollution, high temperature, aging and mental stress and many other factors; the decline in semen quality includes reduced sperm motility, reduced sperm count and increased deformity, and so far there is no targeted method to improve sperm quality. In order to improve the symptoms of asthenospermia and improve sperm motility, a hydrogel preparation is developed, which can significantly improve the problem of reduced sperm motility caused by heavy metal lead, phthalate DBP, high temperature and aging, and significantly improve sperm motility. SUMMARY

[0003] The present application aims to overcome the shortcomings of the prior art, and provides a hydrogel preparation, a preparation method and application in repairing sperm damage. The SKAP2 protein is expressed by constructing an expression vector with a plasmid, and milk exosomes are extracted, and then the SKAP2 protein is wrapped into the milk exosomes. The exosomes containing the SKAP2 protein are then fused into the hydrogel preparation. The preparation can significantly improve the sperm motility of asthenospermia mice by skin application, and achieves the effect of improving the sperm motility of asthenospermia caused by heavy metal lead, organic endocrine disruptor phthalate, high temperature and aging, and solves the problem of no effective repair preparation for asthenospermia in the prior art.

[0004] In order to achieve the above-mentioned purpose, the technical scheme adopted by the present application is as follows:

[0005] A preparation method of a hydrogel preparation, comprising the following steps:

[0006] Step 1, construct a recombinant plasmid;

[0007] The SKAP2 gene is connected with the PEGX-6P-1 carrier by a recombinant method to obtain a recombinant plasmid;

[0008] Step 2, plasmid transformation;

[0009] The plasmid is added to the competent cells to obtain competent cells containing the plasmid, and after bacterial culture and induction expression, the supernatant is collected by centrifugation;

[0010] Step 3, protein purification;

[0011] The collected supernatant is added to GST-beads, washed and eluted to obtain an eluate containing the SKAP2 protein, and the SKAP2 protein is obtained after post-treatment;

[0012] Step four, preparation of mEXOs encapsulated SKAP2 protein;

[0013] Mixing bovine milk exosomes mEXOs with SKAP2 protein in PBS to obtain a mixture; treating the mixture with sound waves, incubating to obtain mEXOs encapsulated SKAP2 protein;

[0014] Step five, preparation of SKAP2 hydrogel preparation;

[0015] Dissolving trehalose dihydrate and water by stirring, adding mEXOs encapsulated SKAP2 protein and continuing to stir, adding CMC and stirring, then standing, repeating multiple times to obtain a hydrogel preparation.

[0016] Preferably, in the step one, the SKAP2 gene sequence is shown as SEQ ID NO. 1:

[0017]

[0018] Preferably, the specific step of recombination connection in step one comprises:

[0019] S1, the SKAP2 gene is amplified by PCR to obtain a fragment PCR product;

[0020] The MIX mixed solution is added to the working solution and mixed to obtain the first round reaction system;

[0021] The MIX mixed solution is a full-length fragment (1104bp) of the SKAP2 gene;

[0022] The first round reaction system is subjected to PCR amplification to obtain a first round product;

[0023] The first primer, the tail primer, the first round product and the working solution are mixed to obtain the second round reaction system;

[0024] The sequence of the first primer is shown in SEQ ID NO. 2: GATCTGGAAGTTCT GTTCCAGGGGCCCCTGGGATCCCCTAATCCGAGCAGTACCAGC AGTCC,

[0025] The sequence of the tail primer is shown in SEQ ID NO. 3: ATATCGGCGGTAGCCAT CATCATCATCACCATTAACTCGAGCGGCCGCATCGTGACTGACT GACGATCTGC;

[0026] The second round reaction system is subjected to PCR amplification to obtain a fragment PCR product;

[0027] S2, the fragment PCR product is recombined into the vector pGEX-6P-1 (BamHI-XhoI enzyme digestion vector) by recombination to obtain a full-length SKAP2 gene construction recombinant plasmid.

[0028] Preferably, in step two, the process of plasmid transformation specifically comprises:

[0029] S1, transformation of competent cells;

[0030] The full-length SKAP2 gene construction recombinant plasmid is added to the melted competent cells on ice, mixed uniformly, placed on ice, heat shocked, transferred to ice, and the competent cells containing the plasmid are obtained;

[0031] The high-pressure treated LB medium is added to the competent cells containing the plasmid, and the culture is incubated at 37°C for 1h with constant temperature and 220rpm shaking. After the culture is completed, the SKAP2 protein expression bacterial solution is obtained;

[0032] S2, bacterial culture and collection

[0033] The SKAP2 protein expression bacterial liquid is plated, cultured, and after the culture is completed, the culture is continued, and when the OD value of the bacterial liquid rises to a specified range, an inducer IPTG is added, and the culture is again carried out at 22°C constant temperature and 210 rpm shaking bed for 18 h. After the culture is completed, centrifugation is carried out, and the centrifugal precipitate is collected, resuspended, broken, centrifuged again, and the supernatant is collected.

[0034] Preferably, in S1 of step two, the competent cell is a competent cell BL21 (DE3).

[0035] Preferably, in S2 of step two, the OD value of the bacterial liquid is in a range of 0.6-0.8, and the final concentration of the inducer IPTG is 0.5 mM.

[0036] Preferably, in step four, the mass ratio of the milk exosome mEXOs to the SKAP2 protein is 1:1, and the final concentration of the mEXOs in the mixture is 4 μg / mL.

[0037] Preferably, in step four, the sonication treatment is set as: an amplitude of 20%, 6 cycles of 30 s on and 2 min off, and the incubation condition is: incubation at 37°C for 60 min to restore the exosome membrane.

[0038] Preferably, in step four, the milk exosome mEXOs are prepared by the following steps:

[0039] The milk is pretreated by centrifugation, and the pretreated milk is sequentially subjected to low-speed centrifugation, high-speed centrifugation, and ultracentrifugation, washed and resuspended to obtain the milk exosome mEXOs.

[0040] Preferably, in step four, when the milk exosome mEXOs are prepared: the low-speed centrifugation operation includes: centrifugation at 4°C and 3000 g centrifugal force for 10 min, and the middle layer clear liquid is taken; the high-speed centrifugation operation includes: centrifugation at 4°C and 10000 g centrifugal force for 30 min, and the precipitate is discarded, and the supernatant is taken; and the ultracentrifugation operation includes: centrifugation at 4°C and 100000 g centrifugal force for 60-90 min, and the exosomes are precipitated.

[0041] The washing and resuspension operation includes: resuspending the precipitate with PBS, again centrifuging at 100000 g centrifugal force for 60 min to remove impurities, and resuspending the obtained precipitate again with PBS.

[0042] Preferably, in step five: the ratio of the two water trehalose, water, and the mEXOs wrapped SKAP2 protein is 4 g:80 mL:2 mL; and the content of the CMC in the cosmetic composition is 0.1-4 wt%.

[0043] The application discloses a hydrogel preparation prepared by a preparation method of the hydrogel preparation.

[0044] The application discloses an application of the hydrogel preparation in repairing sperm damage.

[0045] Compared with the prior art, the hydrogel preparation prepared by the application can significantly improve sperm activity of asthenospermia mice by skin coating, realizes the effect of improving sperm activity of asthenospermia caused by heavy metal lead, organic endocrine disruptor phthalate (DBP), high temperature and aging, sperm movement indexes of the poisoning + coating intervention group are significantly improved compared with the poisoning model group, and the preparation can inhibit the activity of matrix metalloproteinase 1 (MMP1), and achieves the anti-wrinkle effect. BRIEF DESCRIPTION OF DRAWINGS

[0046] Figure 1 is a HE staining result diagram of frozen testis tissue sections of the control group, the lead poisoning group and the lead poisoning group + coating group of mice after the poisoning experiment in example 2;

[0047] Figure 2 is a column chart of average levels of epididymal sperm quality parameters of the control group, the lead poisoning group and the lead poisoning + coating intervention group of mice when the sperm parameters of the mice are detected in example 2;

[0048] Figure 3 is a column chart of average levels of epididymal sperm quality parameters of the control group, the DBP poisoning group and the DBP poisoning + coating intervention group of mice when the sperm parameters of the mice are detected in example 2;

[0049] Figure 4 is a column chart of average levels of epididymal sperm quality parameters of the control group, the high temperature group and the high temperature + treatment group of mice when the sperm parameters of the mice are detected in example 2;

[0050] Figure 5 is a column chart of average levels of epididymal sperm quality parameters of the control group, the aging group and the aging + treatment group of mice when the sperm parameters of the mice are detected in example 2;

[0051] Figure 6 is a PCR amplification result of the SKAP2 gene in example 1;

[0052] Figure 7 is a bacterial liquid PCR identification result of the SKAP2 gene in example 1;

[0053] Figure 8 is a double enzyme digestion identification result of a recombinant plasmid in example 1. DETAILED DESCRIPTION

[0054] The technical solutions in the embodiments of the present application will be clearly and completely described below in combination with the embodiments of the present application. Obviously, the described embodiments are only part of the embodiments of the present application, rather than all the embodiments. Based on the embodiments of the present application, all other embodiments obtained by those skilled in the art without creative efforts fall within the protection scope of the present application.

[0055] Embodiment 1

[0056] The present embodiment discloses a preparation method of a hydrogel preparation, comprising the following steps:

[0057] Step one, constructing a recombinant plasmid;

[0058] The SKAP2 gene is connected with the pEGX-6P-1 vector by using a recombination method to obtain a SKAP2 full-length construction recombinant plasmid;

[0059] The SKAP2 gene sequence is shown in SEQ ID NO. 1:

[0060]

[0061] The specific steps of recombination connection include:

[0062] 1.1 The SKAP2 gene is amplified by PCR to obtain a fragment PCR product;

[0063] Mix 34.5 μL of sterile water, 10 μL of 5x Buffer, and 1 μL of 10 mM dNTPs to obtain a working solution;

[0064] Add 2 μL of MIX mixture to the working solution and mix well to obtain the first round reaction system;

[0065] The MIX mixture is a full-length fragment of the SKAP2 gene (1104 bp);

[0066] The first round reaction system is subjected to PCR amplification to obtain a first round product;

[0067] The PCR reaction program is as follows:

[0068]

[0069] Mix 2 μL of the first primer, 2 μL of the tail primer, 2 μL of the first round product, and 94 μL of the working solution to obtain the second round reaction system;

[0070] The sequence of the first primer is shown in SEQ ID NO. 2: GATCTGGAAGTT CTGTTCCAGGGGCCCCTGGGATCCCCTAATCCGAGCAGTACCAG CAGTCC,

[0071] The sequence of the tail primer is shown in SEQ ID NO. 3: ATATCGGCGGTAGCCAT CATCATCATCACCATTAACTCGAGCGGCCGCATCGTGACTGACT GACGATCTGC;

[0072] The second round reaction system is subjected to PCR amplification to obtain a fragment PCR product;

[0073] The PCR reaction program is as follows:

[0074]

[0075] Further, the band brightness and size of the PCR product are detected by agarose gel electrophoresis, and the product size is 1104 bp;

[0076] 1.2 Recombination of the fragment PCR product into the vector pGEX-6P-1 (BamHI-XhoI enzyme-digested vector) by a recombination method to obtain a full-length SKAP2 gene construction recombinant plasmid;

[0077] The preparation of the BamHI-Xho enzyme-digested vector includes the following steps:

[0078] The pGEX-6P-1 plasmid 3 μL, BamHI 0.5 μL, XhoI 0.5 μL, 10x enzyme digestion buffer 1 μL, ddH2O 5.5 μL are mixed uniformly to obtain an enzyme digestion system; the enzyme digestion system is reacted at 37°C for 20 min to obtain the BamHI-Xho enzyme-digested vector;

[0079] Further, whether the enzyme-digested band is correct is judged by gel electrophoresis according to a Snapgene simulated enzyme digestion map;

[0080] The recombination method includes the following steps:

[0081] 5 μL of the fragment PCR product, 5 μL of the vector pGEX-6P-1, and 10 μL of 2x recombination enzyme Mix (seamless assembly MIX) are mixed to obtain a reaction system with a total volume of 20 μL, which is connected at 52°C for 30 min to obtain a recombinant plasmid containing the SKAP2 gene with a plasmid vector pGEX-6P-1 at a concentration of 100 ng / μL;

[0082] 2 μL of the recombinant plasmid containing the SKAP2 gene with a plasmid concentration of 100 ng / μL is added to 100 μL of competent cells DH5α, mixed uniformly, placed on ice for 3 min, subjected to water bath at 42°C for 90 s, transferred to ice bath for 3 min, added with 800 μL of 37°C LB medium, and subjected to 200 rpm shaking at 37°C for 40 min to obtain a "ampicillin-resistant" bacterial solution;

[0083] Further, the verification of the recombinant includes the following steps:

[0084] An ampicillin-resistant agar plate (containing ampicillin at 1:1000) is prepared; 100 μL of the recombinant plasmid containing the SKAP2 gene with a plasmid vector pGEX-6P-1 at a concentration of 100 ng / μL is plated on the ampicillin-resistant agar plate, the bacterial solution is coated on the surface of the plate with a sterile glass spreader, the plate is placed at 37°C for 15 min, and then the plate is inverted and cultured at 37°C for 14 h; after the culture is completed, the plate is picked, shaken at 250 r / min at 37°C for 14 h, the bacterial solution is subjected to PCR, and the positive clone bacterial solution is sent for sequencing;

[0085] Further, the identification of the cloning plasmid includes the following steps: the SKAP2 gene fragment is amplified by PCR, positive clones are screened by "ampicillin-resistant" bacterial liquid PCR method, and the obtained positive bacterial liquid is obtained;

[0086] The sequence of the upstream primer is shown in SEQ ID NO. 4: CCTAATCCGAG CAGTACCAGCAGT,

[0087] The sequence of the downstream primer is shown in SEQ ID NO. 5: TAGCCATCATCATCAT CACCATTAA.

[0088] The length of the amplified fragment is 1104bp;

[0089] The components of the PCR reaction system are: 20μL system, including 0.5μL of upstream primer and downstream primer, 2μL of "ampicillin-resistant" bacterial liquid, 0.5μL of 5U / μL polymerase, 2μL of 10xPCR Buffer, and 15μL of ddH2O;

[0090] The PCR reaction program is as follows: (1) 96℃ pre-denaturation for 3min, (2) 95℃ denaturation for 15s, (3) 58℃ annealing for 15s, (4) 72℃ extension for 20s, (5) cycle (2)-(4) for 23 cycles, (6) 72℃ terminal extension for 1min;

[0091] The positive bacterial liquid is shaken at 37℃, the cloning plasmid is extracted, sequenced, and then double-digested with restriction endonuclease BamHI-XhoI, the Bamh 1 digestion site is GGATCC, and the Xhol digestion site is CTCGAG, to obtain two fragments of 4960bp and 1110bp, and the detection is performed.

[0092] Step two, plasmid transformation;

[0093] 2.1, competent cell transformation;

[0094] 1ug / μL of SKAP2 gene full-length recombinant plasmid 1μL is taken and added to 100μL of ice-melted competent cell BL21(DE3) to mix evenly, placed on ice for 30min, then transferred to 42℃ water bath for heat shock for 90s, quickly transferred to ice for 3min, to obtain the plasmid-containing competent cell;

[0095] 800μL of high-pressure treated LB medium is added to the plasmid-containing competent cell in the super-clean bench, and cultured at 37℃ constant temperature, 220rpm shaking bed for 1h, after the culture is completed, the SKAP2 protein expression bacterial liquid is obtained;

[0096] 2.2, bacterial culture and collection;

[0097] Take LB agar plates in the super-clean table, pour 10 mL of agar medium (containing ampicillin 1:1000) into each plate, and let it solidify to get solidified LB agar plates;

[0098] Take 100 μL of SKAP2 protein expression bacterial solution and apply it to the solidified LB agar plates. When the bacterial solution is almost dry, invert it in a 37°C constant temperature incubator and incubate for 12 h. After incubation, pick the bacteria and place them in a 20 ml test tube containing 5 ml of LB medium (containing ampicillin 1:1000), and incubate at 37°C with constant temperature and 220 rpm shaking for 3 h to obtain a small shaking bacterial solution.

[0099] Add 1 mL of the small shaking bacterial solution to 100 mL of LB medium (containing ampicillin 1:1000), incubate at 37°C with constant temperature and 220 rpm shaking for 3 h. When the OD value of the bacterial solution reaches the specified range, add the inducer IPTG to a final concentration of 0.5 mM, and incubate at 22°C with constant temperature and 210 rpm shaking for 18 h. After incubation, centrifuge at 18,000 g for 20 min to collect the centrifugation precipitate. Resuspend the precipitate with resuspension solution, break it, and centrifuge at 18,000 g for 20 min to collect the supernatant.

[0100] The OD value of the bacterial solution is specified to be in the range of 0.6-0.8. The resuspension solution contains 50 mM Kcl and 25 mM Tris, with a pH value of 8.0. 3.5 mL of resuspension solution is used for 100 mL of bacterial solution.

[0101] Step three, protein purification;

[0102] Take the collected supernatant and add GST-beads. For 1 L of bacterial solution, add 1 mL of solid beads. Pass the column, and after the column is finished, use 10 times the column volume of the wash solution to wash the impurities. After the impurities are washed, use 10 times the column volume of the eluent to elute, and obtain the eluent containing SKAP2 protein. After treatment, the SKAP2 protein is obtained.

[0103] The wash solution contains 140 mM NaCl, 2.7 mM KCl, 10 mM Na2HPO4, and 1.8 mM KH2PO4, with a pH value of 7.4. The wash solution is prepared by filtering with a 0.22 or 0.45 needle filter. The eluent is GST eluent, which is mixed and configured from the equilibrium solution and reduced glutathione. The eluent contains 10 mM reduced glutathione.

[0104] Step four, preparation of mEXOs wrapped SKAP2 protein;

[0105] 4.1, preparation of milk exosomes mEXOs;

[0106] The fat and cell debris in the milk are removed at a temperature of 4℃ by centrifugation to obtain pretreated milk;

[0107] The pretreated milk is sequentially subjected to low-speed centrifugation, high-speed centrifugation, and ultracentrifugation, resuspended after washing, filtered, and milk exosomes mEXOs are obtained;

[0108] The low-speed centrifugation operation includes centrifugation at 4℃, 3000g centrifugal force for 10min, and taking the middle layer supernatant; the high-speed centrifugation operation includes centrifugation at 4℃, 10000g centrifugal force for 30min, discarding the precipitate, and taking the supernatant; and the ultracentrifugation operation includes centrifugation at 4℃, 100000g centrifugal force for 60-90min, and precipitating the exosomes;

[0109] The resuspension and washing operation includes resuspending the precipitate with PBS, centrifuging again at 100000g centrifugal force for 60min to remove impurities, and resuspending and washing the obtained precipitate again with PBS;

[0110] 4.2, Preparation of milk exosome mEXOs encapsulating SKAP2 protein;

[0111] The milk exosome mEXOs and the SKAP2 protein prepared in step three are mixed in PBS with a pH value of 7.4 at a mass ratio of 1:1, and the final concentration of mEXOs in the obtained mixture is 4μg / mL;

[0112] The mixture is subjected to sonication treatment, and the sonication treatment is set as follows: amplitude 20%, 6 cycles of 30s on and 2min off; after the sonication treatment, the supernatant is measured for unencapsulated SKAP2 protein at 260nm using a microplate reader, and the exosome membrane is recovered by incubation at 37℃ for 60min to obtain mEXOs encapsulating SKAP2 protein;

[0113] Step five, preparation of SKAP2 hydrogel preparation;

[0114] 4g of trehalose dihydrate and 80mL of water are stirred and dissolved under sterile conditions, 2mL of mEXOs encapsulating SKAP2 protein is added, stirred for 10min, 0.6g of CMC is added in 5 portions, stirred for 30min, and then placed for 30min, and the operation is repeated 4 times until there are no visible bubbles in the solution and the solution is transparent, viscous and colorless, and the SKAP2 hydrogel preparation is obtained;

[0115] The total protein concentration of the mEXOs encapsulating SKAP2 protein in the cosmetic composition is 225ug / mL.

[0116] Example 2

[0117] The embodiment discloses a method for establishing a mouse chronic lead and DBP poisoning model, and comprises the following steps:

[0118] Step (1), reagent configuration;

[0119] 1.1, lead acetate poisoning solution configuration: 167.00 g of anhydrous lead acetate is weighed and dissolved in 1 L of water to obtain a 167 g / L lead acetate solution;

[0120] 1.2, DBP solution configuration: 2.83 g of butyl phthalate (DBP) is weighed and dissolved in 25 mL of corn oil to obtain a DBP solution;

[0121] Step (2), chronic lead poisoning model and DBP poisoning model establishment;

[0122] 2.1, selection of experimental objects;

[0123] SPF level (5 months old) C57 mice with a body weight of 25-32 g are subjected to experiments, and the environmental conditions in the laboratory environment are maintained at room temperature of 25 DEG C, the relative humidity is maintained at 40-60%, and the light-dark cycle is 12 h (light on at 8:00 in the morning, light off at 8:00 in the evening); animal feeding strictly follows the manual of the experimental animal experimental committee of the Army Medical University;

[0124] 2.2, lead poisoning and DBP poisoning model construction;

[0125] The mice selected in 2.1 are randomly divided into five groups, each group having 6 mice; lead acetate is added to drinking water, a 0.5 g / Kg body weight dose is used for poisoning, and intragastric administration is performed once a day for 21 consecutive days, so as to establish a chronic lead poisoning model; DBP dissolved in corn oil is added to drinking water, a 500 mg / Kg body weight dose is used for poisoning, and intragastric administration is performed once a day for 21 consecutive days, so as to establish a DBP poisoning model; the five groups of poisoning experiments are respectively: a control group, a lead poisoning group, a lead poisoning + smearing intervention group, a DBP poisoning group and a DBP poisoning + smearing intervention group;

[0126] The blood lead concentration is used as an exposure index, and the diet and growth and development of the mice are observed and recorded;

[0127] The weights of the heart, liver, spleen, lung, kidney, brain, testis and epididymis of the mice are observed, and the weights of the mouse tissues and organs are shown in Table 1:

[0128] Table 1. Organ weights and organ coefficients of lead and DBP poisoning model mice

[0129]

[0130]

[0131] Note: One-way ANOVA was used for normal distribution, and non-parametric test was used for non-normal distribution.

[0132] i: control group, Pb, Pb+TC; o: control group, DBP, DBP+TC

[0133] As shown in Table 1, the results obtained by variance analysis show that, although there are differences in the weights of these organs compared with the control group, such differences do not reach statistical significance (all p>0.05); the spleen weight of mice in the DBP poisoning + smearing intervention group is greater than that of mice in the DBP poisoning group, and is significantly greater than that of mice in the control group (although p=0.074); the visceral coefficient of mice is analyzed, and the calculation formula of the visceral coefficient is: visceral coefficient = tissue / organ weight / animal body weight; the results show that the bilateral epididymal coefficients of mice in the DBP poisoning group and the DBP poisoning + smearing intervention group are significantly smaller than that of the control group (p=0.008), which shows that the damage of DBP to the epididymis is greater than that of lead, resulting in a relative decrease in the weight of the epididymis, and the kidney coefficients of mice in the lead poisoning group and the lead poisoning + smearing intervention group are greater than that of the control group (although p=0.095);

[0134] Further, the mice after the poisoning experiment are detected and analyzed, including:

[0135] (1) Testicular tissue section, HE staining

[0136] 1.1, Tissue fixation: fresh testicular tissue of mice after the poisoning experiment is respectively taken out, immediately put into the tissue fixing solution or the corresponding special fixing solution, fixed for 24h, and stored and transported at room temperature; the tissue is taken out from the fixing solution, and the target tissue is trimmed flat with a scalpel;

[0137] Fresh testicular tissue of mice after the poisoning experiment is respectively taken out, the water on the surface of the tissue is absorbed with filter paper or gauze, and the tissue is quickly frozen in liquid nitrogen for 15s, then transferred to a-80°C refrigerator for storage, and dry ice is transported to ensure that the sample is in dry ice throughout the process before reaching the laboratory, and the tissue is not thawed; the tissue is taken out from the dry ice or-80°C refrigerator, and the target tissue is trimmed flat with a scalpel;

[0138] 1.2, Dehydration: the trimmed fixed tissue is placed in a 15wt% sucrose solution, and after dehydration and sinking in a 4°C refrigerator, it is transferred to a 30wt% sucrose solution for dehydration and sinking in a 4°C refrigerator;

[0139] Fresh tissue does not need to be dehydrated;

[0140] 1.3, embedding: the dehydrated tissue is taken out, the surface water is slightly absorbed with filter paper, and then the tissue is placed on the embedding table with the section facing up. OCT embedding agent is dropped around the tissue, the embedding table is placed on the quick-freezing table for rapid freezing and embedding, and the OCT becomes white and hard. Then, the sectioning can be performed;

[0141] Fresh tissue direct frozen section does not need to be fixed and dehydrated. The target tissue is smoothed with a scalpel, and then embedded and sectioned with OCT embedding agent;

[0142] 1.4, frozen sectioning: the embedding table is fixed on the sectioning machine. The tissue surface is smoothed by rough cutting, and then the sectioning can be started. The sectioning thickness is 8-10 μm. A clean glass slide is placed above the cut tissue section, and the tissue is attached to the glass slide. After labeling, it is stored at -20°C for later use;

[0143] 1.5, HE staining:

[0144] The section is deparaffinized and hydrated, and then stained with hematoxylin and eosin, dehydrated, transparentized, and mounted. The staining is completed;

[0145] In the staining result, the cell nucleus is dark blue, and the cytoplasm and collagen fibers are pink;

[0146] The HE staining result of the frozen testis tissue section of the mice after the poisoning experiment is shown in Figure 1 ;

[0147] As shown in Figure 1 , in the control group, 5-7 layers of spermatogenic cells can be seen in the seminiferous tubules, the cells are polar, and the arrangement is neat. A small amount of short spindle-shaped Sertoli cells can be seen between the spermatogenic cells. Spermatogenesis can be seen in the lumen. In the lead poisoning group, the number of spermatogenic cells in the seminiferous tubules is significantly reduced, and there are only 3-4 layers. A small amount of sperm can be seen in the lumen. In the lead poisoning group + smearing group, compared with the lead poisoning group, the number of spermatogenic cells in the seminiferous tubules increases, and there are 5-6 layers. The wall of the seminiferous tubules is slightly increased, and spermatogenesis can be seen in the lumen;

[0148] (2) Detection of mouse semen parameters

[0149] After the mice are sacrificed, the bilateral epididymal tails are cut longitudinally and placed in a 6-well plate containing 1 mL of HTF. The plate is placed on a constant temperature platform at 37°C for 2 min, and a pipette is used to gently blow the epididymal tail five times to obtain the sample;

[0150] The above operation is to ensure that the sperm can be completely separated from the epididymal tail;

[0151] Take 20 μL of epididymal tail liquid sample into 1 mL of HTF culture solution, put it into an EP tube, and prepare in advance in a 37 ℃ water bath; after shaking and mixing, take out 40 μL of the mixed solution into a disposable sperm analysis plate, then use the sperm automatic detection and analysis system (CASA) to detect the sperm, and count 500 sperm per mouse;

[0152] Among them, the sperm motility related indexes are: percentage of forward moving sperm PR, percentage of forward moving and non forward moving sperm PR+NP, percentage of super-activated sperm, average curve speed VCL (μm / s), average straight line speed VSL (μm / s), average path speed VAP (μm / s), moving forward STR (%), average side swing amplitude ALH (μm) and average whipping frequency BCF (Hz).

[0153] After the detection is completed, the obtained results are comprehensively statistically analyzed by using statistical software SPSS 26.0 and R 4.2.1; for continuous variables conforming to normal distribution, mean ± standard deviation (Mean ± SD) is used for description, and the differences between two groups are compared by t test; on this basis, further pairwise comparison between groups is carried out; if the variances between groups are equal, LSD method is used for comparison; if the variances are not equal, Dunnett-t method is used; for data not conforming to normal distribution, median (M) and quartile (P25, P75) are used for description, and Kruskal-Wallis H statistical method is used to compare the differences between two groups; the results are shown in Tables 2 and Figure 2 、 Figure 3

[0154] Table 2 Average level of epididymal sperm quality parameters of lead and DBP exposed model mice

[0155]

[0156]

[0157] Note: single factor analysis of variance is used for data conforming to normal distribution, and non-parametric test is used for data not conforming to normal distribution

[0158] a: compared with the control group; c: pairwise comparison between dose groups; i: control group, Pb, Pb+TC; o: control group, DBP, DBP+TC

[0159] **P<0.01, *P<0.05

[0160] ​As shown in Table 2, the results of the epididymal sperm quality parameter analysis of the mice showed that the percentage of forward-moving sperm of the lead-doped group, the lead-doped + smearing intervention group and the DBP-doped group was significantly lower than that of the control group (all p<0.05); the percentage of non-forward-moving sperm of the lead-doped group, the lead-doped + smearing intervention group and the DBP-doped group was significantly lower than that of the control group (all p<0.01); the multiple sperm quality parameters of the mice in the DBP-doped group were significantly lower than those of the control group (all p<0.01); the multiple sperm quality parameters of the mice in the DBP-doped + smearing intervention group were significantly higher than those of the control group (all p<0.01).

[0161] Example 3

[0162] The present embodiment discloses a method for establishing a mouse high-temperature model and a mouse aging model, comprising the following steps:

[0163] Step (1), selecting experimental objects;

[0164] The control group of mice were 5-month-old mice, which were bred in an animal room at 25℃, and were provided with sufficient water and food without any intervention; the high-temperature intervention group and the high-temperature treatment group of mice were 5-month-old; the aging treatment group and the aging group of mice were 19-month-old;

[0165] Step (2), constructing a high-temperature model and an aging model;

[0166] 2.1, constructing a high-temperature model;

[0167] The temperature and humidity of the HOPE-MED 8050D small extreme environment simulation cabin were set to 37.5℃ and 60%, and the light was set to 50%. When the temperature was preheated to 37.5℃ and the humidity reached 60%, the mice were placed in the small extreme environment simulation cabin for 2h, during which sufficient water and real objects were provided for the mice to freely eat. The mice were placed in the cabin once a day from Monday to Saturday, with an interval of 24 hours each time. After high temperature, the mice were immediately taken out and allowed to recover at room temperature for one hour. The scrotal skin area of the high-temperature intervention group was smeared with gel, and the high-temperature group was not smeared. Then the mice were put back into the animal room for breeding. After four weeks of high-temperature intervention, the high-temperature intervention was stopped, and the high-temperature treatment group continued to be smeared for 3 weeks, while the high-temperature group did not receive any other intervention. Each group of mice consisted of 6-8 mice. One mouse in the high-temperature group died during the high-temperature process.

[0168] 2.2, constructing a high-temperature model;

[0169] The scrotal skin of the aging treatment group was smeared with the hydrogel preparation prepared in Example 1 once a day from Monday to Saturday, with an interval of 24h each time, and the mice were put back into the animal room after treatment. Three mice in the aging treatment group and two mice in the aging group died due to aging.

[0170] Table 3: Organ weights and organ coefficients of high-temperature and aging groups of mice

[0171]

[0172]

[0173] Kidney coefficient

[0174]

[0175] Note: ANOVA was used for normal distribution, and Kruskal-waills was used for non-normal distribution; There was a difference in the level of sperm hyperactivation among the three groups in the aging treatment study (P = 0.081), and the hyperactivation in the aging treatment group was significantly higher than that in the aging group (P < 0.05), and the VSL in the aging treatment group was significantly higher than that in the aging group (P < 0.05), but the difference in VSL level among the three groups was not significant (P = 0.108); There were significant differences in hyperactivation, VSL, STR, and BCF among the three groups in the high temperature treatment study (P < 0.05), and the hyperactivation, VSL, STR, and BCF in the high temperature group were significantly higher than those in the control group (P < 0.05), and there were differences in PR, PRNP, VCL, VAP, and ALH among the three groups (P < 0.1), and the levels of PR, PRNP, VCL, VAP, and ALH in the high temperature group were higher than those in the control group (P < 0.05).

[0176] Table 4 Average level of epididymal sperm quality parameters in high temperature and aging groups

[0177]

[0178]

[0179] Note: ANOVA was used for normal distribution, and Kruskal-waills test was used for non-normal distribution.

[0180] a: compared with the control group; c: pairwise comparison of dose groups; i: control group, aging treatment group, aging group; o: control group, high temperature treatment group, high temperature group

[0181] **P < 0.01, *P < 0.05

[0182] From Table 4, Figures 4-5 It can be seen from Table 4 that compared with the control group, the percentage of forward motility sperm PR, PR+NP, hyperactivation, VCL, VSL, VAP, and STR in the high temperature group were significantly reduced (all p < 0.01); Compared with the high temperature group, the sperm parameters of the high temperature treatment group were improved, especially the sperm hyperactivation rate and STR were significantly increased (all p < 0.05). The sperm parameters of the aging group were lower than those of the control group, and the hyperactivation sperm rate of the aging treatment group was significantly higher than that of the aging group, and the difference was statistically significant (p < 0.05).

[0183] While embodiments of the application have been shown and described, it is to be understood that the application is not limited to the details of the embodiments described, since numerous changes, modifications, substitutions and variations can be made thereto without departing from the spirit and scope of the application as defined by the appended claims and their equivalents.

Images