Application of substance for reducing activity and / or expression quantity of RPL22 protein in delaying senescence
By reducing the activity and expression of RPL22 protein and regulating RPL22 using sgRNA and Cas protein, the unknown role of ribosomal proteins in the aging process was solved, achieving the effects of delaying cell aging and improving heterochromatin stability.
Patent Information
- Application Number
- CN202411981800.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Priority Date
- 2024-04-10
- Filing Date
- 2024-12-31
- Publication Date
- 2025-10-17
AI Technical Summary
The role of ribosomal protein RPL22 in the aging process has not been fully studied in the existing technology, and there are insufficient means to regulate ribosomal proteins during the aging process, which leads to accelerated cellular senescence.
By reducing the activity and expression level of RPL22 protein, sgRNA can be used to recognize specific DNA molecular targets and bind to Cas protein to prepare products that regulate the expression of RPL22 protein, including sgRNA-encoding genes and Cas protein-encoding genes, for the preparation of drugs to delay aging or for the research of aging-related diseases.
It significantly delays cell senescence, improves heterochromatin stability, inhibits rRNA expression, reduces the expression of senescence-related markers, prolongs cell telomeres, reduces DNA damage, and enhances cell proliferation.
Smart Images

Figure HDA0005221718080000011 
Figure HDA0005221718080000021 
Figure HDA0005221718080000031
Abstract
Description
TECHNICAL FIELD
[0001] The present application belongs to the field of biomedicine, and particularly relates to application of a substance for reducing RPL22 protein activity and / or expression amount in delaying aging. BACKGROUND
[0002] Aging is a process of degenerative changes occurring at various levels of organs, tissues and cells of an organism. As the basic structural and functional unit of an organism, cell aging is considered to be an important driving factor of organismal aging. Human mesenchymal progenitor cells (hMPCs) can be differentiated into various types of cells (such as adipocytes, chondrocytes, osteoblasts) under certain conditions, and then repair and renew corresponding tissues and organs. One of the important markers of individual aging is the aging and depletion of stem cells, and the aging and depletion of mesenchymal progenitor cells can trigger the aging of multiple tissues and organs. Studies have shown that hMPCs undergo various gene expression and epigenetic changes during aging, such as increased expression of ribosomal DNA (rDNA), decreased expression of H3K9me3 and other heterochromatin-related markers, and heterochromatin depolymerization. In young cells, the expression of rDNA is low, and the heterochromatin is more stable. Therefore, the expression of rDNA and the stability of heterochromatin can be used as a target for cell aging intervention.
[0003] Ribosomes are the machines of cell translation and the sites of protein synthesis, and play an important role in cell life activities. Ribosomes are composed of ribosomal proteins (RPs) and rRNA (Ribosomal RNA, rRNA). After rRNA is transcribed in the nucleolus rDNA, it is exported from the nucleus and assembled with ribosomal proteins to form ribosomes. Ribosomes are divided into two subunits (60S large subunit and 40S small subunit), and the 60S large subunit contains 47 ribosomal proteins and 5S, 5.8S and 28S rRNA, and the 40S small subunit contains 33 ribosomal proteins and 18S rRNA. Ribosomes, as protein synthesis machines, are involved in multiple life processes, but there are few reports on the relationship between ribosomal proteins and aging.
[0004] RPL22 protein is a ribosomal protein on the 60S large subunit of ribosomes. Current research on RPL22 protein mainly focuses on tumor occurrence and immune-related fields, and there is no research on the role of RPL22 protein in aging and the nuclear function of RPL22 protein. SUMMARY
[0005] The purpose of the present application is to delay aging.
[0006] The present application first protects the use of a substance that reduces the activity and / or expression amount of RPL22 protein in the preparation of a product; the function of the product can be at least one of the following C1) to C6): C1) delaying aging; C2) preventing diseases related to aging; C3) treating diseases related to aging; C4) inhibiting heterochromatin disassembly; C5) increasing heterochromatin stability; and C6) inhibiting the expression level of rRNA.
[0007] The present application also protects the use of a substance that reduces the activity and / or expression amount of RPL22 protein, which can be at least one of the following C1) to C6): C1) delaying aging; C2) preventing diseases related to aging; C3) treating diseases related to aging; C4) inhibiting heterochromatin disassembly; C5) increasing heterochromatin stability; and C6) inhibiting the expression level of rRNA.
[0008] In any of the above-mentioned applications, the substance that reduces the activity and / or expression amount of RPL22 protein can include an sgRNA coding gene; the target point recognized by the sgRNA is a DNA molecule represented by SEQ ID NO: 1 or SEQ ID NO: 2.
[0009] When the target point recognized by the sgRNA is a DNA molecule represented by SEQ ID NO: 1, the substance that reduces the activity and / or expression amount of RPL22 protein can be an oligo dimer 1 composed of a DNA molecule represented by SEQ ID NO: 4 and a DNA molecule represented by SEQ ID NO: 5.
[0010] When the target point recognized by the sgRNA is a DNA molecule represented by SEQ ID NO: 2, the substance that reduces the activity and / or expression amount of RPL22 protein can be an oligo dimer 2 composed of a DNA molecule represented by SEQ ID NO: 6 and a DNA molecule represented by SEQ ID NO: 7.
[0011] The substance that reduces the activity and / or expression amount of RPL22 protein can also include a coding gene of Cas protein.
[0012] In any of the above-mentioned applications, in C1), the delay of aging can be the delay of cell aging. Preferably, the cell can be human mesenchymal progenitor cells, human fibroblasts, or human endothelial cells. Preferably, the aging of human mesenchymal progenitor cells can be pathological aging, stress-induced aging, or replicative aging. Preferably, the human endothelial cells can be human umbilical vein endothelial cells or human coronary artery endothelial cells.
[0013] The present application also protects the use of RPL22 protein as a drug target in the preparation of products; the functions of the products can be at least one of the following C1) to C6): C1) delaying aging; C2) preventing diseases related to aging; C3) treating diseases related to aging; C4) inhibiting heterochromatin disassembly; C5) increasing heterochromatin stability; C6) inhibiting the expression level of rRNA.
[0014] In the above application, in C1), the delay of aging can be the delay of cell aging. Preferably, the cell can be human mesenchymal progenitor cells, human fibroblasts or human endothelial cells. Preferably, the aging of human mesenchymal progenitor cells can be pathological aging, stress-induced aging or replicative aging. Preferably, the human endothelial cells can be human umbilical vein endothelial cells or human coronary artery endothelial cells.
[0015] The present application also protects the use of RPL22 protein in the preparation of products; the functions of the products can be at least one of A1) to A6): A1) promoting aging; A2) studying diseases related to aging; A3) preparing a mouse model with an early aging phenotype; A4) promoting heterochromatin disassembly; A5) reducing heterochromatin stability; A6) promoting the expression level of rRNA.
[0016] The present application also protects the use of RPL22 protein, which can be at least one of A1) to A6): A1) promoting aging; A2) studying diseases related to aging; A3) preparing a mouse model with an early aging phenotype; A4) promoting heterochromatin disassembly; A5) reducing heterochromatin stability; A6) promoting the expression level of rRNA.
[0017] In any of the above applications, in A1), promoting aging can be promoting cell aging. Preferably, the cell can be human mesenchymal progenitor cells, human fibroblasts or human endothelial cells. Preferably, the aging of human mesenchymal progenitor cells can be pathological aging, stress-induced aging or replicative aging. Preferably, the human endothelial cells can be human umbilical vein endothelial cells or human coronary artery endothelial cells.
[0018] The present application obtains the following conclusions through a large number of experiments:
[0019] 1. Reducing the activity and / or expression level of RPL22 protein can significantly alleviate the aging phenotype of cells. Specifically, knockout of RPL22 protein can increase the number of cell passages, enhance cell proliferation, significantly reduce the positive rate of aging-related β-galactosidase, reduce the expression level of P16, up-regulate the levels of LaminB1 and LAP2 proteins, reduce the secretion level of aging-related secretory phenotype such as IL-6, prolong the telomere of cells, reduce DNA damage, reduce the nuclear area, up-regulate genes related to cell division and DNA replication, and down-regulate genes related to inflammatory factors.
[0020] 2. The expression of RPL22 protein can significantly promote the aging of young hMPCs. Specifically, after overexpression of RPL22 protein in young hMPCs, the proliferation ability of the cells is significantly decreased, the positive rate of aging-related β-galactosidase is significantly increased, the expression level of P16 is increased, the protein levels of LaminB1 and LAP2 are decreased, the secretion level of aging-related secretory phenotype such as IL-6 is increased, the telomere of the cells is shortened, the DNA damage is increased, the nuclear area is increased, the cell proliferation-related genes are down-regulated, and the like.
[0021] 3. The RPL22 protein induces rRNA expression and destroys the nucleolus structure in the aging process of hMPCs.
[0022] 4. The RPL22 protein induces the down-regulation of heterochromatin-related proteins such as HP1γ, KAP1 and H3K9me3 on the nucleolar rDNA region in the aging process of hMPCs, and further induces the decondensation of heterochromatin.
[0023] 5. The deletion of RPL22 protein can delay the aging of hMPCs, and the overexpression of RPL22 protein can promote the aging of human endothelial cells. It can be seen that the expression of RPL22 protein increases in the process of cell aging. The overexpression of RPL22 protein leads to the aging of hMPCs, and the deletion of RPL22 protein delays the aging of hMPCs.
[0024] In addition, RPL22 can induce the decrease of HP1γ, KAP1 and H3K9me3 heterochromatin protein levels on the heterochromatin region of nucleolar rDNA in the process of aging or overexpression, and further induce the decondensation of heterochromatin, increase the transcription level of rDNA, lead to the increase of rRNA expression, and affect the nucleolus structure. The deletion of RPL22 can alleviate the occurrence of the above phenotypes. Therefore, RPL22 can be used as a potential target for preventing, alleviating or treating aging or aging-related diseases. The present application has important application value. BRIEF DESCRIPTION OF DRAWINGS
[0025] Figure 1CRISPR / Cas9-based screening of ribosome-related genes promotes hMPC aging. A is a schematic diagram of the CRISPR / Cas9-based screening of ribosome-related genes to identify aging-promoting genes in RS-hMPCs (Replicative-senescent hMPCs); B is the enrichment level of each gene determined 2, 5, 8, and 10 weeks after the ribosome-related gene screening lentiviral library was infected with replicative senescent RS-hMPCs; C is a Venn diagram showing the enriched genes of two repeated screenings (repeat 1 at 10 weeks and repeat 2 at 12 weeks), and the overlapping 9 genes are shown in the table; D is a Western blot analysis of RPL22 protein levels in early and late generation RS-hMPCs; E is a protein blot analysis of RPL22 protein levels in RS-hMPCs after lentiviral-mediated CRISPR knockout of sgRPL22. F is the analysis of clonal expansion of RS-hMPCs after sgRPL22 lentivirus-mediated CRISPR knockout; G is the immunofluorescence staining analysis of Ki67 in RS-hMPCs after sgRPL22 lentivirus-mediated CRISPR knockout, the scale bar is 10 μm; H is the SA-β-Gal staining analysis of RS-hMPCs after sgRPL22 lentivirus-mediated CRISPR knockout, the scale bar is 100 μm; I is the Western blot analysis of P16 and P21 protein levels in RS-hMPCs after sgRPL22 lentivirus-mediated CRISPR knockout; J is the ELISA analysis of IL-6 secretion in RS-hMPCs after sgRPL22 lentivirus-mediated CRISPR knockout.
[0026] Figure 2 The loss of RPL22 protein alleviates the aging of hMPCs. A is RPL22 from hESCs + / + and RPL22 - / - Schematic diagram of the generation of hMPCs; B is RPL22 + / + and RPL22 - / - Western blot analysis of RPL22 protein in hMPCs; C is RPL22 + / + and RPL22 - / - Growth curve analysis of hMPC; D is RPL22 + / + and RPL22 - / - Analysis of clonal expansion experiments of hMPCs; E stands for RPL22 + / + and RPL22 - / - Immunofluorescence staining analysis of Ki67 in hMPCs, scale bar is 10 μm; F is RPL22 + / + and RPL22 - / - Immunofluorescence staining analysis of EdU in hMPCs, scale bar: 10 μm; G: RPL22+ / + and RPL22 - / - SA-β-Gal staining analysis of hMPCs, scale bar 100 pm; H is RPL22 + / + and RPL22 - / - Western blot analysis of P16, Lamin B1 and LAP2 protein levels in hMPCs; I is RPL22 + / + and RPL22 - / - Immunofluorescence staining analysis of LAP2 intensity in hMPCs, scale bar 10 pm; J is RPL22 + / + and RPL22 - / - ELISA analysis of IL-6 secretion in hMPCs; K is RPL22 + / + and RPL22 - / - Real-time quantitative PCR analysis of telomere length in hMPCs; L is RPL22 + / + and RPL22 - / - Immunofluorescence staining analysis of yH2AX and 53BP1 in hMPCs, scale bar 5 pm; M is RPL22 + / + and RPL22 - / - Nuclear area analysis of hMPCs, scale bar 20 pm (left) and 5 pm (right); N is a Venn diagram showing the overlapping DEGs of RS-hMPCs (RPL22 + / + hMPCs, EP and LP compared) and RPL22 - / - Overlapping DEGs in hMPCs (LP, compared to RPL22 + / + hMPCs); O is a bar graph showing the differentially expressed genes related GO pathway analysis rescued by the knock-out of RPL22 protein.
[0027] Figure 3Aging is accelerated by overexpression of RPL22 protein in hMPCs. A, Western blot analysis of RPL22 protein levels in young hMPCs infected with lentivirus overexpressing Flag-Luc or Flag-RPL22; B, clonogenic assay analysis in young hMPCs infected with lentivirus overexpressing Luc or RPL22; C, immunofluorescence staining analysis of Ki67 in young hMPCs infected with lentivirus overexpressing Luc or RPL22, scale bar, 10 pm; D, SA-b-Gal staining analysis in young hMPCs infected with lentivirus overexpressing Luc or RPL22, scale bar, 100 pm; E, Western blot analysis of P16, Lamin B1 and LAP2 protein levels in young hMPCs infected with lentivirus overexpressing Luc or RPL22; F, immunofluorescence staining analysis of LAP2 in young hMPCs infected with lentivirus overexpressing Luc or RPL22, scale bar, 10 pm; G, ELISA analysis of IL-6 secretion in young hMPCs infected with lentivirus overexpressing Luc or RPL22; H, real-time quantitative PCR analysis of telomere length in young hMPCs infected with lentivirus overexpressing Luc or RPL22; I, immunofluorescence staining analysis of yH2AX and 53BP1 in young hMPCs infected with lentivirus overexpressing Luc or RPL22, scale bar, 5 pm; J, nuclear area analysis in young hMPCs infected with lentivirus overexpressing Luc or RPL22, scale bar, 20 pm (left) and 5 pm (right); K, volcano plot showing up-regulated (red) or down-regulated (green) differential genes in young hMPCs infected with lentivirus overexpressing Luc or RPL22; L, dot plot showing GO pathways associated with up-regulated (red) and down-regulated (green) differential genes in young hMPCs infected with lentivirus overexpressing RPL22 protein compared to Luc.
[0028] Figure 4 RPL22 protein induces rRNA expression during hMPCs aging. A, schematic diagram of RPL22 protein; B, clonogenic assay analysis in RPL22 WT hMPCs infected with lentivirus overexpressing Luc, RPL22 or RPL22 ΔN9 / C8 ; C, immunofluorescence staining analysis of Ki67 in RPL22 m88A hMPCs infected with lentivirus overexpressing Luc, RPL22 or RPL22 m13-m16 ; D, SA-b-Gal staining analysis in RPL22 ΔN9 / C8 hMPCs infected with lentivirus overexpressing Luc, RPL22 or RPL22 - / - ; E, Western blot analysis of P16, Lamin B1 and LAP2 protein levels in RPL22 ΔN9 / C8 hMPCs infected with lentivirus overexpressing Luc, RPL22 or RPL22 - / -hMPCs were subjected to immunofluorescence staining analysis for Ki67, scale bar 10 μm; D is hMPCs infected with lentivirus overexpressing Luc, RPL22 or RPL22 ΔN9 / C8 hMPCs were subjected to immunofluorescence staining analysis for Ki67, scale bar 10 μm; D is hMPCs infected with lentivirus overexpressing Luc, RPL22 or RPL22 - / - hMPCs were subjected to SA-β-Gal staining analysis, scale bar 100 μm; E is the immunofluorescence three-dimensional reconstruction of RPL22 and Nucleolin in early and late passage cells of RS-hMPCs, scale bar 5 μm; F is the analysis of nucleolar area and percentage of cells with the indicated number of nucleoli in hMPCs; G is the analysis of nucleolar area and percentage of cells with the indicated number of nucleoli in hMPCs infected with lentivirus overexpressing Luc or RPL22 in young hMPCs; H is the Northern blot analysis of rRNA (28S, 18S and 5.8S) levels in young hMPCs infected with lentivirus overexpressing Luc or RPL22; I is the Northern blot analysis of rRNA (28S, 18S and 5.8S) levels in late passage RPL22 + / + and RPL22 - / - hMPCs were subjected to immunofluorescence three-dimensional reconstruction of Nucleolin, analysis of nucleolar area and percentage of cells with the indicated number of nucleoli, scale bar 5 μm; J is the Northern blot analysis of rRNA (28S, 18S and 5.8S) levels in late passage RPL22 + / + and RPL22 - / - hMPCs were subjected to immunofluorescence three-dimensional reconstruction of Nucleolin, analysis of nucleolar area and percentage of cells with the indicated number of nucleoli, scale bar 5 μm; J is the Northern blot analysis of rRNA (28S, 18S and 5.8S) levels in late passage RPL22 m88A and RPL22 - / - hMPCs were subjected to immunofluorescence three-dimensional reconstruction of Nucleolin, analysis of nucleolar area and percentage of cells with the indicated number of nucleoli, scale bar 5 μm; J is the Northern blot analysis of rRNA (28S, 18S and 5.8S) levels in late passage RPL22 m88A and RPL22 - / - hMPCs were subjected to immunofluorescence three-dimensional reconstruction of Nucleolin, analysis of nucleolar area and percentage of cells with the indicated number of nucleoli, scale bar 5 μm; J is the Northern blot analysis of rRNA (28S, 18S and 5.8S) levels in late passage RPL22 m88A and RPL22 - / - hMPCs were subjected to SA-β-Gal staining analysis, scale bar 100 μm.
[0029] Figure 5RPL22 binds to rDNA and disrupts the stability of HP1y and KAP1 in senescent hMPCs. A, a network diagram showing the interaction of heterochromatin-associated proteins with RPL22; B, Western blot analysis of KAP1, HP1y and H3K9me3 protein levels in early and late passage RS-hMPCs; C, Co-IP experiment analysis of exogenous interaction between RPL22 and HP1y or KAP1 in Flag-Luc transfected HEK293T cells; D, Co-IP experiment analysis showing the presence of interaction between endogenous RPL22 and HP1y or KAP1 in early passage WT-hMPCs; E and F, Western blot analysis of KAP1, HP1y and H3K9me3 protein levels in young hMPCs (E) or RPL22 - / - hMPCs (F) infected with lentivirus overexpressing Luc or RPL22; G, Western blot analysis of KAP1 and HP1y protein levels in RPL22 m88A hMPCs infected with lentivirus overexpressing Flag-Luc, Flag-RPL22 or Flag-RPL22 - / - hMPCs; H, Western blot analysis of HP1y or KAP1 in young hMPCs infected with lentivirus overexpressing Flag-Luc or Flag-RPL22 with or without MG132 (20 mM, 12 hours) treatment; I, RPL22 + / + and RPL22 - / - hMPCs; J-L, Relative enrichment of HP1y (J), KAP1 (K) or H3K9me3 (L) on rDNA regions in young hMPCs infected with lentivirus overexpressing Luc or RPL22; M-O, Relative enrichment of HP1y (M), KAP1 (N) or H3K9me3 (O) on rDNA regions in RPL22 + / + and RPL22 - / - hMPCs; P, Colony expansion experiment analysis in RPL22 - / - hMPCs infected with lentivirus expressing sh-GL2, sh-HP1y or sh-KAP1; Q, Immunofluorescence staining analysis of Ki67 in RPL22 - / - hMPCs infected with lentivirus expressing sh-GL2, sh-HP1y or sh-KAP1; R, SA-β-Gal staining analysis in RPL22 - / - hMPCs infected with lentivirus expressing sh-GL2, sh-HP1y or sh-KAP1; R, SA-β-Gal staining analysis in RPL22
[0030] Figure 6 Depletion of RPL22 protein can rescue the senescence of human cells. A and C are clonogenic assay analysis in late passage HGPS-hMPCs (A) and WS-hMPCs (C) after lentivirus-mediated CRISPR knockout with sgRPL22; B and D are SA-β-Gal staining analysis in late passage HGPS-hMPCs (B) and WS-hMPCs (D) after lentivirus-mediated CRISPR knockout with sgRPL22, scale bar is 100 μm; E and G are clonogenic assay analysis in UV or H2O2-induced hMPCs senescence model after lentivirus-mediated CRISPR knockout with sgRPL22; F and H are SA-β-Gal staining analysis in UV or H2O2-induced hMPCs senescence model after lentivirus-mediated CRISPR knockout with sgRPL22, scale bar is 100 μm; I is clonogenic assay analysis in senescent primary hMPCs after lentivirus-mediated CRISPR knockout with sgRPL22; J is SA-β-Gal staining analysis in senescent primary hMPCs after lentivirus-mediated CRISPR knockout with sgRPL22, scale bar is 100 μm; K and M are clonogenic assay analysis in hCAECs (K) or hUVECs (M) infected with lentivirus overexpressing Luc or RPL22; L and N are SA-β-Gal staining analysis in hCAECs (L) or hUVECs (N) infected with lentivirus overexpressing Luc or RPL22, scale bar is 100 μm.
[0031] Figure 7 Depletion of RPL22 protein can rescue the senescence of human cells. A and C are clonogenic assay analysis in late passage HGPS-hMPCs (A) and WS-hMPCs (C) after lentivirus-mediated CRISPR knockout with sgRPL22; B and D are SA-β-Gal staining analysis in late passage HGPS-hMPCs (B) and WS-hMPCs (D) after lentivirus-mediated CRISPR knockout with sgRPL22, scale bar is 100 μm; E and G are clonogenic assay analysis in UV or H2O2-induced hMPCs senescence model after lentivirus-mediated CRISPR knockout with sgRPL22; F and H are SA-β-Gal staining analysis in UV or H2O2-induced hMPCs senescence model after lentivirus-mediated CRISPR knockout with sgRPL22, scale bar is 100 μm; I is clonogenic assay analysis in senescent primary hMPCs after lentivirus-mediated CRISPR knockout with sgRPL22; J is SA-β-Gal staining analysis in senescent primary hMPCs after lentivirus-mediated CRISPR knockout with sgRPL22, scale bar is 100 μm; K and M are clonogenic assay analysis in hCAECs (K) or hUVECs (M) infected with lentivirus overexpressing Luc or RPL22; L and N are SA-β-Gal staining analysis in hCAECs (L) or hUVECs (N) infected with lentivirus overexpressing Luc or RPL22, scale bar is 100 μm.
[0032] Figure 8The deletion of RPL22 protein does not affect the proliferation ability, pluripotent stemness and genomic stability of hESCs. A is the schematic diagram of CRISPR / Cas9-mediated gene editing to knock out RPL22, and 1bp and 8bp deletions are detected in the first allele and the second allele, respectively; B is the Western blot analysis of RPL22 + / + and RPL22 - / - The sequencing results of two allelic mutations in hESCs; C is the Western blot analysis of RPL22 + / + and RPL22 - / - The Western blot analysis of RPL22 protein level in hESCs; D is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The immunofluorescence staining analysis of RPL22 protein in hESCs, the scale bar is 20μm; E is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The immunofluorescence staining analysis of Ki67 in hESCs, the scale bar is 20μm; F is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The immunofluorescence staining analysis of cell morphology, NANOG, SOX2 and OCT4 in hESCs, the scale bar of bright field image is 200μm, and the scale bar of immunofluorescence image is 20μm; G is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The immunofluorescence staining analysis of three germ layers in teratoma of hESCs, the scale bar is 20μm; H is the immunofluorescence staining analysis of RPL22 - / - The karyotype analysis of hESCs; I is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The gene copy number variation analysis of hESCs.
[0033] Figure 9 The deletion of RPL22 protein alleviates the senescence of hMPCs. A is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The flow cytometry analysis of CD73, CD90 and CD105 in hMPCs; B is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The gene copy number variation analysis of hMPCs; C is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The adipogenic differentiation ability analysis of hMPCs, the scale bar is 100μm; D is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / - The chondrogenic differentiation ability analysis of hMPCs, the scale bar is 100μm; E is the immunofluorescence staining analysis of RPL22 + / + and RPL22 - / -hMPCs, scale bar 100 pm; F is RS hMPCs (RPL22 + / + Volcano plot representation of differentially expressed genes in hMPCs, LP vs EP; G is RPL22 + / + and RPL22 - / - Volcano plot representation of differentially expressed genes in hMPCs; H is RS hMPCs (RPL22 + / + hMPCs, LP vs EP) upregulated (left) and downregulated (right) genes expression reversed by RPL22 knockout; I is heatmap analysis of downregulated differentially expressed genes in young hMPCs infected with lentivirus overexpressing Luc or RPL22.
[0034] Figure 10 RPL22 induces an increase in rRNA expression. Wherein A is in RPL22 + / + and RPL22 - / - Global protein translation level analysis in hMPCs; B is RPL22 WT or Flag-RPL22 ΔN9 / C8 protein level analysis in RPL22 - / - hMPCs; C is agarose gel analysis of rRNA (28S and 18S) levels in RS hMPCs in early and late passages; D is qPCR analysis of rRNA (28S and 18S) levels in RS hMPCs in early and late passages; E is agarose gel analysis of rRNA (28S and 18S) levels in young cells after transfection with Luc or RPL22 virus; F is qPCR analysis of rRNA (28S and 18S) levels in young cells after transfection with Luc or RPL22 virus; G is agarose gel analysis of rRNA (28S and 18S) levels in late passage RPL22 + / + and RPL22 - / - hMPCs; H is qPCR analysis of rRNA (28S and 18S) levels in late passage RPL22 + / + and RPL22 - / - hMPCs; I is 45S pre-rRNA level analysis in young hMPCs after infection with Luc or RPL22 virus; J is 45S pre-rRNA level analysis in RPL22 + / + and RPL22 - / - hMPCs; K is RPL22 WT or Flag-RPL22 m88A protein level analysis in RPL22 - / - hMPCs; L is RPL22 WTor RPL22 m88A RPL22 - / - RPL22 WT RPL22 m88A RPL22 - / - RPL22 WT RPL22 m13-16 RPL22 - / - RPL22 WT RPL22 m13-16 RPL22 - / - Flag immunofluorescence staining of hMPCs, scale bar, 5 pm; P, RPL22 WT RPL22 m13-16 RPL22 - / - RPL22 WT RPL22 m13-16 RPL22 - / - SA-p-Gal staining analysis in hMPCs overexpressing Luc, RPL22
[0035] Figure 11 RPL22 binds rDNA and causes destabilization of HP1y and KAP1 in senescent hMPCs. A, schematic of Co-IP binding LC-MS analysis to identify RPL22 interacting proteins; B, GO cellular component enrichment analysis of RPL22 interacting proteins; C, exogenous HP1y has protein interaction with RPL22; D, exogenous KAP1 has protein interaction with RPL22; E, immunofluorescence analysis of H3K9me3 in RPL22 overexpressing hMPCs, scale bar, 10 pm; F, RPL22 + / + and RPL22 - / -Immunofluorescence analysis of H3K9me3 in hMPCs, scale bar is 10 μm; G is immunofluorescence analysis of H3K9me3 in RS-hMPCs after CRISPR knockout mediated by sgRPL22 lentivirus, scale bar is 10 μm; H is a schematic diagram of primers for 28S and 5.8S in the rDNA region in ChIP-qPCR; I is the enrichment level of RPL22 in the rDNA region in early and late generation hMPCs; J is the enrichment level of HP1γ in the rDNA region in early and late generation hMPCs; K is the enrichment level of KAP1 in the rDNA region in early and late generation hMPCs; L is the enrichment level of H3K9me3 in the rDNA region in early and late generation hMPCs; M is the enrichment level of Luc and RPL22 in the rDNA region in early and late generation hMPCs WT or RPL22 m88A RPL22 - / - The enrichment level of Flag in the rDNA region in hMPCs; N represents the overexpression of Luc, RPL22 WT or RPL22 m88A RPL22 - / - The enrichment level of HP1γ in the rDNA region of hMPCs; O represents overexpression of Luc and RPL22 WT or RPL22 m88A RPL22 - / - The enrichment level of KAP1 in the rDNA region in hMPCs.
[0036] Figure 12 RPL22 binds to rDNA in aging hMPCs and leads to the instability of HP1γ and KAP1. WT or RPL22 m88A RPL22 - / - The enrichment level of H3K9me3 in the rDNA region in hMPCs; Q is the late generation RPL22 + / + and RPL22 - / - H3K9me3 ChIP-seq signals in the rDNA region of hMPCs; R represents late generation RPL22 + / + and RPL22 - / - Violin plots showing H3K9me3 ChIP-seq signals in the rDNA region of hMPCs; S represents RPL22 - / - Analysis of HP1γ protein levels in hMPCs transfected with sh-GL2, sh-HP1γ, or sh-KAP1 viruses; T represents RPL22 - / - Analysis of KAP1 protein levels after hMPCs were transfected with sh-GL2, sh-HP1γ, or sh-KAP1 viruses; U represents RPL22 - / -Agarose gel analysis of rRNA (28S and 18S) levels in hMPCs after transfection with sh-GL2, sh-HP1y or sh-KAP1 viruses.
[0037] Figure 13 RPL22 knockout alleviates senescence in HGPS and WS hMPCs. Wherein A is agarose gel analysis of rRNA (28S and 18S) levels in HGPS hMPCs; B is protein level analysis of RPL22 in HGPS hMPCs after RPL22 knockout by CRISPR and sgRPL22; C is agarose gel analysis of rRNA (28S and 18S) levels in HGPS hMPCs after RPL22 knockout by CRISPR and sgRPL22; D is growth curve analysis in HGPS hMPCs after RPL22 knockout by CRISPR and sgRPL22; E is Ki67 immunofluorescence staining analysis in HGPS hMPCs after RPL22 knockout by CRISPR and sgRPL22, scale bar is 10 pm; F is H3K9me3 immunofluorescence staining analysis in HGPS hMPCs after RPL22 knockout by CRISPR and sgRPL22, scale bar is 10 pm; G is agarose gel analysis of rRNA (28S and 18S) levels in WS hMPCs; H is protein level analysis of RPL22 in HGPS hMPCs after RPL22 knockout by CRISPR and sgRPL22; I is agarose gel analysis of rRNA (28S and 18S) levels in WS hMPCs after RPL22 knockout by CRISPR and sgRPL22; J is growth curve analysis in WS hMPCs after RPL22 knockout by CRISPR and sgRPL22; K is Ki67 immunofluorescence staining analysis in WS hMPCs after RPL22 knockout by CRISPR and sgRPL22, scale bar is 10 pm; L is H3K9me3 immunofluorescence staining analysis in WS hMPCs after RPL22 knockout by CRISPR and sgRPL22, scale bar is 10 pm.
[0038] Figure 14A, RPL22 protein level analysis after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by UV; B, rRNA (28S and 18S) level analysis by agarose gel after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by UV; C, Ki67 immunofluorescence staining analysis after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by UV, scale bar, 10 μm; D, H3K9me3 immunofluorescence staining analysis after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by UV, scale bar, 10 μm; E, RPL22 protein level analysis after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by H2O2; F, rRNA (28S and 18S) level analysis by agarose gel after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by H2O2; G, Ki67 immunofluorescence staining analysis after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by H2O2, scale bar, 10 μm; H, H3K9me3 immunofluorescence staining analysis after CRISPR and sgRPL22 knockout of RPL22 in hMPCs induced by H2O2, scale bar, 10 μm; I, rRNA (28S and 18S) level analysis by agarose gel after CRISPR and sgRPL22 knockout of RPL22 in old primary hMPCs. DETAILED DESCRIPTION
[0039] The present application will be further described in conjunction with the preferred embodiments thereof, given only by way of illustration of the present application, and not intended to limit the scope of the present application. The following examples provided as a guide for those of ordinary skill in the art to make further improvements, and do not constitute any way of limiting the present application.
[0040] The experimental methods in the following examples are all routine methods, and are carried out according to the techniques or conditions described in the literature in the art or according to the product instructions, unless otherwise specified. The materials, reagents, etc. used in the following examples can be obtained commercially, unless otherwise specified.
[0041] In the quantitative test in the following examples, three repeated experiments were set. All animal experiments were approved by the Animal Welfare Committee of the Institute of Animal Sciences, Chinese Academy of Sciences. The experimental data were expressed as mean ± standard deviation, and analyzed by GraphPad Prism 9 statistical software, and P<0.05 was considered to be a significant difference between groups.
[0042] In the following examples, the Gene ID of RPL22 protein is: 6146, and the Gene Bank number of the gene encoding RPL22 protein (i.e., RPL22 gene) is: NC_000001.11.
[0043] Example 1, reducing the content and / or activity of RPL22 protein can delay the aging of human mesenchymal progenitor cells
[0044] I. Preparation of recombinant lentivirus for reducing the content of human RPL22 protein
[0045] 1. Preparation of recombinant vector
[0046] According to the nucleotide sequence of the RPL22 gene, the target site is designed at the first start codon. In this embodiment, two target sites (named target site 1 and target site 2, respectively) and one control target site are selected for experiments. The sequence of target site 1 is: 5'-CATACTAACCACAGGAGCCA-3'(SEQ ID NO: 1), and the sequence of target site 2 is: 5'-CGCTGCCGCCATGGCTCCTG-3'(SEQ ID NO: 2), both of which correspond to the target gene RPL22 gene. The sequence of the control target site is: 5'-GTAGGCGCGCCGCTCTCTAC-3'(SEQ ID NO: 3).
[0047] (1) According to the target site 1, sgRPL22-1-F: 5'-CACCGCATACTAACCACAGGAGCCA-3'(SEQ ID NO: 4) and sgRPL22-1-R: 5'-CTGGCTCCTGTGGTTAGTATGCAAA-3'(SEQ ID NO: 5) are designed and synthesized. According to the target site 2, sgRPL22-2-F: 5'-CACCGCGCTGCCGCCATGGCTCCTG-3'(SEQ ID NO: 6) and sgRPL22-2-R: 5'-CCAGGAGCCATGGCGGCAGCGCAAA-3'(SEQ ID NO: 7) are designed and synthesized.
[0048] sgRPL22-2-F: 5'-CACCGCGCTGCCGCCATGGCTCCTG-3'(SEQ ID NO: 6) and sgRPL22-2-R: 5'-CCAGGAGCCATGGCGGCAGCGCAAA-3'(SEQ ID NO: 7) are designed and synthesized. According to the control target site, sgNTC-F: 5'-CACCGGTAGGCGCGCCGCTCTCTAC-3'(SEQ ID NO: 8) and sgNTC-R: 5'-CGTAGAGAGCGGCGCGCCTACCAAA-3'(SEQ ID NO: 9) are designed and synthesized.
[0049] (2) After annealing sgRPL22-1-F and sgRPL22-1-R, oligo dimer 1 was obtained. After annealing sgRPL22-2-F and sgRPL22-2-R, oligo dimer 2 was obtained. After annealing sgNTC-F and sgNTC-R, oligo dimer 3 was obtained.
[0050] (3) The lentiCRISPRv2 vector (Addgene, #52961) was digested with Esp3I (Thermo Scientific) to obtain the vector backbone.
[0051] (4) The vector backbone and oligo dimer 1 were ligated using T4 DNA ligase (NEB) to obtain sgRPL22 recombinant vector 1. The vector backbone and oligo dimer 2 were ligated using T4 DNA ligase (NEB) to obtain sgRPL22 recombinant vector 2. The vector backbone and oligo dimer 3 were ligated using T4 DNA ligase (NEB) to obtain a control recombinant vector.
[0052] sgRPL22 recombinant vector 1 and sgRPL22 recombinant vector 2 can be used to reduce the content of human RPL22.
[0053] 2. Preparation of recombinant lentivirus
[0054] The sgRPL22 recombinant vector 1 was co-transfected with the lentiviral packaging vectors psPAX2 (Addgene, #12260) and pMD2G (Addgene, #12259) into HEK293T cells to obtain the sgRPL22 recombinant lentivirus 1. The specific steps are as follows:
[0055] (1) HEK293T cells were co-transfected with the sgRPL22 recombinant vector 1, the lentiviral packaging vector psPAX2, and pMD2G using the Lipo3000 transfection kit (Thermo Scientific). The transfection ratio was as follows: 293T cells covering a 15 cm diameter culture dish: 21 μg sgRPL22 recombinant vector 1, 14 μg psPAX2, and 7 μg pMD2G. HEK293T cell culture medium was added and cultured in a cell culture incubator at 37°C for 8 h.
[0056] (2) After completing step (1), the old culture medium was replaced with fresh HEK293T cell culture medium and cultured in a 37°C cell culture incubator for 72 hours. The culture medium was collected at 24, 48, and 72 hours of culture and filtered through a 0.45 μm filter to remove dead cells and cell debris.
[0057] (3) After step (2) is completed, the culture solution is placed in an ultracentrifuge, centrifuged at 19400 rpm for 2 hours and 15 minutes at 4°C, the precipitate is collected and resuspended with PBS to obtain the sgRPL22 recombinant lentivirus 1 concentrate.
[0058] According to the above steps, the sgRPL22 recombinant vector 1 is replaced with the sgRPL22 recombinant vector 2, and the other steps remain unchanged to obtain the sgRPL22 recombinant lentivirus 2 concentrate.
[0059] According to the above steps, the sgRPL22 recombinant vector 1 is replaced with the control recombinant vector, and the other steps remain unchanged to obtain the control lentivirus sgNTC concentrate.
[0060] II. Screening of ribosome-related genes delaying the replicative senescence phenotype of human mesenchymal progenitor cells by lentivirus infection
[0061] 1. Human mesenchymal progenitor cells (induced and differentiated from embryonic stem cells) were used as test cells and infected with control lentivirus sgNTC, sgRPL22 recombinant lentivirus 1 and sgRPL22 recombinant lentivirus 2, respectively. The specific method is as follows: 6 μl of lentivirus concentrate (sgRPL22 recombinant lentivirus 1 concentrate, sgRPL22 recombinant lentivirus 2 concentrate or control lentivirus sgNTC concentrate) and 10 μl of Polybrene were added to the culture dish (10 cm in diameter) of the individual human mesenchymal progenitor cells, and the next day the hMPCs culture medium was replaced, and 48 hours later 1 μg / mL of puromycin (Invivogen) was added to the hMPCs culture medium, so that each cell was infected with only one sgRNA virus at the same time. 5 Personal mesenchymal progenitor cells were added to the culture dish (10 cm in diameter) of the individual human mesenchymal progenitor cells 6 μl of lentivirus concentrate (sgRPL22 recombinant lentivirus 1 concentrate, sgRPL22 recombinant lentivirus 2 concentrate or control lentivirus sgNTC concentrate) and 10 μl of Polybrene, and the next day the hMPCs culture medium was replaced, and 48 hours later 1 μg / mL of puromycin (Invivogen) was added to the hMPCs culture medium, so that each cell was infected with only one sgRNA virus at the same time.
[0062] 2. The lentivirus-infected cells obtained in step 1 were cultured in hMPCs culture medium and continuously passaged until the cells appeared to be growth-arrested and the cells became large, and the lentivirus-infected cells were collected, and the sgRNA in the cells with improved proliferation ability was enriched and analyzed by second-generation sequencing and bioinformatics analysis.
[0063] III. Cell culture
[0064] RPL22 + / + hESCs (wild type, H9, from WiCell Research) and RPL22 - / - hESCs (see step four for source) were cultured on a mitomycin C (Selleck)-inactivated mouse embryonic fibroblast (MEF) feeder layer.
[0065] The solutes and their concentrations of the culture medium for culturing hESCs are 80% DMEM / F12 (Gibco), 20% Knockout Serum Replacement (Gibco), 2 mM GlutaMAX (Gibco), 0.1 mM Non-essential Amino Acids (NEAA, Gibco), 55 mM β-mercaptoethanol (Invitrogen), 10 ng / mL bFGF (JPC), and 1% Penicillin / Streptomycin (Gibco); the solvent is water.
[0066] hESCs were cultured on Matrigel (BD Biosciences). The culture medium for culturing hESCs was mTeSR medium (STEMCELL Technologies).
[0067] hMPCs were cultured on gelatin (Sigma) coated plates. The solutes and their concentrations of the culture medium for culturing hMPCs (i.e. hMPCs medium) are 90% a-MEM with GlutaMAX (Gibco), 10% fetal bovine serum (Gibco), 0.1 mM NEAA, 1% Penicillin / Streptomycin, and 1 ng / mL bFGF; the solvent is water.
[0068] The solutes and their concentrations of the HEK293T cell culture medium for culturing HEK293T are 90% DMEM / High Glucose (HyClone), 10% FBS (Gibco), 0.1 mM NEAA (Gibco), 2 mM GlutaMAX (Gibco), and 1% Penicillin / Streptomycin (Gibco); the solvent is water.
[0069] The cell culture medium for culturing hCAECs and hUVECs is commercialized EGM TM -2 Endothelial Cell Growth Medium-2 BulletKit TM (Lonza, CC-3162).
[0070] Four, RPL22 - / - Preparation of hESCs
[0071] 1. Construction of sgRNA vector targeting RPL22 gene
[0072] sgRNA targeting RPL22 gene was designed and synthesized by GenScript, the sgRNA name is sgRPL22, the nucleotide sequence is CATACTAACCACAGGAGCCA. The sgRPL22 was cloned into pCAG-mCherry-gRNA vector (Addgene, #87110) to get sgRNA vector targeting RPL22 gene.
[0073] 2, RPL22 gene knockout in hESCs + / + RPL22 gene knockout in hESCs
[0074] RPL22 gene knockout in hESCs + / + hESCs were cultured on Matrigel with mTeSR medium, and treated with ROCK inhibitor Y-27632 (Selleck) for 24 hours; then the sgRNA vector targeting RPL22 gene prepared in step 1 was electroporated into RPL22 + / + hESCs were cultured on Matrigel with mTeSR medium for 48 hours, and then flow cytometry sorting (FACS, BD FACS Aria II) was performed to obtain double positive cells of GFP and mCherry, and the hESCs were cultured on MEF feeder cells with hESCs medium until the clones grew out.
[0075] 3, RPL22 gene knockout in hESCs - / - Obtaining of hESCs
[0076] The clones obtained in step 2 were subjected to genomic sequencing analysis. Further, the clones with gene mutations in the region near the gRNA were identified at the protein level using RPL22 antibody (Proteintech, 25001-1-AP).
[0077] The clones with complete knockout of RPL22 protein were RPL22 - / - hESCs.
[0078] Five, RPL22 gene knockout in hMPCs + / + hMPCs and RPL22 - / - Preparation and characterization analysis of hMPCs
[0079] 1, RPL22 gene knockout in hMPCs + / + hMPCs and RPL22 - / - hMPCs were respectively derived from RPL22 + / + hESCs and RPL22 - / - hESCs were induced to differentiate. The specific steps are as follows:
[0080] (1) hESCs were generated into embryoid bodies (EBs) and then cultured with hMPCs differentiation medium until cell confluence (about 10 days).
[0081] The solutes and their concentrations of hMPCs differentiation medium were: 90% a-MEM with GlutaMAX (Gibco), 10% fetal bovine serum (Gibco), 0.1 mM NEAA, 1% penicillin / streptomycin, 10 ng / mL bFGF and 5 ng / mL TGF-β (PeproTech).
[0082] (2) After completion of step (1), cells were digested and then transferred to gelatin-coated plates for culture with hMPCs medium.
[0083] (3) After completion of step (2), FACS was used to sort cells positive for CD73 (550741, BD Biosciences), CD90 (555595, BD Biosciences) and CD105 (17-1057, eBioscience), i.e. hMPCs.
[0084] 2, The differentiation ability of hMPCs into adipogenic, chondrogenic and osteogenic cells was evaluated using oil red O (Sigma), toluidine blue (Sigma) and Von Kossa (Genmed Scientifics, GMS80045.3) staining, respectively.
[0085] Six, Western blot analysis
[0086] 1, 1 x 10 6 cells were lysed in 1 x SDS lysis buffer (solute and their concentrations were 62.5 mM Tris-HCl, 10% glycerol, 2% SDS and 2% β-mercaptoethanol, solvent was water, pH 6.8) at 105°C for 10 minutes, and then total protein quantification was performed using BCA kit (Dingguochangsheng, BCA02).
[0087] 2, 20 μg of protein was separated by SDS-PAGE gel electrophoresis, and then transferred to a PVDF membrane (Millipore) by electroblotting, and then blocked with 5% skim milk (BBI Life Sciences) at room temperature for 1 hour. Incubated with primary antibody at 4°C overnight. Then incubated with horseradish peroxidase (HRP)-labeled secondary antibody at room temperature for 1 hour.
[0088] 3, ChemiDoc XRS system (Bio-Rad) was used for data acquisition and data processing, and ImageJ was used for data analysis.
[0089] The primary antibodies for Western blotting experiments were RPL22 antibody (Proteintech, 25001-1-AP), LaminB1 antibody (Abeam, ab16048), LAP2 antibody (BD Bioscience, 611000), HP1a antibody (Cell Signaling Technology, 2616), P16 antibody (BD Bioscience, 550834), P21 antibody (Abeam, ab188224), H3K9me3 antibody (Abeam, ab8898), H3 antibody (Abeam, ab1791), KAP1 antibody (Abeam, ab22553), HP1y antibody (Cell Signaling Technology, 2619), b-Tubulin antibody (Immunoway, YM3030) and Flag (Sigma-Aldrich, F1804), respectively. The secondary antibodies were goat anti-mouse antibody (ZSGB-BIO, ZB2305) and goat anti-rabbit antibody (ZSGB-BIO, ZB2301) labeled with HRP, respectively.
[0090] Seven, senescence-associated b-galactosidase (SA-b-Gal) staining
[0091] Cells were washed twice with PBS buffer and fixed with PBS buffer containing 2% formaldehyde and 0.2% glutaraldehyde for 5 min at room temperature; then stained with SA-b-Gal staining buffer (solute and its concentration: 150 mM NaCl, 2 mM MgCl2, 5 mM K4[Fe(CN)6], 5 mM K3[Fe(CN)6], 40 mM citrate / phosphate sodium buffer and 1 mg / ml X-gal (AMRESCO), solvent: water) overnight at 37 °C. The percentage of SA-b-Gal positive cells was quantified and analyzed by Image J.
[0092] Eight, clonal expansion experiment
[0093] 2000 hMPCs were seeded on gelatin-coated plates (Corning, 12-well) and cultured for about 10 days; then the cells were washed twice with PBS buffer, followed by fixation with 4% paraformaldehyde for 30 min at room temperature, and stained with crystal violet (Biohao, C0520) for 1 h at room temperature; then washed with PBS buffer, the images were scanned by Epson Perfection V370 Photo (EPSON) and the relative cell density was quantitatively analyzed by Image J.
[0094] Nine, immunofluorescence staining
[0095] Cells were seeded on gelatin-coated coverslips and cultured to a cell density of about 80%; then washed twice with PBS buffer, fixed with 4% paraformaldehyde at room temperature for 30 min, permeabilized with 0.4% Triton X-100 for 15 min, and blocked with 10% donkey serum (Jackson ImmunoResearch Laboratorie) at room temperature for 1 h; then incubated with primary antibodies at 4°C overnight, incubated with fluorescently labeled secondary antibodies at room temperature for 1 h, labeled with Hoechst 33342 (Invitrogen) for cell nuclei, and imaged using a ZEISS LSM900 laser confocal microscope or a Leica SP5 laser confocal microscope, and the percentage of positive cells or the fluorescence signal intensity was quantitatively analyzed using Image J.
[0096] The primary antibodies used for immunofluorescence staining experiments were OCT4 antibody (Santa Cruz Biotechnology, sc-5279), SOX2 antibody (R&D, MAB2018), NANOG antibody (Abeam, ab109250), TUJ1 antibody (Abeam, ab78078), SMA antibody (ZSGB-BIO, ZM-0003), FOXA2 antibody (Cell Signaling Technology, 8186S), RPL22 antibody (Proteintech, 25001-1-AP), ki67 antibody (ZSGB-BIO, ZM-0166), H3K9me3 antibody (Abeam, ab8898), LAP2 antibody (BD Bioscience, 611000), Nucleolin antibody (Santa Cruz Biotechnology, sc-8031), 53BP1 antibody (Beth Laboratories, A300-273A), and gH2AX antibody (Millipore, 05-636). The secondary antibodies used for immunofluorescence staining were Alexa Flour 488 donkey anti-mouse antibody (Invitrogen, A21202), Alexa Flour 568 donkey anti-goat antibody (Invitrogen, A11057), Alexa Flour 647 donkey anti-rabbit antibody (Invitrogen, A31573), and Alexa Flour 568 donkey anti-rabbit antibody (Invitrogen, A10042).
[0097] Ten, enzyme-linked immunosorbent assay (ELISA)
[0098] 1 x 10 5Cells were seeded on gelatin-coated 6-well plates (Corning) and cultured for 48 hours. The cell culture supernatant was collected and filtered with a 0.2 μm filter. The secretion level of IL-6 in the filtrate was determined according to the instructions of the kit (Biolegend, 430515).
[0099] Eleven, telomere length detection
[0100] Genomic DNA was extracted using the TIANamp Genomic DNA Extraction Kit (TIANGEN, DP304); then fluorescence quantitative PCR (qPCR) was performed by Quant Studio 5 (Applied Biosystems). 36B4 was used as an internal reference, and the relative length of the telomere was calculated according to the cycle number at which the Telomere primer peaked.
[0101] The primer for detecting Telomere was Telomere-F:
[0102] GGTTTTTGAGGGTGAGGGTGAGGGTGAGGGTGAGGGT and Telomere-R: TCCCGACTATCCCTATCCCTATCCCTATCCCTATCCCTA.
[0103] The primer for detecting 36B4 was 36B4-F: CAGCAAGTGGGAAGGTGTAATCC and 36B4-R: CCCATTCTATCATCAACGGGTACAA.
[0104] Twelve, EdU staining analysis
[0105] BeyoClick TM The EdU-488 Cell Proliferation Detection Kit (Beyotime, C0071L) was used to detect the DNA replication level of cells. hMPCs were cultured in hMPC medium containing 10 μM EdU for 2-3 hours; then the cells were fixed with 4% PFA for 15 minutes and permeabilized with 0.4% Triton X-100 for 10 minutes, and then incubated with the reaction mixture (consisting of 86% Click Reaction Buffer, 4% CuSO4, 10% Click Additive and 1 μL Azide 488) at room temperature for 30 minutes in the dark; finally, the cells were washed with PBS, stained with Hoechst 33342 for the nucleus, and analyzed by confocal microscopy and flow cytometry.
[0106] EdU, Azide 488, Click Reaction Buffer, CuSO4, Hoechst 33342 (1000x), and Click Additive are all from BeyoClick TM Components in the EdU-488 Cell Proliferation Detection Kit.
[0107] Thirteen, Copy Number Variation (CNV) Analysis
[0108] 1. For CNV analysis, genomic DNA was extracted using TIANamp Genomic DNA Kit (TIANGEN, DP304), then library construction was performed and whole genome sequencing was conducted by Illumina NovaSeq 6,000 platform.
[0109] 2. First, Trim Galore software (version 0.5.0)
[0110] (https: / / github.com / FelixKrueger / TrimGalore) was used to filter reads in whole genome sequencing (WGS) data; then Bowtie2 software (version 2.2.9) was used to map the remaining high-level reads to the human 19 reference genome; then Samtools program (version 1.3.1) was used to convert sam files to bam files, and ReadCounter in HMMcopy_utils was used to calculate the number of reads per 500kb bin size. CNV analysis was performed using the R tool HMMcopy (version 1.28.1).
[0111] Fourteen, CRISPR Screening Analysis
[0112] MAGeCK software (version 0.5.9.2) was used to calculate CRISPR-based screening sequencing data. Specifically: first, the data (reproducible data separated by spaces) was trimmed and counted by the “count” subcommand; then, the “test” subcommand was used to perform statistical tests on the provided count table; finally, the positive rate was used to sort the calculation results, and genes with a P value less than 0.05 were considered significant.
[0113] The count file generated by the “count” subcommand of the MAGeCK software was used to perform principal component analysis (PCA) in the R environment.
[0114] Fifteen, RNA-seq Analysis
[0115] 1. Total RNA was extracted from cells using TRIzol reagent (ambion, 15596018); then, library construction was performed according to the manufacturer's instructions of Next Ultra RNA Library Prep Kit for Illumina (NEB) and sequencing was performed by Illumina NovaSeq 6,000 platform.
[0116] 2. Trim Galore software (version 0.5.0) was used to trim and quality control the RNA-seq data of RPL22 - / - hMPCs, then clean data was mapped to the hg19 reference genome using HISAT2 software (version 2.0.4); afterwards, the number of reads mapped to each gene was calculated using HTSeq software (version 0.11.0), finally, the differentially expressed genes (DEG) were calculated using DEseq2 software (version 1.30.1) with the criteria of adjusted P-value less than 0.05 and |log2(fold change)| greater than 0.5.
[0117] 3. Trim Galore software (version 0.6.7) was used to trim the RNA-seq data of RPL22 + / + hMPCs, then clean data was mapped to the hg19 reference genome using HISAT2 software (version 2.2.1); afterwards, the number of reads mapped to each gene was calculated using featureCounts software (version 2.0.1), finally, the differentially expressed genes (DEG) were calculated using DEseq2 software (version 1.30.1) with the criteria of adjusted P-value less than 0.05 and |log2(fold change)| greater than 0.5.
[0118] 4. Metascape was used for enrichment study of gene ontology (GO) terms and pathways
[0119] Through bioinformatics analysis of the screening library of ribosome-related genes and subsequent verification of senescence-related phenotypes, it was found that sgRNAs targeting RPL22 were gradually accumulated in the ribosome-related gene library with passage, and RPL22 protein was likely to be a ribosome gene closely related to senescence phenotype (see Figure 1 Figs. A-C and Figure 7 Figs. A-B). It was also found that the level of RPL22 protein was up-regulated to a certain extent during replicative senescence (see Figure 1 Fig. D). Subsequently, detection of senescence-related phenotypes found that the replicative senescence phenotype of cells infected with sgRPL22 recombinant lentivirus 1 or sgRPL22 recombinant lentivirus 2 was effectively alleviated compared with cells infected with control lentivirus sgNTC (see Figure 1 Figs. E-J andFigure 7 Specifically, late-generation hMPCs with RPL22 protein knockout showed stronger proliferation capacity (see Figure 1 FG and Figure 7 DE), the aging-related β-galactosidase positive rate was significantly reduced (see Figure 1 H), decreased expression of senescence-related proteins (P16, P21) and decreased secretion of senescence-related secretory phenotypic factors (such as IL-6) (see Figure 1 In addition, RPL22 deficiency leads to decreased DNA damage levels and reduced nuclear size (see Figure 7 These results suggest that RPL22 may be a driver of aging, and reducing RPL22 protein expression can alleviate the aging of hMPCs.
[0120] In addition, the RPL22 gene was knocked out in hESCs, and the successful knockout of RPL22 protein was verified by gene sequencing and protein immunoblotting experiments (see Figure 8 AD), and found that the loss of RPL22 protein did not affect the proliferation ability, pluripotency and genomic stability of hESCs (see Figure 8 The cells were then differentiated into hMPCs and found that the loss of RPL22 protein did not affect the genomic stability of hMPCs, nor did it affect the differentiation ability of hMPCs into adipogenesis, osteoblasts, and chondrogenesis (see Figure 2 Middle AB and Figure 9 AE). Subsequent detection of senescence-related phenotypes showed that reducing the content of RPL22 protein could significantly alleviate the senescence phenotype of cells (see Figure 2 Specifically, knockout of RPL22 protein can increase the number of cell passages ( Figure 2 C), the proliferation ability of cells is enhanced (see Figure 2 DF), the aging-related β-galactosidase positive rate was significantly reduced (see Figure 2 G), aging-related proteins changed, P16 expression level decreased, while LaminB1 and LAP2 protein levels increased (see Figure 2 HI), aging-related secretory phenotypes such as decreased secretion of IL-6 (see Figure 2 Middle J), cell telomeres lengthened (see Figure 2 Middle K), DNA damage is reduced (see Figure 2 Middle L), the nuclear area is reduced (see Figure 2 The results of RNA-seq showed that genes related to cell division and DNA replication were upregulated, while genes related to inflammatory factors were downregulated (see Figure 2 NO and Figure 9 (in FH).
[0121] The above results show that after knocking out the RPL22 protein, the senescence phenotype of the cells is obviously alleviated, that is, reducing the content and / or activity of the RPL22 protein can delay the senescence of human mesenchymal progenitor cells.
[0122] Example 2, increasing the content and / or activity of the RPL22 protein can accelerate the senescence of human mesenchymal progenitor cells
[0123] I. Take the cDNA of hMPCs as a template, and use the primer pair composed of primer cDNA-RPL22-F: 5'-ATGGACTACAAGGACGACGACGACAAGGGCGCTCCTGTGAAAAAGCTT-3' and primer cDNA-RPL22-R: 5'-TTTAATCCTCGTCTTCCTC-3' to perform PCR amplification, to obtain a PCR amplification product. The PCR amplification product is the full-length sequence of the cDNA encoding the RPL22 protein. The PCR amplification product is ligated to the pLE4 vector (recorded in the following literature: Hu H, Ji Q, Song M, Ren J, Liu Z, Wang Z, Liu X, Yan K, Hu J, Jing Y, Wang S, Zhang W, Liu GH, Qu J. ZKSCAN3 counteracts cellular senescence by stabilizing heterochromatin. Nucleic Acids Res. 2020 Jun 19;48(11):6001-6018. doi: 10.1093 / nar / gkaa425. PMID: 32427330; PMCID: PMC7293006.) by T4 DNA ligase, to obtain a recombinant vector pLE4-RPL22.
[0124] II. According to the method of step I, the primer cDNA-RPL22-F is replaced by the primer cDNA-Luc-F: 5'-ATGGACTACAAGGACGACGACGACAAGGGCGAAGACGCCAAAAACATAAAGAAAGG C-3' and the primer cDNA-Luc-R: 5'-TTACACGGCGATCTTTCCGCCCTTCTTGGC-3', and the other steps remain unchanged, to obtain a recombinant vector pLE4-Luc as a control.
[0125] III. Replace the sgRPL22 recombinant vector 1 of step I of example 1 with the recombinant vector pLE4-RPL22, and the other steps remain unchanged, to obtain a pLE4-RPL22 lentivirus concentrate.
[0126] Four, replace the sgRPL22 recombinant vector 1 in step one of example 1 with recombinant vector pLE4-Luc, and other steps remain unchanged, to obtain pLE4-Luc lentivirus concentrate.
[0127] Five, according to the method of steps six-fourteen in example 1, detect the senescence-related phenotype of young hMPCs after infection with pLE4-RPL22 lentivirus.
[0128] The results are as follows:
[0129] The successful overexpression of RPL22 protein was verified by Western blotting experiment (see Figure 3 A in the middle). After overexpression of RPL22 protein in young hMPCs, the proliferation ability of cells decreased significantly (see Figure 3 B-C in the middle), the positive rate of senescence-related β-galactosidase increased significantly (see Figure 3 D in the middle), the senescence-related proteins changed, the expression level of P16 increased, and the protein levels of LaminB1 and LAP2 decreased (see Figure 3 E-F in the middle), the secretion level of senescence-related secretory phenotype such as IL-6 increased (see Figure 3 G in the middle), the telomeres of cells shortened (see Figure 3 H in the middle), DNA damage increased (see Figure 3 I in the middle), and the nuclear area increased (see Figure 3 J in the middle). The results of RNA-seq showed that the genes related to cell proliferation were down-regulated (see Figure 3 K-L and Figure 9 I in the middle), which was completely opposite to the RPL22 protein knockout experiment.
[0130] The above results comprehensively show that overexpression of RPL22 protein can significantly promote the aging of young hMPCs.
[0131] Example 3, RPL22 protein induces rRNA expression in hMPCs during aging
[0132] I. SUnSET experiment
[0133] 1. After incubating the cells with hMPC medium containing 2 μg / ml puromycin for 15 minutes, the cells were collected and digested. The negative control cells were treated with hMPC medium containing 100 μg / ml cycloheximide for 5 minutes, and then incubated with hMPC medium containing 2 μg / ml puromycin for 15 minutes before collecting and digesting the cells.
[0134] 2. After completing step 1, Western blotting analysis was performed with the collected cells. Total protein stained with Coomassie blue was used as a loading control.
[0135] II. Mutant RPL22 ΔN9 / C8 Construction of pLE4-RPL22
[0136] The gene encoding mutant RPL22 ΔN9 / C8 was inserted into the multiple cloning site of pLE4 vector by GenScript Corporation to obtain the recombinant plasmid pLE4-RPL22 ΔN9 / C8 .
[0137] Mutant RPL22 ΔN9 / C8 is to remove 9 amino acids from the N-terminus and 8 amino acids from the C-terminus of the amino acid sequence of RPL22 protein (see A in Figure 4 ; mutant RPL22 ΔN9 / C8 cannot be incorporated into ribosome to perform its ribosome function (recorded in the following literature: Shu-Nu, C., Lin, C. H., and Lin, A. (2000). An acidic amino acid cluster regulates the nucleolar localization and ribosome assembly of human ribosomal protein L22. FEBS letters 484, 22-28. 10.1016 / s0014-5793(00)02118-9.).
[0138] III. Obtaining RPL22 - / - hMPCs infected with luc-expressing lentivirus and RPL22 ΔN9 / C8 hMPCs infected with RPL22 - / - IV. Obtaining RPL22 - / - hMPCs infected with RPL22 - / - lentivirus
[0139] 1. Culture RPL22 - / - hMPCs to about 50% density in a six-well plate containing hMPCs culture medium, add about 2 μl of pLE4-Luc lentivirus concentrate and 2 μl of Polybrene to each well, and change the medium the next day to obtain RPL22 - / - hMPCs infected with luc-expressing lentivirus.
[0140] 2. Culture RPL22 - / - hMPCs to about 50% density in a six-well plate containing hMPCs culture medium, add about 2 μl of RPL22 ΔN9 / C8 lentivirus concentrate (replace the sgRPL22 recombinant vector 1 in step one, 2 of Example 1 with the recombinant plasmid pLE4-RPL22 ΔN9 / C8 , and the other steps remain unchanged to obtain RPL22 ΔN9 / C8 lentivirus concentrate) and 2 μl of Polybrene to each well, and change the medium the next day to obtain RPL22 ΔN9 / C8RPL22 - / - hMPCs.
[0141] 4. Northern blot analysis
[0142] TRIzol reagent (Ambion, 15596018) was used to culture the same number of cells (RPL22 infected with luc lentivirus overexpressing - / - hMPCs or infected with RPL22 ΔN9 / C8 RPL22 - / - Total RNA was extracted from hMPCs, mixed with RNA loading buffer, denatured at 70°C for 5 minutes, and then quickly cooled on ice to obtain an RNA sample. Subsequently, the RNA sample was loaded onto a 1.2% agarose gel at a minimum loading amount of 20 μg and electrophoresed in MOPS buffer (Beyotime, ST468-500ml) at 120V for 1 hour. The membrane was transferred in 20×SSC buffer (3M NaCl, 0.3M citric acid, pH 7.0-7.5) for 16 hours, and the RNA was transferred to a nylon membrane (Millipore) by capillary action. After the transfer was completed, an XL-1000 UV crosslinker (Spectronics Corporation) was used at 120mJ / cm 2 Under energy conditions, the transferred RNA was cross-linked to the membrane. The membrane was then prehybridized in DIG Easy Hyb solution (Roche, 11796895001) at 42°C for 4 hours in a hybridization oven. Following prehybridization, the prepared probe was denatured at 100°C for 5 minutes and immediately placed on ice. The denatured probe was then diluted in DIG Easy Hyb solution and incubated with the nylon membrane in a hybridization oven at 42°C for at least 20 hours. After hybridization, the cells were washed twice in low- and high-stringency buffers at 50°C, followed by blocking in blocking reagent (Roche, 11096176001) for 4 hours at room temperature. The cells were then incubated with alkaline phosphatase-conjugated anti-digoxigenin antibody (Roche, 12041677001) at room temperature for 0.5–1 hour. The luminescent substrate CDP star reagent (Roche, 12041677001) was added for exposure. Data were collected using the ChemiDoc XRS system and analyzed using Image J software. The probes used were prepared using the PCR DIG PROBESYNTHESIS KIT (Roche, 11636090910).
[0143] The probe sequences used are as follows:
[0144] U1 snRNA: 5'-CAAATTATGCAGTCGAGTTTCCCACATTTG-3';
[0145] 28S rRNA: 5'-CCAGCTATCCTGAGGGAAACTTCGGAGGGAACCAGCTACTAGATGGTTCG-3';
[0146] 18S rRNA: 5'-CACCCGTGGTCACCATGGTAGGCACGGCGACTACCATCGAAAGTTGATAG-3';
[0147] 5.8S rRNA: 5'-CAATGTGTCCTGCAATTCAC-3'.
[0148] 5. rRNA agarose gel electrophoresis
[0149] TRIzol reagent (Ambion, 15596018) was used to extract the cells from an equal number of RPL22 cells (infected with lentivirus overexpressing luc) - / - hMPCs or infected with RPL22 ΔN9 / C8 RPL22 - / - Total RNA was extracted from hMPCs and subjected to agarose gel electrophoresis. The electrophoresis was visualized and data processed using the ChemiDoc XRS system (Bio-Rad), and quantitative analysis was performed using Image J.
[0150] 6. Following the methods of steps 6 to 9 in Example 1, immunofluorescence experiments and aging-related phenotype experiments of hMPCs were performed.
[0151] First, the SUnSET assay was used to examine the effect of RPL22 protein deficiency on the overall translation level of cells. The results showed that RPL22 deficiency did not affect the overall translation level of hMPCs (see Figure 10 Subsequently, to further verify the effect of RPL22's ribosome function on its pro-aging ability, we - / - hMPCs were infected with overexpression of Luc and RPL22 WT and RPL22 ΔN9 / C8 , and RPL22 infected with lentivirus overexpressing luc - / - Compared to hMPCs, infected with RPL22 ΔN9 / C8 RPL22 - / - hMPCs still showed a significant decrease in proliferation capacity and an increase in SA-β-Gal positive cells (see Figure 4Fig. 5. The effect of RPL22 protein on hMPCs aging. (A) The expression level of RPL22 protein in hMPCs aging. (B) The expression level of RPL22 protein in hMPCs aging. (C) The expression level of RPL22 protein in hMPCs aging. (D) The effect of RPL22 protein on hMPCs aging. It can be seen that the effect of RPL22 protein on aging is not related to its ribosome function.
[0152] Seven, in addition, the present application by laser confocal microscopy found that RPL22 protein in the nucleolus of replicative senescent hMPCs (RS-hMPCs, obtained by continuous passage of young hMPCs to late generation) appear aggregation (see Fig. 6A) and the expression level of rRNA is increased (see Fig. 6B). Figure 4 Middle E). At the same time, the expression level of rRNA is increased (see Fig. 6B). Figure 10 Middle C-D), the size of the nucleolus is increased and the number of nucleolus is reduced (see Fig. 6C). Figure 4 Middle F). In young hMPCs overexpressing RPL22, the size of the nucleolus is increased and the number of nucleolus is reduced, accompanied by high levels of rRNA expression (28S, 18S and 5.8S) (see Fig. 6D). Figure 4 Middle G-H and Figure 10 Middle E-F), while the expression level of RPL22 + / + hMPCs is lower than that of RPL22 - / - hMPCs (see Fig. 6E). Figure 4 Middle J and Figure 10 Middle G-H), accompanied by a decrease in the size of the nucleolus and an increase in the number of nucleolus (see Fig. 6F). Figure 4 Middle I). It can be seen that the nucleolar RPL22 protein may affect hMPCs aging by directly regulating rRNA expression and regulating nucleolar structure. In addition, by using qPCR to detect the transcription level of 45S pre-rRNA (transcribed from rDNA, which is the precursor of 28S, 18S and 5.8S rRNA), it is found that the expression level of 45S pre-rRNA is reduced after the deletion of RPL22 protein, while the expression level of 45S pre-rRNA is increased after overexpression of RPL22 protein in young hMPCs (see Fig. 6G-H). Figure 10 Middle I-J).
[0153] Eight, in order to further verify the conclusion of step five, the following experiments were carried out:
[0154] 1, RPL22 m88A lentivirus concentrate and RPL22 WT lentivirus concentrate
[0155] (1-1) The gene encoding mutant RPL22 m88A was inserted into the multiple cloning site of pLE4 vector by Kingsway Biotech Co., Ltd. to obtain recombinant plasmid pLE4-RPL22 m88A .
[0156] Mutant RPL22 m88AAAYLAA in amino acid residues 88-93 from N-terminus of the amino acid sequence of RPL22 protein is mutated to KKYLKK (see Figure 4 A) in the present application. The mutant RPL22 m88A The nucleolus localization ability of RPL22 protein can be abolished (described in Houmani, J. L. and Ruf, I. K. (2009) Clusters of basic amino acids contribute to RNA binding and nucleolar localization of ribosomal protein L22. PloS one, 4, e5306.).
[0157] (1-2) The sgRPL22 recombinant vector 1 in step one 2 of Example 1 is replaced by the recombinant plasmid pLE4-RPL22 m88A , and other steps remain unchanged, to obtain the RPL22 m88A lentivirus concentrate.
[0158] (1-3) The sgRPL22 recombinant vector 1 in step one 2 of Example 1 is replaced by the recombinant vector pLE4-RPL22, and other steps remain unchanged, to obtain the pLE4-RPL22 lentivirus concentrate, i.e. RPL22 WT lentivirus concentrate.
[0159] 2, RPL22 m88A lentivirus concentrate and RPL22 WT lentivirus concentrate are used to infect RPL22 - / - hMPCs, and the transcription level of rRNA, nucleolus volume and nucleolus number are detected.
[0160] Nine, to further verify the conclusion of step five, the following experiment is carried out:
[0161] 1, RPL22 m13-16 lentivirus concentrate and RPL22 WT lentivirus concentrate are obtained
[0162] (1-1) The gene encoding mutant RPL22 m13-16 is inserted into the multiple cloning site of pLE4 vector by Kingsrosa Biotechnology Co., Ltd. to obtain the recombinant plasmid pLE4-RPL22 m13-16 .
[0163] The mutant RPL22 m13-16 is to mutate the amino acid residues KKKK in positions 13-16 from N-terminus of the amino acid sequence of RPL22 protein to AAAA (see Figure 4 A) in the present application. The mutant RPL22m13-16 Can abolish the nucleolar localization ability of RPL22 protein (see Figure 10 Medium NO).
[0164] (1-2) Replace the sgRPL22 recombinant vector 1 in step 1 of Example 1 with the recombinant plasmid pLE4-RPL22 m13 -16 , the other steps remain unchanged, and RPL22 is obtained m13-16 Lentiviral concentrate.
[0165] (1-3) The sgRPL22 recombinant vector 1 in step 2 of Example 1 was replaced with the recombinant vector pLE4-RPL22, and the other steps remained unchanged to obtain the pLE4-RPL22 lentiviral concentrate, i.e., RPL22 WT Lentiviral concentrate.
[0166] 2. Use RPL22 respectively m13-16 Lentiviral concentrate and RPL22 WT Lentiviral concentrate infected RPL22 - / - hMPCs and detect senescence-related phenotypes of the cells.
[0167] The results showed that in RPL22 - / - RPL22 expression in hMPCs WT Induction of rRNA transcription is accompanied by nucleolar expansion and a decrease in nucleolar number, whereas in the case of RPL22 expression m88A No similar changes were observed in hMPCs (see Figure 4 Middle K and Figure 10 Middle L). At the same time, with RPL22 - / - Overexpression of RPL22 in hMPCs WT Compared with RPL22 m88A It also fails to promote the accelerated aging of hMPCs (see Figure 4 LM and Figure 10 In addition, the mutant RPL22 with mutated nuclear localization sequence m13-16 The ability to promote accelerated aging of hMPCs was also lost (see Figure 10 These results indicate that RPL22 protein induces rRNA expression and promotes a decrease in nucleolar expansion, and that the ability of RPL22 to promote rRNA expression and promote aging depends on its nucleolar localization function.
[0168] Example 4: RPL22 protein causes heterochromatin depolymerization in the rDNA region of aging hMPCs
[0169] 1. Co-immunoprecipitation (Co-IP) analysis
[0170] 1. For exogenous Co-IP, HEK293T cells were first transfected with overexpression plasmids; 72 hours later, cells were harvested and lysed in lysis buffer (40 mM HEPES, 120 mM NaCl, 0.3% CHAPS, 1 mM EDTA, 1 mM PMSF and protease inhibitor cocktail (Roche, 4693159001) in water, pH 7.5) on a rotator at 4 °C for 2 hours; then centrifuged at 4 °C, 12000 g for 30 minutes, and the supernatant was collected; anti-FLAG M2 affinity gel (Sigma-Aldrich, A2220) was added to the supernatant and incubated at 4 °C overnight on a rotator; finally, the interacting proteins were eluted with flag peptides (Sigma-Aldrich, F3290) and analyzed by Western blotting.
[0171] 2. For endogenous Co-IP, RPL22 + / + hMPCs or RPL22 - / - hMPCs were lysed in lysis buffer on a rotator at 4 °C for 2 hours; then centrifuged at 4 °C, 12000 g for 30 minutes, and the supernatant was collected; the supernatant was incubated with anti-RPL22 antibody at 4 °C overnight, and then the cell supernatant mixed with anti-RPL22 antibody was incubated with Protein A / G PLUS-agarose beads (Santa Cruz Biotechnology, sc-2003) at 4 °C for 2 hours; finally, eluted with 1x SDS lysis buffer at 105 °C for 10 minutes, and analyzed by Western blotting.
[0172] II. Liquid chromatography-tandem mass spectrometry (LC-MS / MS) analysis
[0173] 1. The proteins obtained by Co-IP were subjected to SDS-PAGE gel electrophoresis and Coomassie blue staining. After destaining, the gel bands containing the target proteins were cut and dehydrated (100% acetonitrile), reduced (10 mM DTT in 25 mM NH4HCO3, 56 °C for 45 minutes) and alkylated (10 mM DTT in 25 mM NH4HCO3, 56 °C for 45 minutes).
[0174] 2. After completing step 1, the target protein was digested with sequencing-grade modified trypsin (Worthington) in 25mM NH4HCO3 at 37°C overnight, and the enzyme reaction was terminated with formic acid and analyzed by mass spectrometry using a nano LC-Q EXACTIVE (Thermo Fisher Scientific) equipped with a nano-ES ion source (ProxeonBiosystems). The raw files were processed using MaxQuant software (version 1.3.0.5). The generated peak list files were analyzed using Thermo Proteome Discoverer (version 1.4.0.288) based on the UniProt-proteome-human database. The required false discovery rate (FDR) at the peptide and protein levels was set to 1%, and the minimum length of the obtained peptides was set to 7 amino acids. Each proteome requires at least one unique peptide or razor peptide for protein identification.
[0175] Proteins that were not found in the control group but were highly abundant in the RPL22 experimental group were identified as RPL22-interacting proteins.
[0176] 3. Chromatin Immunoprecipitation (ChIP)
[0177] 1. Collect 1×10 6 hMPCs were cross-linked with 1% formaldehyde (Sigma) at room temperature for 10 minutes, and then cross-linking was terminated with 0.125M glycine (VWR International) at 4°C for 10 minutes. The cells were lysed on ice for 10 minutes, and the chromosomes were fragmented to a target peak size of 100-500 base pairs (bps) using an S220 focused ultrasonicator (Covaris). The protein-DNA mixture was incubated with antibody-coupled Dynabeads Protein A (Thermo Fisher Scientific, 10006D) at 4°C overnight, and then the protein-DNA cross-links were digested with proteinase K at 68°C for 2 hours. The DNA was purified with ethanol and used for qPCR analysis or sequencing.
[0178] The primer sequences used to detect 28S were 28S-F: 5'-CTTGGGAATGCAGCCCAAAG-3' and 28S-R:
[0179] 5′-GAATCCTCCGGGCGGACTG-3′.
[0180] The primer sequence for detecting 5.8S is 5.8S-F: 5'-GAGGCAACCCCCTCTCCTCTT-3' and 5.8S-R: 5'-GAGCCGAGTGATCCACCGCTA-3'.
[0181] 2. For ChIP-seq, library construction was performed according to the manufacturer's instructions of KAPA Hyper Prep Kit (KAPA, KK8504) and sequencing was performed by DNBSEQ-T7 platform.
[0182] The antibodies used for ChIP were RPL22 antibody (Proteintech, 25001-1-AP), KAP1 antibody (Abeam, ab22553), HP1y antibody (Cell Signaling Technology, 2619), H3K9me3 antibody (Abeam, ab8898) and Flag antibody (Sigma, F1804), respectively.
[0183] Four, H3K9me3 ChIP-seq data analysis
[0184] 1. To explore the signal (RPKM, Reads Per Kilobase per Million mapped reads) in rDNA region, rDNA region (GenBank: U13369.1) was assembled on chromosome 13 of hg19, which was named as "hg19_plusrDNA".
[0185] 2. Trim Galore was used for quality control and adapter removal of H3K9me3 ChIP-seq data. The remaining reads were aligned to hg19_plusrDNA using Bowtie2 software (version 2.2.9).
[0186] 3. To reduce bias, the same number of reads were collected for subsequent analysis (35,000,000 for H3K9me3 ChIP-seq).
[0187] 4. The bam file was converted to bw file using deepTools (version 2.5.4-2-5ee467f), and heat map file was generated using deepTools before optimization using R.
[0188] Five, preparation of recombinant lentivirus for reducing the content of human HP1y and KAP1
[0189] 1、According to the sequence of human HP1 gamma gene, shRNA was designed, and sh-HP1 gamma-F: 5'-CGCGTGCAGAATTGATTGAAGCGTTTTCAAGAGAAACGCTTCAATCAATTCTGCTTTTTTGGAAAT-3' and sh-HP1 gamma-R: 5'-CGATTTCCAAAAAAGCAGAATTGATTGAAGCGTTTCTCTTGAAAACGCTTCAATCAATTCTGCA-3' were synthesized by GenScript. According to the sequence of human KAP1 gene, shRNA was designed, and sh-KAP1-F: 5'-CGCGTGGCGTCCTGGCACTAACTCATTCAAGAGATGAGTTAGTGCCAGGACGCCTTTTTTGGAAAT-3' and sh-KAP1-R: 5'-CGATTTCCAAAAAAGGCGTCCTGGCACTAACTCATCTCTTGAATGAGTTAGTGCCAGGACGCCA-3' were synthesized by GenScript. Control shRNA was designed, and sh-GL2-F: 5'-CGCGTGCGTACGCGGAATACTTCGATTCAAGAGATCGAAGTATTCCGCGTACGCTTTTTTGGAAAT-3' and sh-GL2-R: 5'-CGATTTCCAAAAAAGCGTACGCGGAATACTTCGATCTCTTGAATCGAAGTATTCCGCGTACGCA-3' were synthesized by GenScript.
[0190] 2、After annealing reaction of sh-HP1 gamma-F and sh-HP1 gamma-R, dimer HP1 gamma was obtained. After annealing reaction of sh-KAP1-F and sh-KAP1-R, dimer KAP1 was obtained. After annealing reaction of sh-GL2-F and sh-GL2-R, dimer GL2 was obtained.
[0191] 3、The pLVTHM vector (Addgene, #12247) was digested with Afl II (NEB) to obtain the vector skeleton.
[0192] 4. The vector backbone and dimer HP1γ were ligated using T4 DNA ligase (NEB) to obtain a shRNA recombinant vector that reduces the level of human HP1γ, named sh-HP1γ recombinant vector. The vector backbone and dimer KAP1 were ligated using T4 DNA ligase (NEB) to obtain a shRNA recombinant vector that reduces the level of human KAP1, named sh-KAP1 recombinant vector. The vector backbone and dimer GL2 were ligated using T4 DNA ligase (NEB) to obtain a control shRNA recombinant vector, named sh-GL2 recombinant vector.
[0193] 5. According to the method of step 2 in step 1 of Example 1, the sgRPL22 recombinant vector 1 was replaced with the sh-HP1γ recombinant vector, the sh-KAP1 recombinant vector, and the sh-GL2 recombinant vector, respectively. The other steps remained unchanged to obtain the sh-HP1γ lentiviral concentrate, the sh-KAP1 lentiviral concentrate, and the control lentiviral concentrate, respectively.
[0194] 6. According to the methods of steps 6 to 9 in Example 1, Western blot analysis of hMPCs and detection of senescence-related molecular phenotypes of cells after knockdown of KAP1 and HP1γ were performed.
[0195] 7. Following the method of step 5 in Example 3, the rRNA levels of cells were detected after KAP1 and HP1γ were knocked down in hMPCs.
[0196] To discover the mechanism by which RPL22 regulates rRNA expression and cellular senescence, we expressed Flag-tagged RPL22 in HEK293T cells, performed co-immunoprecipitation experiments, and performed mass spectrometry analysis (see Figure 11 Based on the function and location of RPL22 protein, nuclear and ribosomal components were identified as RPL22-interacting proteins. In addition, several RPL22-interacting proteins associated with heterochromatin were also identified (see Figure 5 China A and Figure 11 Downregulation of HP1γ, KAP1, and H3K9me3 was detected by Western blotting in senescent hMPCs ( Figure 5 Interactions between HP1γ and KAP1 and RPL22 were verified by exogenous and endogenous Co-IP assays (see Figure 5 CD and Figure 11 In addition, the expression of HP1γ, KAP1, and H3K9me3 is affected by RPL22 protein. For example, the expression of HP1γ, KAP1, and H3K9me3 is downregulated in hMPCs overexpressing RPL22 protein (see Figure 5 Zhong E and Figure 11Figure 6. RPL22 protein depletion leads to higher expression levels of these proteins (see Figure 5 Figure 7. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 11 Figure 8. RPL22 protein overexpression leads to lower expression levels of these proteins (see - / - Figure 9. RPL22 protein overexpression leads to lower expression levels of these proteins (see WT Figure 10. RPL22 protein overexpression leads to lower expression levels of these proteins (see m88A Figure 11. RPL22 protein overexpression leads to lower expression levels of these proteins (see WT Figure 12. RPL22 protein overexpression leads to lower expression levels of these proteins (see m88A Figure 13. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 5 Figure 14. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 5 Figure 15. RPL22 protein overexpression leads to lower expression levels of these proteins (see
[0197] Figure 16. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 5 Figure 17. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 11 Figure 18. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 11 Figure 19. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 11 Figure 20. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 5 Figure 21. RPL22 protein overexpression leads to lower expression levels of these proteins (see - / - Figure 22. RPL22 protein overexpression leads to lower expression levels of these proteins (see WT Figure 23. RPL22 protein overexpression leads to lower expression levels of these proteins (see m88A Figure 24. RPL22 protein overexpression leads to lower expression levels of these proteins (see m88 Figure 25. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 11 Figure 26. RPL22 protein overexpression leads to lower expression levels of these proteins (see m88A Figure 27. RPL22 protein overexpression leads to lower expression levels of these proteins (see WT Figure 28. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 11 Figure 29. RPL22 protein overexpression leads to lower expression levels of these proteins (see Figure 12M) and the enrichment of HP1y, KAP1 and H3K9me3 binding at rDNA binding sites in hMPCs (see Figure 5 M-O and Figure 12 Q-R). This indicates that the loss of HP1y and KAP1 and the loss of H3K9me3 at rDNA are dependent on the expression of RPL22 protein in the nucleolus during the aging process of hMPCs.
[0198] The above results show that RPL22 protein can induce the down-regulation of heterochromatin-associated proteins, such as HP1y, KAP1 and H3K9me3, on the rDNA region of the nucleolus during the aging process of hMPCs, and further induce the decondensation of heterochromatin.
[0199] To further verify the role of KAP1 and HP1y in the aging process, the inventors of the present application knocked down the expression of RPL22 - / - hMPCs were infected with sh-HP1y lentivirus concentrate, sh-KAP1 lentivirus concentrate and control lentivirus concentrate, respectively, and after confirming that the protein levels were successfully knocked down (see Figure 12 S-T), the rRNA expression was detected, and it was found that with the decrease of KAP1 and HP1y protein levels, the rRNA expression increased significantly (see Figure 12 U), and the proliferation ability of the cells decreased significantly (see Figure 5 P-Q), and the cell positive rate of senescence-associated beta-galactosidase increased significantly (see Figure 5 R). The above results show that RPL22 promotes the transcription of rRNA and the occurrence of cell aging by reducing KAP1 and HP1y protein levels to destroy heterochromatin.
[0200] Example 5, RPL22 protein depletion can delay the aging of human cells
[0201] The applicants used two different types of premature aging hMPCs (Hutchinson-Gilford premature aging syndrome (HGPS) and Werner premature aging syndrome (HGPS)), UV and H2O2-induced stress aging models, physiologically aged primary hMPCs isolated from the elderly, and two types of human primary endothelial cells (hCAECs (human coronary artery endothelial cells) and hUVECs (human umbilical vein endothelial cells)). The specific steps are as follows:
[0202] I. Preparation of CRISPR / sgRPL22 lentivirus
[0203] sgRPL22 recombinant lentivirus 1 concentrate and control lentivirus sgNTC concentrate were prepared according to the method of step one in Example 1. The sgRPL22 recombinant lentivirus 1 concentrate is CRISPR / sgRPL22 lentivirus concentrate.
[0204] II. CRISPR / sgRPL22 lentivirus concentrate in HGPS hMPCs or WS hMPCs infection
[0205] The results show that the rRNA expression in both progeria cell models is increased relative to wild-type hMPCs (see Figure 13 Figs. 3A and 3G). However, when RPL22 was knocked out in HGPS hMPCs and WS hMPCs by lentivirus, it was found that RPL22 deficiency reduced the expression level of rRNA and alleviated the senescence phenotype of cells (see Figure 6 Figs. 3A-D, Figure 13 Figs. 3B-F and Figure 13 Figs. 3H-L).
[0206] III. UV and H2O2 induced cell senescence model preparation
[0207] hMSCs were treated at 80 μΜ H2O2 to produce H2O2 induced cell senescence model.
[0208] The results show that in the UV or H2O2 treatment induced cell senescence model, the knockout of RPL22 can restore the increase in rRNA expression level, the impairment of proliferation ability, the increase in SA-β-Gal level and the loss of heterochromatin in the two models (see Figure 6 Figs. 3E-H and Figure 13 Figs. 3A-H). In addition, RPL22 protein deficiency inhibits rRNA expression in human primary MPCs isolated from the elderly and restores the cell senescence phenotype (see Figure 6 Figs. 3I-J and Figure 13 Fig. 3I). Overexpression of RPL22 in hCAECs and hUVECs will cause an increase in cell positivity of senescence-associated β-galactosidase and a decrease in cell proliferation ability (seeFigure 6 K-N).
[0209] The above results show that RPL22 protein is a potential target for slowing down aging.
[0210] The application has been described in detail. For those skilled in the art, the application can be implemented in a wider range under equivalent parameters, concentrations and conditions without departing from the spirit and scope of the application and without unnecessary experiments. Although the application gives specific examples, it should be understood that further improvements can be made to the application. In general, according to the principle of the application, the application intends to include any changes, uses or improvements of the application, including changes made by conventional techniques known in the art, which are outside the scope disclosed in the application. Some basic features can be applied within the scope of the following attached claims.
Claims
1. Use of a substance that reduces the activity and / or expression of RPL22 protein in the preparation of a product; the function of the product is at least one of the following C1) to C6): C1) delaying aging; C2) preventing aging-related diseases; C3) treating aging-related diseases; C4) inhibiting heterochromatin disintegration; C5) improving heterochromatin stability; C6) inhibiting rRNA expression level.
2. The use of a substance that reduces the activity and / or expression of RPL22 protein is at least one of the following C1) to C6): C1) delaying aging; C2) preventing diseases associated with aging; C3) treating diseases associated with aging; C4) inhibiting heterochromatin disintegration; C5) increasing heterochromatin stability; C6) inhibiting rRNA expression levels.
3. The use according to claim 1 or 2, characterized in that: The substance that reduces the activity and / or expression of the RPL22 protein includes an sgRNA encoding gene; the target recognized by the sgRNA is a DNA molecule shown in SEQ ID NO: 1 or SEQ ID NO:
2.
4. The use according to claim 3, characterized in that: When the target recognized by the sgRNA is the DNA molecule shown in SEQ ID NO: 1, the substance that reduces the activity and / or expression of the RPL22 protein is oligo dimer 1 composed of the DNA molecule shown in SEQ ID NO: 4 and the DNA molecule shown in SEQ ID NO: 5; When the target recognized by the sgRNA is the DNA molecule shown in SEQ ID NO: 2, the substance that reduces the activity and / or expression of the RPL22 protein is oligo dimer 2 composed of the DNA molecule shown in SEQ ID NO: 6 and the DNA molecule shown in SEQ ID NO:
7.
5. The use according to claim 1 or 2, characterized in that: In said C1), delaying aging is delaying cellular aging; Preferably, the cells are human mesenchymal progenitor cells or human fibroblasts; Preferably, the senescence of human mesenchymal progenitor cells is pathological senescence, stress-induced senescence or replicative senescence.
6. Use of RPL22 protein as a drug target in the preparation of a product; the function of the product is at least one of the following C1) to C6): C1) delaying aging; C2) preventing aging-related diseases; C3) treating aging-related diseases; C4) inhibiting heterochromatin disintegration; C5) improving heterochromatin stability; C6) inhibiting rRNA expression levels.
7. The use according to claim 6, characterized in that: In said C1), delaying aging is delaying cellular aging; Preferably, the cells are human mesenchymal progenitor cells or human fibroblasts; Preferably, the senescence of human mesenchymal progenitor cells is pathological senescence, stress-induced senescence or replicative senescence.
8. Use of RPL22 protein in preparing a product; the function of the product is at least one of A1)-A6): A1) promoting aging; A2) studying diseases associated with aging; A3) preparing a mouse model with an early aging phenotype; A4) promoting heterochromatin disassembly; A5) reducing heterochromatin stability; A6) promoting rRNA expression levels.
9. The application of RPL22 protein is at least one of A1)-A6): A1) promoting aging; A2) studying diseases associated with aging; A3) preparing a mouse model with an early aging phenotype; A4) promoting heterochromatin disassembly; A5) reducing heterochromatin stability; A6) promoting rRNA expression level.
10. The use according to claim 8 or 9, characterized in that: In said A1), promoting aging means promoting cellular aging; Preferably, the cells are human mesenchymal progenitor cells or human fibroblasts; Preferably, the senescence of human mesenchymal progenitor cells is pathological senescence, stress-induced senescence or replicative senescence.