Acetolactate synthase mutants and uses thereof

Abstract

The application discloses an acetyl lactic acid synthase mutant and application thereof, and belongs to the technical field of bioactive enzymes. The acetyl lactic acid synthase mutant is acetyl lactic acid synthase-PCC6803-L255I, acetyl lactic acid synthase-PCC6803-V398I or acetyl lactic acid synthase-PCC6803-T488V. The application of the acetyl lactic acid synthase mutant in catalyzing preparation of acetyl lactic acid. The acetyl lactic acid synthase derived from PCC6803 is reformed by a site-directed mutation method, and mutant enzymes, acetyl lactic acid synthase-PCC6803-L255I, acetyl lactic acid synthase-PCC6803-V398I and acetyl lactic acid synthase-PCC6803-T488V, are screened, and the catalytic efficiency of the mutant enzymes is 120%, 130% and 110% of that of the wild enzyme respectively. The application lays a technical foundation for metabolic engineering of a blue-green algae photosynthetic cell factory.

Description

Technical Field

[0001] This invention relates to an acetolactate synthase mutant and its applications, belonging to the field of bioactive enzyme technology. Background Technology

[0002] Acetolactate synthase (AHAS, EC 2.2.1.6) is a key enzyme in the branched-chain amino acid synthesis pathway. It consists of a catalytic subunit (CSU), i.e., the large subunit, and a regulatory subunit (RSU), i.e., the small subunit. This enzyme depends on the cofactors thiamine pyrophosphate (TPP), flavin adenine dinucleotide (FAD), and Mg. 2+ The activation of acetyllactate synthase catalyzes the decarboxylation of two molecules of pyruvate to produce 2-acetyllactate and CO2, thus initiating the synthesis pathway of branched-chain amino acids (valine, leucine, and isoleucine). Acetyllactate synthase is widely found in plant systems (including terrestrial higher plants and aquatic algae) and microbial systems (such as bacteria and fungi).

[0003] Synechocystis PCC6803 ( Synechocystis sp. PCC6803 is a single-celled freshwater cyanobacterium belonging to the order Chrochocotyle, and is a model organism for photosynthesis and synthetic biology research. Whole-genome sequencing results indicate that PCC6803 contains an acetolactate synthase gene, but its expression, purification, and enzymatic properties have not yet been studied.

[0004] Wild enzymes often have shortcomings in terms of stability and catalytic efficiency. Therefore, site-directed mutagenesis is often used to modify wild enzymes in order to improve catalytic efficiency, enhance stability, and change substrate specificity. Summary of the Invention

[0005] In view of the above-mentioned prior art, the present invention provides an acetolactate synthase mutant and its application, belonging to the field of bioactive enzyme technology.

[0006] This invention is achieved through the following technical solution:

[0007] An acetyllactate synthase mutant is acetyllactate synthase-PCC6803-L255I, acetyllactate synthase-PCC6803-V398I, or acetyllactate synthase-PCC6803-T488V.

[0008] The acetolactate synthase-PCC6803-L255I is composed of a catalytic subunit and a regulatory subunit. The amino acid sequence of the catalytic subunit is shown in SEQ ID NO.21, and the amino acid sequence of the regulatory subunit is shown in SEQ ID NO.3.

[0009] The acetolactate synthase-PCC6803-V398I is composed of a catalytic subunit and a regulatory subunit. The amino acid sequence of the catalytic subunit is shown in SEQ ID NO.23, and the amino acid sequence of the regulatory subunit is shown in SEQ ID NO.3.

[0010] The acetolactate synthase-PCC6803-T488V is composed of a catalytic subunit and a regulatory subunit. The amino acid sequence of the catalytic subunit is shown in SEQ ID NO.25, and the amino acid sequence of the regulatory subunit is shown in SEQ ID NO.3.

[0011] Furthermore, the nucleotide sequence of the gene encoding the catalytic subunit of acetolactate synthase-PCC6803-L255I is shown in SEQ ID NO.22, and the nucleotide sequence of the gene encoding the regulatory subunit is shown in SEQ ID NO.4;

[0012] The nucleotide sequence of the gene encoding the catalytic subunit of the acetolactate synthase-PCC6803-V398I is shown in SEQ ID NO.24, and the nucleotide sequence of the gene encoding the regulatory subunit is shown in SEQ ID NO.4.

[0013] The nucleotide sequence of the gene encoding the catalytic subunit of the acetolactate synthase-PCC6803-T488V is shown in SEQ ID NO.26, and the nucleotide sequence of the gene encoding the regulatory subunit is shown in SEQ ID NO.4.

[0014] Furthermore, the gene encoding the catalytic subunit of acetolactate synthase-PCC6803-L255I was obtained by the following method: using a plasmid containing the gene encoding the catalytic subunit of wild-type acetolactate synthase as a template, PCR amplification was performed using specific primers L255I-F and L255I-R.

[0015] The nucleotide sequence of the gene encoding the catalytic subunit of the wild-type acetolactate synthase is shown in SEQ ID NO.2;

[0016] The nucleotide sequence of the specific primer L255I-F is shown in SEQ ID NO.13, and the nucleotide sequence of the specific primer L255I-R is shown in SEQ ID NO.14.

[0017] Furthermore, the gene encoding the catalytic subunit of acetolactate synthase-PCC6803-V398I was obtained by the following method: using a plasmid containing the gene encoding the catalytic subunit of wild-type acetolactate synthase as a template, PCR amplification was performed using specific primers V398I-F and V398I-R.

[0018] The nucleotide sequence of the gene encoding the catalytic subunit of the wild-type acetolactate synthase is shown in SEQ ID NO.2;

[0019] The nucleotide sequence of the specific primer V398I-F is shown in SEQ ID NO.15, and the nucleotide sequence of the specific primer V398I-R is shown in SEQ ID NO.16.

[0020] Furthermore, the gene encoding the catalytic subunit of acetolactate synthase-PCC6803-T488V was obtained by the following method: using a plasmid containing the gene encoding the catalytic subunit of wild-type acetolactate synthase as a template, PCR amplification was performed using specific primers T488V-F and T488V-R.

[0021] The nucleotide sequence of the gene encoding the catalytic subunit of the wild-type acetolactate synthase is shown in SEQ ID NO.2;

[0022] The nucleotide sequence of the specific primer T488V-F is shown in SEQ ID NO.17, and the nucleotide sequence of the specific primer T488V-R is shown in SEQ ID NO.18.

[0023] Application of the acetolactate synthase mutant in the catalytic preparation of acetolactate.

[0024] This invention involved the heterologous expression and purification of acetyllactone synthase from *Synostemma pentaphyllum* PCC6803. The study revealed insufficient conformational stability, which could be a rate-limiting factor in metabolic engineering, restricting the potential application of cyanobacteria as photosynthetic bioreactors. To address this critical bottleneck, this invention modified the wild-type enzyme through site-directed mutagenesis. Combining PROSS and FireProt protein design with molecular docking techniques, mutant enzymes with improved anti-aggregation ability and catalytic efficiency—acetyllactone synthase-PCC6803-L255I, acetyllactone synthase-PCC6803-V398I, and acetyllactone synthase-PCC6803-T488V—were screened. Their catalytic efficiencies were 120%, 130%, and 110% of the wild-type enzymes, respectively, and their protein structural stability was also significantly improved. This invention lays the technological foundation for the metabolic engineering of cyanobacterial photosynthetic cell factories.

[0025] The various terms and phrases used in this invention have their general meanings known to those skilled in the art. Attached Figure Description

[0026] Figure 1SDS-PAGE results of pET28a-slr2088 protein, where M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged pellet of pET-28a BL21(DE3) protein, respectively; lanes 4-6 contain cell lysate, supernatant, and centrifuged pellet of pET28a-slr2088 BL21(DE3) protein expression, respectively.

[0027] Figure 2 SDS-PAGE results of pXXA-slr2088 protein: M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysates, supernatants, and centrifuged pellets of pXXA BL21(DE3); lanes 4-6 contain cell lysates, supernatants, and centrifuged pellets of pXXA-slr2088 BL21(DE3) after 12h induction; lanes 7-9 contain cell lysates, supernatants, and centrifuged pellets of pXXA-slr2088 BL21(DE3) after 24h induction.

[0028] Figure 3 SDS-PAGE results of pXXA-sll0065 protein, where M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged precipitate of pXXA BL21(DE3) respectively; lanes 4-6 contain cell lysate, supernatant, and centrifuged precipitate of pXXA-sll0065 BL21(DE3) protein expression respectively.

[0029] Figure 4 SDS-PAGE results of pET28a-slr2088 protein elution buffer, where M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged precipitate of pET28a-slr2088 protein, respectively; lanes 4-5 contain flow-through buffer; lanes 6-10 contain 20, 40, 60, 80, and 100 mmol / L imidazole elution buffer, respectively; and lanes 11-25 contain 200 mmol / L imidazole elution buffer.

[0030] Figure 5 SDS-PAGE results of pXXA-slr2088 protein elution buffer, where M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged precipitate of pXXA-slr2088 protein, respectively; lanes 4-6 contain flow-through buffer; lanes 7-10 contain 20, 40, 60, and 80 mmol / L imidazole elution buffer, respectively; lanes 11-14 contain 100 mmol / L imidazole elution buffer; and lanes 15-18 contain 200 mmol / L imidazole elution buffer.

[0031] Figure 6Tertiary structure of the slr2088 protein.

[0032] Figure 7 SDS-PAGE results of mutant enzymes S75A and L111M, where M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged pellet of pXXA BL21(DE3); lanes 4-6 contain cell lysate, supernatant, and centrifuged pellet of mutant enzyme S75A; and lanes 7-9 contain cell lysate, supernatant, and centrifuged pellet of mutant enzyme L111M.

[0033] Figure 8 SDS-PAGE results of mutant enzymes L255I and V398I, where M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged pellet of pXXA BL21(DE3); lanes 4-6 contain cell lysate, supernatant, and centrifuged pellet of mutant enzyme L255I; and lanes 7-9 contain cell lysate, supernatant, and centrifuged pellet of mutant enzyme V398I.

[0034] Figure 9 SDS-PAGE results of mutant enzymes T488V and I523F: M: pre-stained protein molecular weight standard; lanes 1-3 contain cell lysate, supernatant, and centrifuged pellet of pXXA BL21 (DE3); lanes 4-6 contain cell lysate, supernatant, and centrifuged pellet of mutant enzyme T488V; lanes 7-9 contain cell lysate, supernatant, and centrifuged pellet of mutant enzyme I523F.

[0035] Figure 10 : Standard curve of β-couple.

[0036] Figure 11 Results of kinetic parameter determination of wild-type enzymes. Detailed Implementation

[0037] The present invention will be further described below with reference to embodiments. However, the scope of the present invention is not limited to the following embodiments. Those skilled in the art will understand that various changes and modifications can be made to the present invention without departing from the spirit and scope thereof.

[0038] Unless otherwise specified, the instruments, reagents, and materials used in the following embodiments are all conventional instruments, reagents, and materials already available in the prior art and can be obtained through legitimate commercial channels. Unless otherwise specified, the experimental methods and detection methods used in the following embodiments are all conventional experimental methods and detection methods already available in the prior art.

[0039] Example 1: Heterologous expression and purification of acetyllactate synthase

[0040] This study focused on the expression, purification, and kinetic characterization of the AHAS catalytic subunit encoded by the slr2088 gene in Synechocystis PCC6803, and simultaneously expressed and purified the regulatory subunit encoded by the sll0065 gene. The enzyme activity of the in vitro recombinant AHAS catalytic subunit-regulatory subunit system was measured. Through systematic genetic engineering and vector system optimization, an efficient protein expression and purification system was established.

[0041] The amino acid sequence of the catalytic subunit of acetolactate synthase derived from Synechocystis PCC6803 is shown below, as in SEQ ID NO.1:

[0042] .

[0043] The nucleotide sequence of the slr2088 gene encoding the catalytic subunit is shown below (direction 5'-3'), as indicated in SEQ ID NO. 2:

[0044]

[0045] The amino acid sequence of the regulatory subunit of acetolactate synthase from Syntrophus polymorpha PCC6803 is shown below, as in SEQ ID NO.3:

[0046] MEFYPNGHRRSPSLPPMKHTLSVLVEDEAGVLTRIAGLFARRGFNIESLAVGSAEQGDVSRITMVVPGDENTIEQLTKQLYKLVNVIKVQDITETPCVERELMLVKVSANAPNRAEVIELAQVFRARIVDISEDTVTIEVVGDPGKMVAILQMLAKFGIKEVARTGKIALVRESGVNTEYLKSLESKF.

[0047] The nucleotide sequence of the sll0065 gene encoding the regulatory subunit is shown below (direction 5'-3'), as indicated in SEQ ID NO. 4:

[0048] .

[0049] (I) Main Experimental Materials

[0050] The pET28a-slr2088 expression plasmid was synthesized by Genewiz. *E. coli* strains DH5α and BL21(DE3) were preserved in our laboratory. The pXXA plasmid was provided by the laboratory of Shi Ning at the Fujian Institute of Research on the Structure of Matter, Chinese Academy of Sciences. T4 DNA ligase, DNA marker, restriction endonucleases EcoRI, XhoI, and NdeI were all purchased from TransGen Biotech Ltd.

[0051] The nucleotide sequences of the specific primers used in this experiment are shown below (direction 5'-3'):

[0052] slr2088F:CTGTTCCAGGGGCCCGAATTCCATCATCATCATCATC, as shown in SEQ ID NO.5.

[0053] slr2088R: CACCAGGCCACTACTCTCGAGTCAGTGGTGGTG, as shown in SEQ ID NO.6.

[0054] sll0065F: CTGTTCCAGGGGCCCGAATTCCATCATCATCATCATC, as shown in SEQ ID NO.7.

[0055] sll0065R: CACCAGGCCACTACTCTCGAGTCAGTGGTGGTG, as shown in SEQ ID NO.8.

[0056] (II) Experimental Methods

[0057] (1) Inducible expression of slr2088 protein

[0058] Synthesized stab bacteria (containing pET28a-slr2088 plasmid) were inoculated into LB liquid medium containing kanamycin (50 μg / mL) and cultured overnight in a constant temperature shaking incubator at 37°C and 180 rpm. The target plasmid was extracted using a plasmid miniprep kit and transformed into *E. coli* BL21(DE3) competent cells using a heat shock method. The transformation product was evenly spread on the surface of LB solid medium containing kanamycin (50 μg / mL) and incubated upside down at 37°C for 12–16 h until single colonies formed. Single colonies were randomly selected for colony PCR amplification. The amplification products were analyzed by 1.2% agarose gel electrophoresis to screen for positive clones matching the expected fragment size of the slr2088 gene.

[0059] Verified positive clones were inoculated into 3 mL of LB liquid medium containing kanamycin (50 μg / mL) and cultured at 37°C with shaking at 180 rpm for 12 h until the logarithmic growth phase. The clones were then transferred to fresh LB liquid medium containing kanamycin (50 μg / mL) at a 1% (v / v) inoculation rate, and OD was monitored. 600 When the β-carboxylic acid level reached 0.6–0.8, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.05 mmol / L, and induction was performed at 16 °C and 180 rpm for 24 h. A pET28a empty vector-transformed strain was simultaneously used as a negative control, and cultured under the same conditions.

[0060] After induction, the bacterial cells were collected by centrifugation at 4°C and 6000 rpm for 10 min. The supernatant was discarded, and the cells were resuspended in pre-cooled Tris-HCl buffer (20 mM, pH=7.5). The cells were then centrifuged at 4°C and 8000 rpm for 15 min to remove any residual culture medium. The final bacterial pellet was resuspended in the same buffer at a ratio of 1:20 (m / v) on ice for subsequent lysis experiments.

[0061] Cells were disrupted using an ultrasonic cell disruptor (instrument operating parameters: amplitude bar 6mm, effective power 60%, ultrasonic operation on 3s, off 9s, total operating time 30min). 1ml of whole-cell lysis buffer was centrifuged at 12000rpm for 15min at 4℃ to obtain the supernatant and precipitate. These were then mixed separately with 4× protein loading buffer and heated in a metal bath at 99.5℃ for 10min to denature the protein. After cooling, the sample was shaken for 30s and loaded onto a 10% (v / v) protein gel. Finally, the induced expression of slr2088 protein was detected by SDS-PAGE.

[0062] (2) Construction and expression of pXXA-slr2088 recombinant plasmid

[0063] Using pET28a-slr2088 plasmid as a template, the slr2088 gene fragment was amplified by PCR using primers slr2088F and slr2088R. The PCR reaction system was as follows: 1 μL plasmid template, 25 μL 2×Pfu PCR MasterMix, 1 μL each of forward and reverse primers, 22 μL ddH2O, and a total volume of 50 μL. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 2 min, for 30 cycles; 72℃ extension for 10 min, and hold at 16℃.

[0064] After the PCR reaction, the amplified fragment was purified using a DNA purification kit. Simultaneously, the pXXA plasmid was digested with XhoI restriction enzyme. The recombinant pXXA-slr2088 plasmid was seamlessly cloned using DNA. The recombinant product was transformed into *E. coli* DH5α competent cells using a heat shock method. The cells were evenly spread on LB agar plates containing ampicillin (100 μg / mL) and incubated at 37°C for 12–14 h. The next day, single colonies were randomly selected for PCR verification. Positive single colonies of the same size as the target gene were selected by 1.2% agarose gel electrophoresis and inoculated into 20 mL of LB liquid medium containing ampicillin (100 μg / mL). The colonies were incubated at 37°C and 180 rpm for 12 h. The plasmid was extracted using a plasmid miniprep kit and subjected to bidirectional sequencing to verify the integrity of the inserted sequence and the correctness of the reading frame. After successful plasmid construction, it was transformed into *E. coli* BL21(DE3) competent cells.

[0065] The expression method is the same as described in (1) above. After adding IPTG, the protein was induced at low temperature for 12h and 24h respectively to investigate the protein expression at different induction times.

[0066] (3) Construction and expression of pXXA-sll0065 vector

[0067] Using pET28a-sll0065 plasmid as a template, the pXXA-sll0065 expression vector was constructed using seamless cloning technology, following the same procedure as described in (2) above. The expression method was the same as described in (1) above.

[0068] (4) Protein isolation and purification

[0069] The supernatant obtained after ultrasonic disruption was filtered through a 0.22 μm filter and loaded into pre-equilibrated Ni-NTA at a flow rate of 0.5–1 mL / min. The flow-through was collected for subsequent analysis. A gradient elution was performed using imidazole elution buffer (pH 7.5) from 20–200 mmol / L, and protein eluates at different imidazole concentrations were collected. Samples were taken from the protein eluates at different concentrations, and the purification status of the target protein was analyzed by SDS-PAGE.

[0070] Select an eluent containing the target protein at a high concentration and purity, place it in a dialysis bag, and concentrate the target protein at 4°C by absorbing water with polyethylene glycol (PEG-20000) to obtain a high concentration of protein. After concentration, wash off the polyethylene glycol on the surface of the dialysis bag with ice water, and remove imidazole from the protein by dialysis. The dialysis buffer contains 1 mmol / L DTT, 0.3 mol / L NaCl, and 20 mmol / L Tris-HCl pH=7.5 buffer. Dialyze three times, 2 hours each time, all in a chromatography cabinet at 4°C. Finally, collect the protein, and calculate the protein concentration using the absorbance of the SLR2088 protein at 280 nm [Ɛ = 63000 L / (mol·cm)], according to the Lambert-Beer Law: A = Ɛ·c·L (where A is the absorbance, Ɛ is the molar absorptivity, c is the concentration of the absorbing substance, and L is the thickness of the absorbing layer).

[0071] The isolation and purification steps for pXXA-slr2088 and pXXA-sll0065 proteins are the same as above.

[0072] (III) Experimental Results and Analysis

[0073] (1) Inducible expression of pET28a-slr2088 protein

[0074] The SDS-PAGE results of pET28a-slr2088 protein are as follows: Figure 1 As shown, the slr2088 protein has a size of 70.84 kDa. The bands in lanes 4-6 are the same size as the theoretical protein, and no expression was observed in the empty vector controls in lanes 1-3. Therefore, these were identified as the slr2088 protein bands. The supernatant in lane 5 contained a large amount of soluble target protein, which is beneficial for the subsequent direct separation and purification of the slr2088 protein.

[0075] (2) Induction of pXXA-slr2088 protein expression

[0076] The SDS-PAGE results of pXXA-slr2088 protein are as follows: Figure 2 As shown, the molecular weight of pET28a-slr2088 protein during expression is 70.84 kDa. The molecular weight of the XXA tag fused to the pXXA vector is 25 kDa. Therefore, theoretically, the molecular weight of pXXA-slr2088 protein is approximately 96 kDa, consistent with the protein size shown in the figure. Figure 2 It can be seen that most of the proteins expressed after pXXA-slr2088BL21(DE3) induction are soluble proteins, which is beneficial for subsequent protein separation and purification.

[0077] (3) Induction of pXXA-sll0065 protein expression

[0078] The SDS-PAGE results of pXXA-sll0065 protein are as follows: Figure 3 As shown, the molecular weight of pET28a-sll0065 protein is 17 kDa. The molecular weight of the tag XXA fused to the pXXA vector is 25 kDa. Therefore, theoretically, the molecular weight of pXXA-sll0065 protein is about 42 kDa, which is consistent with the protein size in the figure.

[0079] (4) Isolation and purification of pET28a-slr2088 protein

[0080] The SDS-PAGE results of pET28a-slr2088 protein eluent are as follows: Figure 4 As shown, purification yielded a large amount of eluent containing the target protein, with high protein purity and almost no impurities; in the subsequent collection of 200 mmol / L imidazole eluent, almost all soluble proteins precipitated, and no high concentration of protein was obtained.

[0081] (5) Isolation and purification of pXXA-slr2088 protein

[0082] After 24 h of pXXA-slr2088 BL21(DE3) induction expression, bacterial cells were collected, and the protein was separated and purified by Ni-NTA affinity chromatography. The elution buffer (20–200 mmol / L imidazole) was collected. SDS-PAGE results of the pXXA-slr2088 protein elution buffer are shown below. Figure 5 As shown, the target protein was eluted with 200 mmol / L imidazole elution buffer, and there were almost no other proteins. The 200 mmol / L imidazole elution buffer was collected and concentrated by dialysis. Although some precipitation occurred during the process, a protein concentration of 40 μmol / L was still obtained for subsequent analysis.

[0083] (iv) Conclusion

[0084] During the purification of the slr2088 protein, protein aggregation and precipitation occurred, making it impossible to obtain protein with high purity and concentration, thus hindering the normal progress of the experiment. Literature review revealed that natural AHAs have low abundance and poor stability. Subsequently, homologous recombination cloning technology was used to successfully construct the pXXA-slr2088 plasmid. The protein induced by pXXA-slr2088 BL21(DE3) and purified showed relatively good stability; although some protein precipitation still occurred, a final concentration of 40 μmol / L of the target protein was obtained for subsequent enzyme activity assays.

[0085] Example 2: Rational Design of Acetolactate Synthase

[0086] As a key rate-limiting enzyme in the branched-chain amino acid synthesis pathway, the soluble expression and stability of acetyllactate synthase are core prerequisites for studying its catalytic mechanism and industrial applications. The experimental results in Example 1 showed that although the pXXA-slr2088 protein did not completely aggregate and precipitate during the separation and purification process, yielding a certain concentration of protein, the protein recovery rate was limited by partial irreversible aggregation. To address this bottleneck, this experiment aimed to systematically improve the conformational stability and catalytic efficiency of acetyllactate synthase through rational computational protein design without damaging the enzyme's active site. This study integrated multi-dimensional biological information, primarily utilizing the protein stability design website FireProt and the one-stop protein repair website PROSS to generate single mutation sites and screen for mutations that could potentially improve the conformational stability and catalytic efficiency of acetyllactate synthase.

[0087] First, the amino acid sequence of the catalytic subunit of acetyllactate synthase (i.e., the slr2088 protein) was input into the online protein structure simulation tool AlphaFold2, and the tertiary structure of the protein was directly predicted through calculation. The tertiary structure of the slr2088 protein is as follows: Figure 6 As shown.

[0088] Then, using the molecular docking software AutoDockTools, acetyllactate synthase was docked with the substrate pyruvate and cofactors TPP and FAD, respectively, resulting in fifty docking complexes with different binding energies and binding positions. Based on the known positions and conformations of the substrate and cofactors in their crystal structures, the complex with the lowest binding energy and similar substrate and cofactor positions was selected for analysis. The docking results were visualized using the structural visualization software PyMOL.

[0089] Subsequently, the stability optimization design of acetyllactone synthase was carried out using a dual platform of PROSS and FireProt. PROSS, based on multiple sequence alignment and structure-energy calculations, screened 71 potential stability-enhancing sites; FireProt, through integrated evolutionary conservation analysis and molecular dynamics simulations, predicted 39 candidate mutation sites. To reduce the impact of algorithmic bias on experimental validation, the intersection sites of the two prediction systems were preferentially selected as modification targets. This strategy significantly improved the positive screening efficiency of mutants. In the candidate site screening, key functional residues (such as Met498 and His417) of the substrate-binding domain and cofactor TPP binding pocket were identified through molecular docking simulations, and these sites, which play a decisive role in catalytic activity, were included in the mutation exclusion list to ensure that the enzyme's native active site was not destroyed during stability modification. After multi-dimensional screening and cross-validation, six mutant combinations with synergistic stabilizing effects—S75A, L111M, L255I, V398I, T488V, and I523F—were finally identified, providing theoretical guidance for subsequent enzyme engineering.

[0090] Example 3 Construction and Induced Expression of Mutant Enzyme

[0091] In this experiment, the recombinant plasmid pXXA-slr2088 constructed in Example 1 was used as a molecular template. Whole-plasmid PCR-mediated site-directed mutagenesis was employed to construct recombinant expression vectors for the six single-point mutants screened in Example 2. The mutant plasmids were introduced into *E. coli* BL21(DE3) expression strain via heat shock transformation. After IPTG induction, the mutant proteins were purified using nickel column affinity chromatography. The activities of wild-type and mutant proteins were determined using visible spectrophotometry (detection wavelength 520 nm).

[0092] (I) Experimental Methods

[0093] (1) Construction of mutants

[0094] Using pXXA-slr2088 plasmid as a template, the nucleotide sequences of the specific primers for each mutation site were obtained by one-step PCR amplification. The specific primers for the six mutation sites are shown below (direction 5'-3'):

[0095] S75A-F: CATGAACAAGGCGCGGCTCATGCGGCGG, as shown in SEQ ID NO.9;

[0096] S75A-R: AGCCGCGCCTTGTTCATGGCGCACCAGAA, as shown in SEQ ID NO.10;

[0097] L111M-F: ATTGCGAACGCGCACATGGATAGCGTGC, as shown in SEQ ID NO.11;

[0098] L111M-R: CATGTGCGCGTTCGCAATGCCGGTCACC, as shown in SEQ ID NO.12;

[0099] L255I-F: GCGGAACGCTTTCAGATCCCGGTGACCA, as shown in SEQ ID NO.13;

[0100] L255I-R: GATCTGAAAGCGTTCCGCAAATTCTTGC, as shown in SEQ ID NO.14;

[0101] V398I-F: GCGCCGCAAGAAGTGATTCATGAAATTG, as shown in SEQ ID NO.15;

[0102] V398I-R: AATCACTTCTTGCGGCGCAATGGTATCT, as shown in SEQ ID NO.16;

[0103] T488V-F: GATATTCAAGTGAAAGTTATTATTCTGA, as shown in SEQ ID NO.17;

[0104] T488V-R: AACTTTCACTTGAATATCATACTGCGCC, as shown in SEQ ID NO.18;

[0105] I523F-F: CATGCCGGATTTCAACCTGCTGTGCGAA, as shown in SEQ ID NO.19;

[0106] I523F-R: GAAATCCGGCATGCCTTGGCTCATGTTG, as shown in SEQ ID NO.20.

[0107] The PCR reaction system consisted of: 1 μL plasmid template, 25 μL 2×Pfu PCR MasterMix, 1 μL each of forward and reverse primers, 22 μL ddH2O, and a total volume of 50 μL. The PCR reaction conditions were: 95℃ pre-denaturation for 5 min; 95℃ denaturation for 30 s, 55℃ annealing for 30 s, 72℃ extension for 5 min, for 30 cycles; 72℃ extension for 10 min, and hold at 16℃.

[0108] After amplification, 1 μL of DMT was added to the PCR reaction solution, mixed well, and incubated at 37°C for 1 hour. The non-mutant plasmid template was degraded in vitro by the DMT enzyme. Then, 2–5 μL of the DMT digestion product was transformed into *E. coli* DH5α competent cells. In this step, DMT continued to degrade the non-mutant plasmid template in the competent cells. After transformation, the bacterial culture was plated on LB agar plates containing ampicillin (100 μg / mL) and incubated overnight at 37°C. The next day, single colonies were picked from the plates for colony PCR verification. The mutant plasmid with the correct band size was sent to the company for sequencing. The sequencing results were compared with the wild-type plasmid map on SnapGene software to ensure successful mutation. The successfully mutated plasmid was transformed into *E. coli* BL21(DE3), and the strain was promptly preserved with glycerol for subsequent fermentation and purification.

[0109] (2) Expression, isolation and purification of mutant enzymes

[0110] Six successfully constructed mutant plasmids were introduced into *E. coli* BL21(DE3). The induction expression method was the same as in Example 1, except that the antibiotic was replaced with ampicillin (100 μg / mL). Protein isolation and purification were performed as in Example 1, using Ni-NTA affinity chromatography to purify the protein. The expression and purification of the mutant protein were detected by SDS-PAGE electrophoresis. The protein was collected, concentrated, and dialyzed using a dialysis bag to improve protein concentration and purity.

[0111] (3) Determination of enzyme activity

[0112] Acetonitrile standard curve plotting: Prepare a 1 mmol / L stock solution of acetoin. Take 10, 20, 50, 100, 200, and 500 μL of each solution, respectively, and add water to make up to 600 μL. Add 200 μL of 0.5% creatine solution and 200 μL of 5% α-naphthol solution (prepared fresh and dissolved in 2.5 M NaOH solution). Incubate at room temperature for 1 h, and measure the OD value at 520 nm using a visible spectrophotometer. Plot the standard curve using GraphPad Prism 9, with acetoin concentration on the x-axis and OD value on the y-axis. 520 The vertical axis is denoted by . Using the standard curve, the molar extinction coefficient of acetoin at a wavelength of 520 nm can be calculated, and the reaction rate of acetyllactone synthase can be further calculated.

[0113] Kinetic characterization of wild-type and mutant enzymes: A stepwise method was used to determine the activity of acetolactate synthase using pyruvate as a substrate. The specific steps were as follows: First, a 200 μL reaction mixture was prepared, containing 100 mmol / L phosphate buffer (pH=7.0), 2 mmol / L TPP, 20 μmol / L FAD, 10 mmol / L magnesium ions, and pyruvate at a gradient concentration of 2–20 mmol / L. Finally, pXXA-slr2088 protein was added to initiate the reaction. After the reaction was completed, the mixture was immediately incubated in a 37°C water bath for 30 min. Then, 20 μL of sulfuric acid solution was added and the reaction was carried out at 60 °C for 15 min to terminate the first step reaction and to decarboxylate the generated 2-acetyllactic acid upon heating to convert it to acetoin. Next, 200 μL of 0.5% creatine solution was added, and the reaction was continued at the same temperature for 15 min. Finally, 200 μL of freshly prepared 5% α-naphthol alkaline solution was added, and the reaction was continued at the same temperature for 15 min. Creatine and α-naphthol reacted with acetoin to form a red complex via a colorimetric reaction. After the reaction, the mixture was centrifuged at 5000 rpm for 2 min, and the absorbance was measured at 520 nm using a microplate reader. Furthermore, under the same reaction conditions, a reaction system without pXXA-slr2088 protein was used as a blank control, and the experiment was repeated three times. The activity assays for each mutant enzyme were performed using the same methods. Enzyme activity data were calculated using GraphPad Prism and nonlinear fitting via the Michaelis-Menten equation to calculate enzyme kinetic parameters.

[0114] (II) Experimental Results and Analysis

[0115] (1) Expression, isolation and purification of mutant enzymes

[0116] Bacterial cells expressing six mutant enzymes, S75A, L111M, L255I, V398I, T488V, and I523F, were collected, sonicated, and then subjected to SDS-PAGE analysis. The SDS-PAGE results for mutant enzymes S75A and L111M are shown below. Figure 7 As shown, the SDS-PAGE detection results of mutant enzymes L255I and V398I are as follows: Figure 8 As shown, the SDS-PAGE detection results of mutant enzymes T488V and I523F are as follows: Figure 9 As shown, the target protein is around 96 kDa. It can be seen that the expression levels of the mutant enzymes are all high, and most of the protein is in the supernatant, indicating it is a soluble protein, providing favorable conditions for subsequent purification. During the collection, concentration, and dialysis of the protein, it remained stable and soluble without aggregation or precipitation, demonstrating that the protein stability mutation improves its anti-aggregation ability and proving the possibility of rational protein design.

[0117] (2) Results of enzyme activity assays for wild-type and mutant enzymes

[0118] (a) Plotting the standard curve for a B-type marriage

[0119] The standard curve of β-chromia is as follows Figure 10 As shown, the standard curve exhibits good linear correlation (R²=0.9991) through linear regression analysis, which is significantly higher than the threshold required for quantitative analysis (R²≥0.995), effectively supporting the subsequent quantitative analysis of acetoin in the acetolactate synthase activity reaction system.

[0120] (b) Kinetic characterization of wild-type enzymes

[0121] The catalytic properties of acetyllactate synthase encoded by slr2088 were revealed through kinetic analysis. The kinetic parameters of the wild-type enzyme were measured as follows: Figure 11 As shown. The Michaelis constant of the slr2088 protein for the substrate pyruvate was experimentally determined. K m The concentration was 2.77 ± 0.50 mmol / L, and the maximum initial reaction rate V was... max The concentration of slr2088 protein in the reaction system was 2.71 ± 0.16 μmol / (L·s), and the concentration of slr2088 protein in the reaction system was 2 μmol / L. Therefore, the catalytic constant k was calculated. cat It is 1.36s -1 Compared with acetyllactate synthase activities from other sources, the K activity of the slr2088 protein... cat Higher than AHAS (k) of brewer's yeast cat It is 0.55s -1 ) and Escherichia coli AHAS II (k cat It is 0.04 ± 0.02 s -1 ).

[0122] (c) Kinetic characterization of mutant enzymes

[0123] The kinetic parameters of the wild-type enzyme and the mutant enzyme are compared in Table 1.

[0124] Table 1 Comparison of kinetic parameters between wild-type and mutant enzymes

[0125]

[0126] The catalytic efficiencies of mutant enzymes S75A, L111M, and I523F decreased to 81%, 56%, and 70% of those of the wild-type enzymes, respectively; while the catalytic efficiencies of mutant enzymes L255I, V398I, and T488V increased to 120%, 130%, and 110% of those of the wild-type enzymes, respectively. Based on these results and molecular docking, we speculate on the possible mechanisms affecting protein catalytic efficiency.

[0127] Although the experimental mutation site design incorporates molecular docking to exclude amino acid residues that directly interact with substrates and cofactors, mutations at the above six sites may disrupt existing interactions with neighboring amino acids or create new interactions, affecting the dynamic opening and closing of the active pocket for protein-substrate binding, hindering the entry of pyruvate substrate, and thus leading to reduced substrate catalytic efficiency of the mutant protein. For example, the mutant enzyme S75A... K m Compared to the wild-type enzyme, the catalytic rate is improved. For the mutant enzyme L111M, leucine is a common residue in the hydrophobic core, and its branched structure facilitates tight packing. The linear side chain of methionine after mutation may disrupt the original hydrophobic interactions, leading to a looser local structure or steric hindrance, resulting in a reduced catalytic rate. For the mutant enzyme I523F, although... K m The substrate affinity is lower than that of the wild-type enzyme, possibly due to the steric hindrance of the benzene ring formed by the mutated phenylalanine, which restricts protein conformational changes during catalysis and reduces the catalytic rate. For mutant enzymes with higher catalytic efficiency than the wild-type enzyme, the change in amino acid side chain after mutation may be due to the alteration of catalytic efficiency. For example, in mutant enzyme L255I, the mutation shortens the side chain, which may lower the energy barrier of the catalytic transition state and thus increase the catalytic rate. In mutant enzyme V398I, the leucine side chain introduces a methylene group, which may form a hydrophobic complementary interface with the methyl group of pyruvate, enhancing stability and increasing the catalytic rate. In mutant enzyme T488V, the polar interference of the hydroxyl group is eliminated, improving protein structural stability and thus increasing catalytic efficiency.

[0128] (III) Conclusion

[0129] This experiment validated six predicted mutation points based on rational design. Using pXXA plasmid as the expression vector, six mutant plasmids (S75A, L111M, L255I, V398I, T488V, and I523F) were successfully constructed. The expression levels of the mutant enzymes and soluble proteins were good. The six mutant proteins were isolated and purified. During protein concentration and collection, the proteins remained in a stable and homogeneous liquid state without aggregation or precipitation, verifying the feasibility of rationally designed proteins to enhance stability. Subsequently, the activities of the wild-type enzyme and each mutant enzyme were determined by visible spectrophotometry using an acetoin colorimetric reaction. The results showed that the Michaelis constant of the slr2088 protein for the substrate pyruvate... K m The concentration was 2.77 ± 0.50 mmol / L, and the maximum initial reaction rate V was... max The catalytic constant k is 2.71 ± 0.16 μmol / (L·s). cat It is 1.36s -1 .

[0130] The catalytic performance of six mutant enzymes was analyzed. The catalytic efficiencies of mutant enzymes S75A, L111M, and I523F were reduced to 81%, 56%, and 70% of the wild-type enzymes, respectively, while the catalytic efficiencies of mutant enzymes L255I, V398I, and T488V were increased to 120%, 130%, and 110% of the wild-type enzymes, respectively. It is speculated that the amino acid mutations at the six sites may disrupt existing interactions with neighboring amino acids or generate new interactions, thereby altering the catalytic rate.

[0131] The catalytic efficiency of mutant enzymes L255I, V398I, and T488V is significantly improved. In this invention, they are formally named as follows: acetolactate synthase-PCC6803-L255I, acetolactate synthase-PCC6803-V398I, and acetolactate synthase-PCC6803-T488V.

[0132] The amino acid sequence of the catalytic subunit of acetyllactate synthase-PCC6803-L255I is shown below, as in SEQ ID NO. 21:

[0133] .

[0134] The gene encoding the catalytic subunit of the acetyllactate synthase-PCC6803-L255I, compared with the gene encoding the catalytic subunit of the wild-type enzyme shown in SEQ ID NO.2, has a mutation from TTG to ATC in the codon corresponding to amino acid position 255 (i.e., nucleotides at positions 763, 764, and 765); its nucleotide sequence is shown below (direction 5'-3'), as shown in SEQ ID NO.22:

[0135]

[0136] The amino acid sequence of the catalytic subunit of acetyllactate synthase-PCC6803-V398I is shown below, as in SEQ ID NO. 23:

[0137] .

[0138] The gene encoding the catalytic subunit of acetolactate synthase-PCC6803-V398I, compared with the gene encoding the catalytic subunit of the wild-type enzyme shown in SEQ ID NO.2, shows that the codon corresponding to amino acid 398 (i.e., nucleotides at positions 1192, 1193, and 1194) is mutated from GTA to ATT; its nucleotide sequence is shown below (direction 5'-3'), as shown in SEQ ID NO.24:

[0139]

[0140] The amino acid sequence of the catalytic subunit of acetyllactate synthase-PCC6803-T488V is shown below, as in SEQ ID NO. 25:

[0141] .

[0142] The gene encoding the catalytic subunit of acetolactate synthase-PCC6803-T488V, compared with the gene encoding the catalytic subunit of the wild-type enzyme shown in SEQ ID NO.2, shows that the codon corresponding to amino acid 488 (i.e., nucleotides at positions 1462, 1463, and 1464) is mutated from ACT to GTT; its nucleotide sequence is shown below (direction 5'-3'), as shown in SEQ ID NO.26:

[0143]

[0144] The above embodiments are provided to those skilled in the art to fully disclose and describe how the claimed implementations can be carried out and used, and are not intended to limit the scope of the disclosure herein. Modifications that will be obvious to those skilled in the art will be within the scope of the appended claims.

Claims

1. An acetolactate synthase mutant, characterized in that: The enzyme is acetyllactone synthase-PCC6803-L255I, acetyllactone synthase-PCC6803-V398I, or acetyllactone synthase-PCC6803-T488V. The acetolactate synthase-PCC6803-L255I is composed of a catalytic subunit and a regulatory subunit. The amino acid sequence of the catalytic subunit is shown in SEQ ID NO.21, and the amino acid sequence of the regulatory subunit is shown in SEQ ID NO.

3. The acetolactate synthase-PCC6803-V398I is composed of a catalytic subunit and a regulatory subunit. The amino acid sequence of the catalytic subunit is shown in SEQ ID NO.23, and the amino acid sequence of the regulatory subunit is shown in SEQ ID NO.

3. The acetolactate synthase-PCC6803-T488V is composed of a catalytic subunit and a regulatory subunit. The amino acid sequence of the catalytic subunit is shown in SEQ ID NO.25, and the amino acid sequence of the regulatory subunit is shown in SEQ ID NO.

3.

2. The acetolactate synthase mutant according to claim 1, characterized in that: The nucleotide sequence of the gene encoding the catalytic subunit of the acetolactate synthase-PCC6803-L255I is shown in SEQ ID NO.22, and the nucleotide sequence of the gene encoding the regulatory subunit is shown in SEQ ID NO.

4. The nucleotide sequence of the gene encoding the catalytic subunit of the acetolactate synthase-PCC6803-V398I is shown in SEQ ID NO. 24, and the nucleotide sequence of the gene encoding the regulatory subunit is shown in SEQ ID NO.

4. The nucleotide sequence of the gene encoding the catalytic subunit of the acetolactate synthase-PCC6803-T488V is shown in SEQ ID NO. 26, and the nucleotide sequence of the gene encoding the regulatory subunit is shown in SEQ ID NO.

4.

3. The application of the acetolactate synthase mutant according to claim 1 in the catalytic preparation of acetolactate.

Images