Fusion protein expression system for promoting yeast to secrete bovine lactoferrin

Abstract

The invention discloses a fusion protein expression system suitable for expressing long-chain helper protein in yeast, which is a gene expression cassette of fusion protein of helper protein and bovine lactoferrin, and comprises a double KREAEA structural domain + flexible Linker tandem helper protein gene and bovine lactoferrin gene, and the fusion protein assists in folding of bovine lactoferrin in cells, so that the expression of long-chain helper protein is realized. The fusion protein is excised in cells, and the secretion efficiency of correctly folded bovine lactoferrin is remarkably enhanced.

Description

Technical Field

[0001] This invention belongs to the field of genetic engineering technology, specifically relating to a fusion protein expression system that can promote the secretion of bovine lactoferrin by yeast. Background Technology

[0002] Bovine lactoferrin (bLF or BLF, UniProt: P24627) is a long-chain protein with a large molecular weight. Bovine lactoferrin with a natural folded structure has high biological activity and has been widely used in the pharmaceutical, food, and cosmetic industries, with a large social demand.

[0003] Producing bovine lactoferrin through fermentation with genetically engineered bacteria is a promising method. However, when commonly used bacteria such as *Escherichia coli*, *Bacillus subtilis*, and *Corynebacterium glutamicum* express proteins with a large number of amino acids, the polypeptide products often fail to fold correctly, and the proteins readily form inclusion bodies during expression, resulting in low soluble expression. Furthermore, *E. coli* expression also suffers from drawbacks such as endotoxin contamination, susceptibility to bacteriophage infection, and difficulty in producing edible products that are acceptable to consumers.

[0004] While using genetic engineering systems such as yeast and other fungi with high safety profiles to express complex long-chain peptides has certain advantages, it generally suffers from low exogenous protein secretion efficiency and insufficient expression levels. Our previous research found that overexpressing the bovine lactoferrin gene in *Saccharomyces cerevisiae* and *Pichia pastoris* resulted in very low bovine lactoferrin content in the fermentation broth, far below expectations, hindering industrial development and application. Summary of the Invention

[0005] To achieve high expression of bovine lactoferrin in yeast, it is necessary to overcome the problems of low secretion efficiency and insufficient expression of exogenous proteins in yeast. We considered using an exogenous protein with a high expression level in yeast as a fusion partner to assist in the expression and secretion of the target protein bLF.

[0006] Numerous methods for expressing fusion proteins in yeast have been reported. For example, patent document WO2004 / 027067A1 reports a method for enhancing the secretion of recombinant polypeptides by yeast and bacterial cells through fusion protein technology; patent document CN 117363641 A reports a fusion expression method for recombinant dibasic endopeptidase and carboxypeptidase B, using a structure of recombinant dibasic endopeptidase truncated variant-linked peptide-carboxypeptidase B proteaseogen; and patent document CN116083475A reports the promotion of the expression of the target protein human IGF-1 or its analogue LR3IGF-1 in Pichia pastoris through fusion protein.

[0007] Experiments revealed that traditional fusion tags (such as α-factor signal peptide) have limited effect on enhancing the secretion of bovine lactoferrin (bLF) in Pichia pastoris (see patent document CN119930758A), and the activity of the secreted bLF is not as good as that of native bLF, suggesting that the expressed bLF cannot form a well-formed folded structure. We devised an auxiliary expression scheme that forms a fusion with a highly expressed yeast protein to achieve high expression in yeast cells, and allows for intracellular cleavage to secrete bLF separately extracellularly. Ideally, this highly expressed yeast protein should act as a fusion partner to maintain the folded conformation of bLF. Therefore, dozens of reported yeast high-expression proteins were screened and compared experimentally. It was found that human serum albumin (HSA; UniProt ID: P02768), xylanase (PDB: 1XYP), and phytase (phyA, UniProt: P34752) could meet the above requirements and help improve the high expression and extracellular secretion of bLF in Pichia pastoris. In particular, the effect of promoting the expression and secretion of bovine lactoferrin in yeast was even better when their genes were expressed in tandem with the α-factor signal peptide gene. Based on this, the present invention includes the following technical solution.

[0008] The first aspect of the present invention provides a fusion protein expression system, which is a gene expression cassette of a fusion protein of an accessory protein and bovine lactoferrin (bLF), the structure of which is: promoter-signal peptide gene-protease cleavage site-accessory protein gene-flexible linker (G4S)n-protease cleavage site-bovine lactoferrin (bLF) gene sequence-terminator, wherein n is 2, 3 or 4.

[0009] In the above fusion protein expression system, the protease cleavage site can be Kex2 or Ste13 or a combination of both, preferably a combination of Kex2 and Ste13; and / or

[0010] The aforementioned signal peptide gene can be any signal peptide suitable for expression in Pichia pastoris, preferably an α signal peptide.

[0011] In one embodiment, the above-described fusion protein expression system is used to express a fusion protein of an accessory protein (or fusion chaperone) and bovine lactoferrin in yeast, and to cleave the two proteins intracellularly, particularly at the endoplasmic reticulum or Golgi apparatus, and then secrete the properly folded bovine lactoferrin extracellularly.

[0012] Preferably, the aforementioned accessory proteins are exogenous proteins that can be highly expressed in Pichia pastoris, with expression levels far exceeding those of bovine lactoferrin, and are selected from human serum albumin (HSA), xylanase, and phytase. Correspondingly, the fusion proteins expressed intracellularly are HAS-bLF, xylanase-bLF, and phytase-bLF.

[0013] The promoter in the above-mentioned fusion protein expression system can be the alcohol oxidase promoter Paox1, a potent inducible promoter commonly used in Pichia pastoris for the production of recombinant proteins; the terminator can be the alcohol oxidase 1 transcription terminator Taox1.

[0014] Preferably, the yeast is Pichia pastoris or Saccharomyces cerevisiae, and the corresponding nucleotide sequence of the bovine lactoferrin (bLF, UniProt: P24627) gene is SEQ ID NO:1; the nucleotide sequence of the human serum albumin (HAS, UniProt ID: P02768) gene is SEQ ID NO:2; the nucleotide sequence of the xylanase (PDB: 1XYP) gene is SEQ ID NO:3; the nucleotide sequence of the phytase (phyA, UniProt: P34752) gene is SEQ ID NO:4; and the nucleotide sequence of the α-mating factors signal peptide gene is SEQ ID NO:5.

[0015] Further, the nucleotide sequence of the promoter Paox1 is SEQ ID NO:6; the nucleotide sequence of the terminator Taox1 is SEQ ID NO:7; and the nucleotide sequence of the KEX2 and STE13 restriction site KREAEA coding sequence is SEQ ID NO:8.

[0016] aagagagaagctgaggct(SEQ ID NO:8);

[0017] The Linker is (G4S)2, namely GGGGSGGGGS (SEQ ID NO:9).

[0018] The nucleotide sequence of the above Linker(G4S)2 encoding gene is ggtggtggtggttctggtggtggtggttct.

[0019] Optionally, upstream of the promoter Paox1, there is also an upstream homologous arm (int1 site upstream homologous arm, int1up), the nucleotide sequence of which is SEQ ID NO:10;

[0020] Downstream of the terminator Taox1 is a downstream homologous arm (int1 site downstreamhomologous arm, int1dn), the nucleotide sequence of which is SEQ ID NO:11.

[0021] A second aspect of the present invention provides a fusion protein expression plasmid, which is a recombinant plasmid on a plasmid vector that clones the fusion protein expression system described above.

[0022] Preferably, the plasmid vectors mentioned above are plasmid vectors suitable for expressing exogenous proteins in yeast, especially Pichia pastoris or Saccharomyces cerevisiae. For example, the plasmid vectors mentioned above can be selected from the following group: pUC19, pUC57, pYES2, etc.

[0023] A third aspect of the present invention provides a yeast engineered strain, namely Pichia pastoris or Saccharomyces cerevisiae, whose genome integrates the fusion protein expression system described above.

[0024] In one embodiment, the aforementioned engineered yeast strain is a transformant that has been transformed with the fusion protein expression plasmid as described above; or it is a positive recombinant strain that has cloned the fusion protein expression system as described above into the host yeast genome using gene editing technology.

[0025] Optionally, the gene editing technologies described above may be selected from the following group: homologous double crossover, TALEN system, CRISPR-Cas9 system, CRISPR-Cpf1 system, CRISPR-Cas12 system, CRISPR-BEST system, and MuGENT.

[0026] The fourth aspect of this invention provides the application of the above-mentioned engineered yeast strain in the production of bovine lactoferrin (bLF).

[0027] In this application, after fermentation by engineered yeast, bovine lactoferrin that has been correctly folded is secreted into the fermentation broth. More preferably, the auxiliary protein / fusion chaperone is retained intracellularly and not secreted, which facilitates the extraction, separation and purification of the target product, bovine lactoferrin.

[0028] This invention provides a strategy for the expression and separate secretion of bovine lactoferrin in yeast. A novel fusion expression vector is designed, which uses a dual KREAEA domain and a flexible linker to tandem with bovine lactoferrin (bLF). The fusion protein helps bovine lactoferrin fold correctly and enables intracellular excision of the fusion protein, significantly enhancing the secretion efficiency of bLF. Attached Figure Description

[0029] Figure 1The image shows an agarose gel electrophoresis photograph of bovine lactoferrin fusion gene integration into the Pichia pastoris genome, as detected by PCR. Lanes 1-8 are HSA-BLF transformants, lanes 9-16 are XYL-BLF transformants, lanes 17-24 are phyA-BLF transformants, and lanes 25-32 are BLF-expressing transformants.

[0030] Figure 2 The HPLC chromatograms of bLF yield from the engineered bacterial fermentation broth are shown. A: HSA-bLF fermentation broth; B: xylanase-bLF fermentation broth; C: phytase-bLF fermentation broth; D: single bLF (control) fermentation broth. Detailed Implementation

[0031] A highly desirable design strategy is to achieve high expression of bLF in yeast by using a fusion protein of accessory proteins and the target protein bLF, followed by intracellular cleavage of the fusion protein to release bLF, and then allowing the cell to release the correctly folded bLF while retaining the accessory proteins intracellularly. To this end, we designed the fusion protein expression cassette as follows: promoter Paox1 - *Saccharomyces cerevisiae*-derived α-factor signal peptide gene - Kex2 and Ste13 protease cleavage sites (e.g., KREAEA expression gene) - accessory protein gene - linker (e.g., GGGGSGGGGS) - Kex2 and Ste13 protease cleavage sites (e.g., KREAEA expression gene) - bovine lactoferrin gene - terminator Taox1. The accessory protein was limited to one of three after screening and experimental comparison: human serum albumin, xylanase, and phytase. Furthermore, these proteins / genes were optimized using codons preferred by *Pichia pastoris*, and then cascaded together to construct the expression cassette.

[0032] This expression cassette can be constructed using overlap-PCR to form a structure of homologous arm-Paox1-signal peptide-KREAEA-accessory protein-linker-KREAEA-bLF-Taox1-homologous arm, which allows for the fusion of the accessory protein with bovine lactoferrin via a dual KREAEA domain and a flexible linker.

[0033] Next, the fusion protein expression cassette was integrated into the Pichia pastoris genome using gene editing technology for heterologous expression, significantly enhancing the expression level and secretion efficiency of bioactive bLF. The integration method can employ CRISPR-Cas9 targeting the int1 site of the genome.

[0034] It should be understood that the above integration methods are not limited to these; Gibson assembly or traditional restriction endonuclease digestion-ligation methods can also be used.

[0035] In this article, the terms “(expression level / secretion efficiency) increase,” “enhancement,” or “increase” as used above mean an increase of at least 20% or more compared to a reference level, such as at least 30%, at least 50%, at least 80%, at least about 1, at least about 2, at least about 3, at least about 4, or at least about 5 times compared to a reference level (e.g., bLF expression alone).

[0036] In this document, for the sake of simplicity, the name of a protein, such as human serum albumin (HSA), and its encoding gene (DNA) are sometimes used interchangeably. Those skilled in the art should understand that they represent different types of substances in different descriptive contexts. Their meanings are readily understood by those skilled in the art based on the context. For example, when describing the function or class of human serum albumin, HSA refers to the protein; when describing it as a gene, it refers to the gene encoding that protein.

[0037] As used herein, an "expression cassette" or "gene expression cassette" refers to a gene expression system containing all the necessary elements required to express a target protein (fusion protein or bLF), typically including the following elements: a promoter, a gene sequence encoding a polypeptide, and a terminator; additionally, it may optionally include a signal peptide encoding sequence such as mCherry (red fluorescent protein), GFP (green fluorescent protein), or YFP (yellow fluorescent protein); these elements are operatively linked.

[0038] As used herein, "exogenous" or "heterogeneous" refers to the relationship between two or more nucleic acid or protein sequences from different sources, or the relationship between a protein (or nucleic acid) from different sources and a host cell. For example, if the combination of nucleic acid and host cell is not normally naturally occurring, then the nucleic acid is exogenous to that host cell. A particular sequence is "exogenous" to the cell or organism in which it is inserted.

[0039] As used herein, “operationally linked” or “operationally connected” refers to a functional spatial arrangement of two or more nucleic acid regions or nucleic acid sequences. For example, a promoter region is placed at a specific position relative to the target gene nucleic acid sequence SEQ ID NO:1-5, such that transcription of the nucleic acid sequence is guided by the promoter region, thereby the promoter region is “operationally linked” to the nucleic acid sequence.

[0040] The nucleic acid constructs described in this invention can be manipulated in various ways to ensure the expression of the fusion protein, such as HAS-bLF. The nucleic acid constructs can be manipulated according to the expression vector or requirements before insertion into the vector. Techniques for altering polynucleotide sequences using recombinant DNA methods are known in the art.

[0041] In some embodiments, the nucleic acid construct is a plasmid vector. The vector can be a cloning vector, an expression vector, or a gene knock-in vector. The nucleic acid sequences SEQ ID NO:1-11 of the present invention can be cloned into many types of vectors, such as plasmids, phage particles, phage derivatives, animal viruses, and granules. Cloning vectors can be used to provide the coding sequence of the protein or polypeptide of the present invention. Expression vectors can be provided to cells in the form of bacterial or viral vectors. Expression of fusion proteins, such as HAS-bLF, is typically achieved by operably linking the nucleic acid sequences SEQ ID NO:1-5 of the present invention to a promoter and incorporating the construct into an expression vector. This vector is suitable for replication and integration into eukaryotic cells. Typical expression vectors contain expression control sequences that can be used to regulate the expression of the desired nucleic acid sequence.

[0042] Gene knock-in vectors can be used to integrate the nucleotide sequences SEQ ID NO:1-11 described herein into regions of interest in the host genome. Typically, gene knock-in vectors contain, in addition to the polynucleotide sequences described herein, 5' and 3' homologous arms required for genomic homologous recombination. In some embodiments, the nucleic acid constructs described herein contain 5' homologous arms, the polynucleotide sequences described herein, and 3' homologous arms. When using gene knock-in vectors, CRISPR / Cas9 technology can be used simultaneously to homologously recombine the polynucleotide sequences into the sites of interest. CRISPR / Cas9 technology guides the Cas9 nuclease to modify the genome at the insertion site by designing guide RNAs targeting the target gene, resulting in increased homologous recombination efficiency in the modified gene region, thus homologously recombinating the target fragment SEQ ID NO:1-11 contained in the gene knock-in vector into the target site. The steps of CRISPR / Cas9 technology and the reagents used, such as the Cas9 nuclease, are well known in the art.

[0043] When the fusion protein of the present invention, such as HAS-bLF, is expressed in higher eukaryotic cells, transcription will be enhanced when an enhancer sequence is inserted into the vector. Enhancers are cis-acting factors of DNA, typically approximately 10 to 300 base pairs, that act on the promoter to enhance gene transcription. Examples include the SV40 enhancer (100 to 270 base pairs) located late on the replication origin side, the polyoma enhancer located late on the replication origin side, and adenovirus enhancers.

[0044] The present invention will be further described in detail below with reference to specific embodiments. It should be understood that the following embodiments are for illustrative purposes only and are not intended to limit the scope of the invention.

[0045] Example

[0046] The examples involve the addition amount, content and concentration of various substances, and unless otherwise specified, the percentage content refers to the mass percentage content.

[0047] In the embodiments described herein, unless otherwise specified, the temperature generally refers to room temperature (15-30°C).

[0048] Materials and methods

[0049] In the embodiments, the whole gene synthesis, primer synthesis and sequencing were all completed by Suzhou Genewiz Biotechnology Co., Ltd.

[0050] The molecular biology experiments in the examples included plasmid construction, enzyme digestion, ligation, preparation of competent cells, transformation, and culture medium preparation, etc., mainly referring to "Molecular Cloning: A Laboratory Manual" (4th Edition), edited by M.R. Green and J. Sambrook (USA), translated by He Fuchu, Science Press, Beijing, 2017. Specific experimental conditions can be determined through simple experiments if necessary.

[0051] PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary.

[0052] The strains used included Pichia pastoris GS115, which was purchased from the Shanghai Institute of Microbiology.

[0053] Example 1: Construction of a fusion protein expression cassette using overlap-PCR

[0054] 1. Gene fragment design:

[0055] Upstream / downstream homologous arms: derived from the Pichia pastoris genome

[0056] Accessory protein sequences: HSA (UniProt ID: P02768), xylanase (PDB: 1XYP), phytase (UniProt: P34752), optimized by Pichia pastoris preferred codons, are shown in Table 1.

[0057] The bovine lactoferrin sequence (UniProt: P24627), after optimization using Pichia pastoris preferred codons, is shown in Table 1.

[0058] 2. Primer design:

[0059] Design overlapping primers (containing a 30-39 bp overlap region), amplify each module stepwise, and then assemble them. Primer sequences are shown in Table 2.

[0060] 3. PCR ligation.

[0061] Homologous arms - Paox1-Alpha factor signal peptide sequence - KREAEA-fusion protein - linker - KREAEA-bovine lactoferrin sequence - terminator Taox1-homologous arms were spliced ​​using overlap-PCR.

[0062] Table 1. Gene Sequences

[0063]

[0064]

[0065]

[0066]

[0067]

[0068] In Table 1, the KEX2 and STE13 restriction site gene sequence SEQ ID NO:12 contains the KREAEA coding sequence SEQ ID NO:8, the Linker (G4S)2 coding gene sequence, and the codon ctggag for the two amino acids LE used to connect Linker (G4S)2 and KREAEA.

[0069] Table 2, Primer List: 5'-3'

[0070]

[0071]

[0072] In Table 2, "-F" in the name represents positive; "-R" represents negative.

[0073] 4. Assembly process:

[0074] The recombinant human serum albumin fusion table of lactoferrin fragments is assembled as follows: upstream homologous arm int1up - AOX1 promoter Paox1 - Alpha factor signal peptide (containing KREAEA) - human serum albumin HSA - linker - KREAEA - bovine lactoferrin sequence BLF - AOX1 terminator Taox1 - downstream homologous arm int1dn.

[0075] Using the *Pichia pastoris* genome as a template and int1up-F / int1up-R as primers, the upstream homologous arm *int1up* fragment of the *Pichia pastoris* int1 site was amplified by PCR. Using the *Pichia pastoris* genome as a template and Paox1-F / Paox1-R as primers, the *Paox1* fragment of the *Pichia pastoris* AOX1 gene promoter was amplified by PCR. Using the pPIC9K plasmid as a template and a-factor-F / a-factor-R as primers, the α-mating factor signal peptide was amplified by PCR to obtain the Alpha factor fragment. Using the human serum albumin (HSA) gene with optimized gene synthesis codons as a template and HSA-F / HSA-R as primers, the HSA fragment was amplified by PCR. Using the bovine lactoferrin (BLF) gene with optimized gene synthesis codons as a template and Linker-BLF-F / BLF-R as primers, the Linker-KREAEA-BLF fragment was amplified by PCR. Using the Pichia pastoris genome as a template and Taox1-F / Taox1-R as primers, the Taox1 fragment, the terminator of the Pichia pastoris AOX1 gene, was amplified by PCR. Using the Pichia pastoris genome as a template and int1dn-F / int1dn-R as primers, the downstream homologous arm int1dn fragment of the Pichia pastoris int1 site was amplified by PCR. Through multiple rounds of overlap PCR amplification, the fragment finally obtained for recombination was: int1up-Paox1-Alpha factor-HSA-Linker-KREAEA-BLF-Taox1-int1dn.

[0076] Similarly, construct the following recombinant fragment:

[0077] Upstream homologous arm int1up-AOX1 promoter Paox1-Alpha factor signal peptide (containing KREAEA)-xylanase XYL-linker-KREAEA-bovine lactoferrin sequence BLF-AOX1 terminator Taox1-downstream homologous arm int1dn.

[0078] The spliced ​​fragment is as follows: upstream homologous arm int1up-AOX1 promoter Paox1-Alpha factor signal peptide (containing KREAEA)-phytase phyA-linker-KREAEA-bovine lactoferrin sequence BLF-AOX1 terminator Taox1-downstream homologous arm int1dn.

[0079] Upstream homologous arm int1up - AOX1 promoter Paox1 - Alpha factor signal peptide (containing KREAEA) - bovine lactoferrin sequence BLF - AOX1 terminator Taox1 - Downstream homologous arm int1dn.

[0080] Using the methods described above, expression cassettes for fusion proteins HAS-bLF, xylanase-bLF, phytase-bLF, and single bLF (control) were obtained, respectively.

[0081] Example 2: CRISPR-Cas9 Genome Integration

[0082] Table 3. Primer List: 5'-3'

[0083] Primer Sequence(5’-3’) cas9-F aaaagtgccacctgacgtcggtaccgttaactctagatttttgtagaaatgtcttggtg cas9-R ttataggttaatgtcatgataataatggtttcttagggggagactgctgatgttcaacc HPpSER-F ctgtgggtatcaggttgaacatcagcagtctccccctaagaaaccattattatcatgac HP20int1-R atttctagctctaaaaccccagtaaatacttcagatagcgtcacagacaggattcgaac HP20int1-F atcctgtctgtgacgctatctgaagtatttactggggttttagagctagaaatagcaag HPAmp-R ccaagacatttctacaaaaatctagagttaacggtaccgacgtcaggtggcacttttcg UBLF-seq1 gaccagttgctgctgagatctac int1-otr-R catgcttcgcctttccagatg

[0084] In Table 3, "-F" in the name represents positive; "-R" represents negative.

[0085] 1. Construct the gRNA plasmid HZP-cas9-sgRNA-int1 targeting the int1 site.

[0086] Using the pGAP-cas9 plasmid (a gift from the Lian Jiachang research group at Zhejiang University; plasmid structure description can be found in the literature DOI: 10.1021 / acssynbio.1c00307) as a template, and cas9-F / cas9-R as primers, the cas9 fragment was amplified by PCR. Using the HZP-sgRNA plasmid (a gift from the Lian Jiachang research group at Zhejiang University; plasmid structure description can be found in the literature DOI: 10.1021 / acssynbio.1c00307) as a template, and HPpSER-F / HP20int1-R as primers, the pSER-sgRNA fragment was amplified by PCR. Using the HZP-sgRNA plasmid as a template, and HP20int1-F / HPAmp-R as primers, the zeocin-PARS1 fragment was amplified by PCR. The Pro Seamless Cloning and Assembly Kit (TransGen #CU202-02) was used to assemble the above fragments to obtain the plasmid HZP-cas9-sgRNA-int1.

[0087] 2. The expression cassette from Example 1 was co-transformed with the Cas9 plasmid into Pichia pastoris GS115.

[0088] Preparation of competent cells of Pichia pastoris:

[0089] (1) Take out the P. pastoris GS115 glycerol bacteria stored in the -80℃ freezer, pick a small amount from the frozen tube and streak it onto YPD antibiotic-free solid medium, incubate at 30℃ for 3 days until larger colonies grow, then take them out.

[0090] (2) Pick larger colonies from the plate and inoculate them into 10 mL of YPD medium. Incubate at 30°C and 200 rpm for 1 day.

[0091] (3) Secondary activation: Add 1 mL of bacterial solution from step (2) to 100 mL of YPD medium and incubate for 4-5 hours. The time should not be too long to maintain the activity of the bacteria.

[0092] (4) Place the cultured bacterial solution on ice for a certain period of time, and then dispense the bacterial solution into sterile 50mL centrifuge tubes in a sterile workbench. Centrifuge at 4℃, 4,000×g for 5min and discard the supernatant. Add 10mL of sterile water to each tube, resuspend the cells by pipetting, and then centrifuge at 4℃, 4,000×g for 5min and discard the supernatant. Repeat the washing process 3 times.

[0093] (5) After washing with water 3 times, add 1 mL of pre-cooled 1M sorbitol to each tube, resuspend the cells, transfer them to sterile 1.5 mL centrifuge tubes, centrifuge at 4℃, 4,000×g for 5 min, and discard the supernatant.

[0094] (6) Add 80 μL of pre-cooled 1M sorbitol to each tube, resuspend the cells by pipetting, and the preparation of P. pastoris GS115 competent cells is complete and ready for use.

[0095] Transformation of Pichia pastoris:

[0096] The fragment from step 1 and the HZP-cas9-sgRNA-int1 plasmid were added to the prepared Pichia pastoris competent cells, gently mixed, and incubated on ice for 5 min. After the ice incubation, the competent cells containing the recombinant expression vector were transferred to a prepared 0.2 cm electroporation cuvette. Electroporation was performed at 1,500 V for 5 ms. After electroporation, 1 mL of 1 M sorbitol placed on ice was quickly added, and the mixture was pipetted several times. The liquid in the electroporation cuvette was then transferred to a centrifuge tube and incubated in a 30°C metal bath for 1-2 h. Then, the cells were centrifuged at 6,000 × g for 5 min, the supernatant was discarded, and the mixture was plated on YPD-zeocin plates and cultured at 30°C for 3 days until larger colonies appeared.

[0097] Transformer verification:

[0098] Transformants obtained from YPD-zeocin plates were subjected to colony PCR. Using the transformant colonies on the plate as templates and UBLF-seq1 / int1-otr-R as primers, PCR amplification yielding a 3Kb fragment was considered positive. Figure 1 As shown.

[0099] The engineered Pichia pastoris strains expressing the fusion proteins HAS-bLF, xylanase-bLF, and phytase-bLF are also named HAS-bLF, xylanase-bLF, and phytase-bLF, respectively; engineered Pichia pastoris strains that do not express -bLF alone are named single bLF.

[0100] Example 3: Fermentation with engineered yeast

[0101] 1. Fermentation process:

[0102] Seed culture medium:

[0103] M2 medium + 1% glycerol: 22 g / L citric acid monohydrate, 3.15 g / L (NH4)2HPO4, 0.8 g / L KCl, 0.49 g / L MgSO4·7H2O, 0.0268 g / L CaCl2·2H2O, 0.4 mg / L biotin, 1.47 ml PTM1 trace element stock solution, 10 mL / L glycerol, pH adjusted to 5.0 with KOH.

[0104] PTM1 trace element stock solution: Biotin 0.2 g / L CuSO4·5H2O, 6 g / L KI 0.09 g / L, MnSO4·H2O 3 g / L, Na2MoO4·2H2O 0.2 g / L, H3BO3 0.02 g / L, CoCl2 0.5 g / L, ZnSO4·7H2O 42.2 g / L, FeSO4·7H2O 65 g / L, H2SO4 5 ml / L.

[0105] Fermentation medium:

[0106] M2 medium + 0.5% methanol: citric acid monohydrate 22 g / L, (NH4)2HPO4 3.15 g / L, KCl 8 g / L, MgSO4·7H2O 0.49 g / L, CaCl2·2H2O 0.0268 g / L, biotin 0.4 mg / L, PTM1 trace element stock solution 1.47 ml, methanol 5 mL / L, pH adjusted to 5.0 with KOH.

[0107] Shake-flask fermentation process:

[0108] Transformants that were identified as positive were selected and cultured overnight in test tubes with YPD for 24 hours.

[0109] Inoculate 3% v / v into 30 ml of seed culture medium and incubate at 30°C and 250 rpm for 16-20 h.

[0110] Centrifuge at 4000×g for 10 min, collect the cells, and resuspend the cells in 50 ml of fermentation medium until OD600 is 1.

[0111] Expression was performed at 30°C and 250 rpm.

[0112] Add methanol as an inducer every 12 hours until the final concentration is 1% v / v.

[0113] The total induction time was 48 hours.

[0114] Example 4: Detection of bLF yield by engineered bacteria and verification of the function of bLF product

[0115] The content of bovine lactoferrin (bLF) in the fermentation broth was determined by HPLC, and the folding pattern of bLF was evaluated. The conditions are as follows.

[0116] HPLC: The correct folding of the accessory protein was confirmed according to the detection method of lactoferrin in GB5009.299-2024.

[0117] Figure 2 The HPLC chromatograms of HSA-bLF fusion, xylanase-bLF fusion, phytase-bLF fusion, and single bLF (control) fermentation broth are shown in the figures.

[0118] Reagent preparation:

[0119] Phosphate buffer I: Weigh 7.1g disodium hydrogen phosphate and 58.4g sodium chloride, dissolve in 900mL water, adjust pH to 8.0 with phosphate, and add water to a final volume of 1000mL. Prepare fresh before use.

[0120] Phosphate Buffer II: Weigh 28.4g of disodium hydrogen phosphate, dissolve in 900mL of water, adjust the pH to 7.5 with phosphoric acid, and add water to a final volume of 1000mL. Prepare fresh before use.

[0121] 0.1% trifluoroacetic acid solution: Measure 1 mL of trifluoroacetic acid and inject it into 900 mL of water, dilute with water to 1000 mL, and filter through a 0.45 μm filter membrane.

[0122] Sample preparation:

[0123] Weigh 5g of the sample into a beaker, add an appropriate amount of phosphate buffer II for extraction, transfer the sample to a 25mL volumetric flask in several portions, and make up to the mark with phosphate buffer II. After thorough mixing, transfer to a centrifuge tube and centrifuge at 10000r / min for 8min at 4℃. The sample solution is then purified.

[0124] Sample purification:

[0125] Before use, activate the heparin affinity column with 5.0 mL of phosphate buffer II. Accurately transfer 10.0 mL of the above sample solution through the column, controlling the flow rate at 1 mL / min to 3 mL / min. After the sample solution has been completely dispensed, rinse with 10.0 mL of phosphate buffer II and discard the eluent. Then elute with phosphate buffer I, collect the eluent, and bring the volume to 5.00 mL with phosphate buffer I. Filter the eluent through a 0.45 μm aqueous syringe filter for instrumental analysis.

[0126] HPLC detection conditions:

[0127] Instrument: Agilent 1260 liquid chromatograph.

[0128] Detection wavelength: 280nm.

[0129] Column: C4, 5μm 250mm×4.6mm (inner diameter).

[0130] Column temperature: 30℃.

[0131] Injection volume: 50 μL.

[0132] Flow rate: 1.0 mL / min.

[0133] Mobile phase: 0.1% trifluoroacetic acid solution and acetonitrile.

[0134] Mobile phase gradient elution reference procedure table:

[0135] Time / min Acetonitrile / % 0.1% Trifluoroacetic acid solution / % 0 15 85 20 85 15 22 15 85 25 15 85

[0136] The test results are shown in Table 4:

[0137] Table 4. bLF content in Pichia pastoris engineered fermentation broth

[0138]

[0139]

[0140] As shown in Table 4, compared with the expression of the single bLF protein in Pichia pastoris, the expression of bLF fusion proteins with accessory proteins HAS, xylanase or phytase can greatly increase the production of bLF secreted extracellularly. Among them, xylanase, as a fusion partner, has the most significant enhancing effect on bLF expression and secretion.

Claims

1. A fusion protein expression system, comprising a gene expression cassette of a fusion protein of an accessory protein and bovine lactoferrin (bLF), characterized in that, Its structure is as follows: promoter-signal peptide gene-protease cleavage site-accessory protein gene-Linker(G4S)n-protease cleavage site-bovine lactoferrin (bLF) gene sequence-terminator, where n is 2, 3 or 4.

2. The fusion protein expression system of claim 1, wherein the protease cleavage site is Kex2 or Ste13 or a combination of both, preferably a combination of Kex2 and Ste13; and / or The signal peptide gene can be any signal peptide suitable for expression in Pichia pastoris, preferably an α signal peptide.

3. The fusion protein expression system as described in claim 1, characterized in that, The fusion protein expression system is used to express a fusion protein of accessory protein and bovine lactoferrin in yeast, and to cleave both proteins inside the cell, and then secrete the properly folded bovine lactoferrin outside the cell.

4. The fusion protein expression system as described in claim 3, characterized in that, The accessory protein is selected from human serum albumin, xylanase, and phytase. The promoter is the alcohol oxidase promoter Paox1, and the terminator is the alcohol oxidase 1 transcription terminator Taox1.

5. The fusion protein expression system as described in claim 3 or 4, characterized in that, The yeast is Pichia pastoris or Saccharomyces cerevisiae, and the corresponding nucleotide sequence of the bovine lactoferrin (bLF, UniProt: P24627) gene is SEQ ID NO:1; the nucleotide sequence of the human serum albumin (HAS, UniProt ID: P02768) gene is SEQ ID NO:2; the nucleotide sequence of the xylanase (PDB: 1XYP) gene is SEQ ID NO:3; the nucleotide sequence of the phytase (phytase, UniProt: P34752) gene is SEQ ID NO:4; and the nucleotide sequence of the α-factor signal peptide gene is SEQ ID NO:

5.

6. The fusion protein expression system as described in claim 4, characterized in that, The nucleotide sequence of the promoter Paox1 is SEQ ID NO:6; the nucleotide sequence of the terminator Taox1 is SEQ ID NO:7; the nucleotide sequence of the KEX2 and STE13 restriction site KREAEA coding sequence is SEQ ID NO:8; the linker is (G4S)2, i.e., GGGGSGGGGS (SEQ ID NO:9).

7. A fusion protein expression plasmid, characterized in that, It is a recombinant plasmid on a plasmid vector that clones the fusion protein expression system as described in any one of claims 1-6.

8. The fusion protein expression plasmid as described in claim 7, characterized in that, The plasmid vector is a plasmid vector suitable for expressing exogenous proteins in yeast.

9. A yeast engineered strain, preferably Pichia pastoris or Saccharomyces cerevisiae, characterized in that, The genome integrates the fusion protein expression system as described in any one of claims 1-6.

10. The use of the engineered yeast strain as described in claim 9 in the production of bovine lactoferrin.

Images