Use of an exosome overexpressing CAP gene and LGR5 gene in preparation of a drug for treating cartilage inflammation

By using mesenchymal stem cell exosomes that overexpress the CAP and LGR5 genes, the problems of low targeting and utilization rate of MSCs exosomes in the treatment of cartilage inflammation in existing technologies have been solved, achieving stronger cartilage targeting and therapeutic effect, promoting cartilage regeneration and reducing cartilage degradation.

CN120899659BActive Publication Date: 2026-06-09THE THIRD HOSPITAL OF HEBEI MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511094912.4
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-06
Publication Date
2026-06-09
Estimated Expiration
2045-08-06

Smart Images

  • Figure CN120899659B_ABST
    Figure CN120899659B_ABST
Patent Text Reader

Abstract

The application relates to the field of biomedical technology, and particularly discloses application of an exosome overexpressing CAP and LGR5 genes in preparation of a drug for treating cartilage inflammation. The exosome overexpressing the CAP and LGR5 genes has both targeting property and cartilage protection function, the exosome can be more phagocytosed by cartilage cells, is targeted to the cartilage cells, can improve the levels of a cartilage generation gene Col2a1 and a cartilage development regulating gene Sox9, can reduce the level of a cartilage degradation gene Mmp13, can relieve cartilage abrasion of osteoarthritis mice, and can protect knee joints, so that the exosome can promote cartilage generation, relieve cartilage aging and reduce cartilage degradation under a complex inflammation environment. Further, the application provides a mesenchymal stem cell exosome overexpressing CAP / LGR5, provides a new technical scheme for targeted treatment based on stem cell engineering, and has a wide application prospect.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and specifically discloses the application of exosomes overexpressing the CAP gene and LGR5 gene in the preparation of drugs for treating cartilage inflammation. Background Technology

[0002] Currently, conventional treatments for cartilage inflammation (such as arthritis) mainly include drug therapy and surgical treatment. Drugs include nonsteroidal anti-inflammatory drugs (NSAIDs) and glucocorticoids. However, these conventional treatments generally have drawbacks such as significant side effects, severe adverse reactions, high costs, or the need for further improvement in effectiveness.

[0003] In recent years, mesenchymal stem cells (MSCs) and their secreted exosomes have gradually become a research hotspot for cartilage repair and inflammation treatment. However, the current use of MSCs exosomes in the treatment of cartilage inflammation generally has the following shortcomings: (1) the effects of exosomes on anti-inflammation and promoting cartilage repair are limited and cannot meet the needs of complex inflammatory environments; (2) the utilization rate of exosomes is low, the function and production of exosomes are limited, and the targeting after intra-articular injection is poor, making it difficult to meet the needs of clinical application. Summary of the Invention

[0004] To address the shortcomings of existing technologies, this invention provides an application of exosomes overexpressing the CAP and LGR5 genes in the preparation of drugs for treating cartilage inflammation. The exosomes overexpressing the CAP and LGR5 genes provided by this invention balance cartilage targeting and functionality, allowing for better binding to chondrocytes, improved exosome utilization, and the promotion of cartilage formation, mitigation of cartilage aging, and reduction of cartilage degradation under complex inflammatory conditions.

[0005] To achieve the above-mentioned objectives, the present invention adopts the following technical solution:

[0006] In a first aspect, the present invention provides the application of exosomes overexpressing the CAP gene and the LGR5 gene in the preparation of drugs for treating cartilage inflammation.

[0007] The exosomes overexpressing the CAP and LGR5 genes provided by this invention have both targeting and cartilage inflammation treatment functions. Specifically, these exosomes can not only be more phagocytosed by chondrocytes and target chondrocytes, but also have the ability to increase the levels of the cartilage-forming gene Col2a1 and the cartilage-regulating gene Sox9, and decrease the level of the cartilage-degrading gene Mmp13. Therefore, they can promote cartilage formation, alleviate cartilage aging and reduce cartilage degradation in complex inflammatory environments.

[0008] Preferably, the nucleotide sequence of the CAP gene is shown in SEQ ID No. 1.

[0009] In this invention, CAP, as a targeting peptide, has cartilage-targeting activity. Cell experiments showed that exosomes overexpressing the CAP and LGR5 genes exhibited more green fluorescence than those without overexpression of the CAP gene, indicating that exosomes overexpressing the CAP and LGR5 genes were more readily phagocytosed by chondrocytes, demonstrating stronger targeting.

[0010] For example, LAMP2B is highly expressed on the surface of exosomes. In this invention, the gene sequence of CAP is added to the end of the LAMP2B gene to construct the LAMP2B-CAP overexpression plasmid.

[0011] Preferably, the cartilage inflammation includes at least one of osteoarthritis, osteochondritis dissecans, tibial tuberosity osteochondritis, patellar chondromalacia, or secondary cartilage inflammation.

[0012] Secondly, the present invention provides a mesenchymal stem cell exocrine body overexpressing CAP / LGR5, which is an exosome of human umbilical cord-derived mesenchymal stem cells (UCMSCs) overexpressing the CAP gene and the LGR5 gene.

[0013] UCMSCs possess multi-lineage differentiation capacity, low immunogenicity, and paracrine functions. They can regulate the local microenvironment through exosome secretion, promoting tissue repair and anti-inflammatory effects. Therefore, this invention uses exosomes of human umbilical cord-derived mesenchymal stem cells as vectors to overexpress the CAP and LGR5 genes.

[0014] Thirdly, the present invention provides a method for preparing mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5, the method comprising the following steps: linking the gene encoding the target peptide CAP with the gene encoding the LGR5 protein, transfecting the gene into human umbilical cord-derived mesenchymal stem cells, culturing, separating the solid and liquid phases to obtain a precipitate, resuspending the precipitate and filtering it to obtain mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5.

[0015] Preferably, the coding gene for the target peptide CAP is linked to the coding gene for the LGR5 protein using a 2A peptide linker. The coding gene for the 2A peptide is shown in SEQ ID No. 3.

[0016] Preferably, the method for preparing mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5 specifically includes the following steps: constructing an LGR5-LAMP2B-CAP overexpression plasmid, transfecting it into human umbilical cord-derived mesenchymal stem cells, culturing for 48-60 hours, centrifuging to obtain the supernatant, then differentially centrifuging to obtain the precipitate, resuspending, filtering, and obtaining mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5.

[0017] For example, the differential centrifugation conditions are: 4℃ 300g centrifugation for 10 minutes → 4℃ 3000g centrifugation for 10 minutes → 4℃ 10000g centrifugation for 30 minutes → 4℃ 100000g centrifugation for 70 minutes, to obtain precipitate;

[0018] For example, the precipitate was resuspended in PBS buffer and then passed through a 0.22 μm-0.3 μm filter to obtain mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5.

[0019] Preferably, the method for constructing the LGR5-LAMP2B-CAP overexpression plasmid includes the following steps: synthesizing an LGR5-LAMP2B-CAP gene containing the LGR5 gene, LAMP2B gene and CAP gene, inserting it into the GV658 plasmid to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

[0020] Preferably, the nucleotide sequence of the LGR5-LAMP2B-CAP gene is shown in SEQ ID No. 2.

[0021] More preferably, the method for constructing the LGR5-LAMP2B-CAP overexpression plasmid specifically includes the following steps:

[0022] The LGR5-LAMP2B-CAP gene and GV658 plasmid were digested with KpnI / PacI, homologous recombination was performed, and then PCR amplification was performed to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

[0023] This invention achieves co-expression of two functional proteins by linking the encoding genes of the targeting peptide CAP and the functional protein LGR5 and co-transfecting them into human umbilical cord-derived mesenchymal stem cells (MSCs). This results in CAP / LGR5-overexpressing MSC exosomes, which possess both targeting and therapeutic functions. Existing research indicates that the LGR5 gene is highly expressed during biological development. In this invention, UCMSCs transfected with the LGR5-LAMP2B-CAP overexpression plasmid exhibit LGR5 gene overexpression, altering the cell's genetic makeup and thus influencing its phenotype. This makes the UCMSCs more stem cell-like, and the secreted exosomes have stronger targeting capabilities, leading to better therapeutic effects on osteoarthritis and other conditions.

[0024] This invention provides a mesenchymal stem cell exocrine body overexpressing CAP / LGR5 that synergistically enhances both targeting and therapeutic function. This exosome construction strategy overcomes the technical bottleneck of limited therapeutic effects of single-target peptide exosomes in existing technologies. Hydrogel microspheres prepared using this exosome can effectively alleviate cartilage wear in mice with osteoarthritis and protect the knee joint. This invention provides a new technical solution for stem cell-engineered targeted therapy and has broad application prospects. Attached Figure Description

[0025] To more clearly illustrate the technical solutions in the embodiments of the present invention, the accompanying drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0026] Figure 1 This is a plasmid map of the LAMP2B-CAP overexpression plasmid in Example 1 of the present invention;

[0027] Figure 2 This is a plasmid map of the LGR5-LAMP2B-CAP overexpression plasmid in Example 1 of this invention;

[0028] Figure 3 This is a plasmid map of the GV658 plasmid in Example 1 of the present invention;

[0029] Figure 4 These are transmission electron micrographs of control exosomes, target peptide exosomes, and exosomes overexpressing LGR5 target peptide in Example 1 of this invention.

[0030] Figure 5 This is a particle size distribution diagram of the three types of exosomes in Example 1 of the present invention;

[0031] Figure 6 The expression of three genes, TSG101, CD9, and CD81, in three exosomal tissues was detected by Western blotting in Example 1 of this invention.

[0032] Figure 7 The relative expression of Col2a1, Sox9, and Mmp13 genes in different groups in Example 2 of this invention;

[0033] Figure 8 The images show fluorescence images of control exosomes and chondrocytes transfected with exosomes overexpressing LGR5 targeting peptide in Example 2 of this invention.

[0034] Figure 9 This is an analysis of the fluorescence statistics of chondrocytes transfected with control exosomes and exosomes overexpressing LGR5 targeting peptide in Example 2 of the present invention;

[0035] Figure 10 This is a cellular fluorescence image used in Example 2 of the present invention to determine the expression of LGR5 in human umbilical cord mesenchymal stem cells and human umbilical cord mesenchymal stem cells transfected with LGR5-LAMP2B-CAP overexpression plasmid.

[0036] Figure 11 This is a statistical chart showing the relative expression levels of LGR5 in human umbilical cord mesenchymal stem cells and human umbilical cord mesenchymal stem cells transfected with the LGR5-LAMP2B-CAP overexpression plasmid in Example 2 of the present invention.

[0037] Figure 12 This is a bright-field micrograph of hydrogel microspheres containing exosomes overexpressing the LGR5 targeting peptide in Example 3 of the present invention;

[0038] Figure 13 Safranin-Fix-Green stained images of sagittal paraffin sections of knee joint cartilage from different groups of mice in Example 3 of this invention;

[0039] Figure 14 This is a statistical chart of the OARSI scores of the knee joints of mice in different groups in Example 3 of the present invention. Detailed Implementation

[0040] To make the objectives, technical solutions, and advantages of this invention clearer, the invention will be further described in detail below with reference to embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the invention.

[0041] Unless otherwise stated, the experimental methods, detection methods and preparation methods disclosed in this invention all adopt conventional techniques in this technical field.

[0042] To better illustrate the embodiments provided by the present invention, further examples are given below.

[0043] In this invention, the primary human umbilical cord-derived mesenchymal stem cells were purchased from OriCell, catalog number HUXUC-01001.

[0044] Example 1

[0045] This invention provides a method for preparing exosomes from mesenchymal stem cells overexpressing CAP / LGR5, and characterizes the properties of the obtained exosomes. Specifically:

[0046] I. This invention provides a method for preparing exocrine bodies of mesenchymal stem cells overexpressing CAP / LGR5, the preparation method specifically including the following steps:

[0047] Shanghai Jikai Gene Medical Technology Co., Ltd. was commissioned to construct LAMP2B-CAP overexpression plasmid and LGR5-LAMP2B-CAP overexpression plasmid. Details are as follows:

[0048] (1) Construction of LAMP2B-CAP overexpression plasmid

[0049] Based on the NCBI query for the human LAMP2B and CAP genes, the LAMP2B-CAP gene was designed by splicing together, with restriction enzyme sites introduced at both ends of the gene, and the whole gene was synthesized. After confirming the correct target fragment was sequenced, primers were used for amplification, and the amplification product was purified and recovered using gel electrophoresis to obtain the LAMP2B-CAP gene. The primer sequences and amplification conditions for PCR are shown in Table 1-2. The nucleotide sequence of the CAP gene is shown in SEQ ID No. 1, and the nucleotide sequence of the LAMP2B-CAP gene is shown in SEQ ID No. 4.

[0050] After double digestion of the GV658 plasmid with KpnI / PacI, the purified vector fragment was combined with the amplified and purified fragment from the previous step using a homologous recombination kit to prepare the following reaction system in an ice-water bath. The mixture was gently pipetted and briefly centrifuged to avoid air bubbles. The reaction was incubated at 37°C for 30 min, then cooled in an ice-water bath for 5 min before immediate transformation. The resulting LAMP2B-CAP recombinant plasmid was obtained. The reaction system is shown in Table 3.

[0051] Table 1

[0052]

[0053] Table 2

[0054]

[0055] Table 3

[0056]

[0057] Add 10 µL of the LAMP2B-CAP recombinant plasmid to 100 µL of competent E. coli, gently tap the tube wall several times to mix, and incubate on ice for 30 min. Heat shock at 42℃ for 90 s, followed by incubation in an ice-water bath for 2 min. Add 500 µL of antibiotic-free LB medium and incubate at 37℃ with shaking for 1 h. Spread an appropriate amount of bacterial culture evenly onto a plate containing the appropriate antibiotic and incubate upside down in a constant temperature incubator for 12-16 h. After colony screening, identify the target gene product. The primer sequences and amplification conditions for gene identification are shown in Tables 4-5 below.

[0058] Table 4

[0059]

[0060] Table 5

[0061]

[0062] Sequencing results analysis showed that if the sequence matched the expectations, it was the correct recombinant plasmid, denoted as LAMP2B-CAP overexpression plasmid. The plasmid map of LAMP2B-CAP overexpression plasmid is shown below. Figure 1 As shown, the plasmid map of GV658 is as follows. Figure 3 As shown.

[0063] (2) Construction of LGR5-LAMP2B-CAP overexpression plasmid

[0064] Based on the NCBI lookup of the LGR5 gene (accession number NM_003667.4), the LGR5-LAMP2B-CAP gene was designed and assembled. NM_003667.4 was ligated to the end of the LAMP2B-CAP gene sequence using a 2A peptide. Restriction sites were introduced at both ends of the gene, and the entire gene was synthesized. After confirming the correct sequencing fragment, primers were used for amplification. The PCR primer sequences are shown in Table 6, and the amplification conditions are shown in Table 2. The amplification product was purified and recovered using gel electrophoresis to obtain the LGR5-LAMP2B-CAP gene. The nucleotide sequence of the LGR5-LAMP2B-CAP gene is shown in SEQ ID No. 2, and the encoding gene for the 2A peptide is shown in SEQ ID No. 3.

[0065] After double digestion of the GV658 plasmid with KpnI / PacI, the purified vector fragment was combined with the amplified and purified fragment from the previous step using a homologous recombination kit to prepare the following reaction system in an ice-water bath. The mixture was gently pipetted and briefly centrifuged to avoid air bubbles. The reaction was incubated at 37°C for 30 min, then cooled in an ice-water bath for 5 min before immediate transformation. The resulting recombinant plasmid was LGR5-LAMP2B-CAP. The reaction system is shown in Table 3.

[0066] Table 6

[0067]

[0068] Add 10 µL of the LGR5-LAMP2B-CAP recombinant plasmid to 100 µL of competent E. coli, gently tap the tube wall several times to mix, and incubate on ice for 30 min. Heat shock at 42℃ for 90 s, followed by incubation in an ice-water bath for 2 min. Add 500 µL of antibiotic-free LB medium and incubate at 37℃ with shaking for 1 h. Spread an appropriate amount of bacterial culture evenly onto a plate containing the appropriate antibiotic and incubate upside down in a constant temperature incubator for 12-16 h. After colony screening, identify the target gene product. The primer sequences for gene identification are shown in Table 7, and the amplification conditions are shown in Table 5.

[0069] Table 7

[0070]

[0071] Sequencing results analysis showed that if the sequence matched the expectations, it was the correct recombinant plasmid, denoted as LAMP2B-CAP overexpression plasmid. The plasmid map of the LGR5-LAMP2B-CAP overexpression plasmid is shown below. Figure 2 As shown.

[0072] The nucleotide sequence shown in SEQ ID No. 1 is: GACTGGAGAGTGATCATCCCACCAAGACCTTCTGCC.

[0073] The nucleotide sequence shown in SEQ ID No. 2 is as follows:

[0074]

[0075] The nucleotide sequence shown in SEQ ID No. 3 is as follows:

[0076] CGGCGGAAGCGGGGCAGCGGCGAGGGCAGAGGAAGTCTTCTAACATGCGGTGACGTGGAGGAGAATCCCGGCCCT.

[0077] The nucleotide sequence shown in SEQ ID No. 4 is as follows:

[0078]

[0079] (3) Preparation of exosomes

[0080] Primary human umbilical cord-derived mesenchymal stem cells were passaged to the fifth generation. When the cells reached 80% confluency, the medium was changed, and the cells were transfected with LGR5-LAMP2B-CAP overexpression plasmid and LAMP2B-CAP overexpression plasmid, respectively. Untransfected cells served as a control group. After 6 hours, the medium was changed to serum-free exosome-free medium. After 48 hours, the supernatant was collected and centrifuged at differential speed to obtain the precipitate. The precipitate was resuspended in 100 μL of PBS and filtered through a 0.22-micron filter to obtain the corresponding exosomes.

[0081] Among them, the exosomes obtained by transfecting the LGR5-LAMP2B-CAP overexpression plasmid are mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5, and are denoted as LGR5-targeting peptide overexpression exosomes;

[0082] The exosomes obtained by transfecting the LAMP2B-CAP overexpression plasmid are mesenchymal stem cell exocrine bodies overexpressing CAP, and are denoted as target peptide exosomes.

[0083] Exosomes obtained without transfecting plasmids are conventional exosomes, while those in the figure of this invention are denoted as control exosomes.

[0084] In this embodiment, the transfection method was as follows: transfection was performed using the Lipo3000 kit (which contains both Lipo3000 and P3000 solutions) at a concentration of 2.5 × 10⁻⁶. 6 For example, regarding cell volume: Solution A is prepared by mixing 125 μL of serum-free medium with 7.5 μL of PIO3000 and vortexing for 3 seconds; Solution B is prepared by mixing 125 μL of serum-free medium, 2.5 μg of plasmid, and 5 μL of PIO3000. Solution A and Solution B are mixed at a volume ratio of 1:1 and allowed to stand for 15 minutes before being added dropwise to the medium for transfection.

[0085] The specific conditions for differential centrifugation are as follows: centrifuge at 300g for 10 minutes at 4℃ → centrifuge at 3000g for 10 minutes at 4℃ → centrifuge at 10000g for 30 minutes at 4℃ → centrifuge at 100000g for 70 minutes at 4℃ to obtain the precipitate.

[0086] II. In this embodiment of the invention, the microstructure, particle size and distribution, and related gene expression of the control exosomes, target peptide exosomes, and LGR5-overexpressing target peptide exosomes prepared above were examined. Transmission electron microscopy images of the control exosomes, target peptide exosomes, and LGR5-overexpressing target peptide exosomes are shown below. Figure 4 As shown, the particle size distribution diagrams of the three exosomes are as follows: Figure 5 As shown, Western blotting was used to detect the expression of three genes, TSG101, CD9, and CD81, in three exosomal cells. Figure 6 As shown.

[0087] Depend on Figure 4-5 It can be seen that there is no significant difference in morphology among the three types of exosomes: exosomes, target peptide exosomes, and exosomes overexpressing LGR5 target peptides, all of which have a spherical vesicle morphology. The average particle sizes of exosomes, target peptide exosomes, and exosomes overexpressing LGR5 target peptides are 119.83 nm, 179.53 nm, and 46.64 nm, respectively, and their particle size and distribution meet the requirements of relevant standards.

[0088] Depend on Figure 6 It can be seen that the detection of these three exosomal protein markers (TSG101, CD9 and CD81) by Western blotting confirmed that these three exosomal marker proteins were expressed in exosomes, target peptide exosomes and exosomes overexpressing LGR5 target peptide.

[0089] Example 2

[0090] This invention verifies the function and targeting of the exosomes overexpressing the LGR5 targeting peptide obtained in Example 1, as detailed below:

[0091] 1. Therapeutic effect experiment on inflammatory chondrocytes

[0092] This invention first prepares inflammatory chondrocytes using the following method: Articular cartilage is extracted from 3-day-old neonatal mice. Once the cell density reaches 90%, the cells are passaged, and the process is repeated to obtain the first generation of chondrocytes (passed twice). The same steps are then repeated to obtain the second generation. The passage medium is DMEM:F12 1:1 medium + 10% serum + 1% penicillin-dextrin antibiotics, and the culture conditions are 37°C and 5% CO2. Recombinant mouse interleukin β1 (manufacturer: Jomo Biotech, catalog number: CM002-5MP) is added to the culture medium of the second generation chondrocytes at a concentration of 3 ng / mL. After 24 hours, the medium is replaced with fresh medium to obtain the inflammatory chondrocytes.

[0093] Control exosomes, targeting peptide exosomes, and LGR5-overexpressing targeting peptide exosomes were added to the 2.5 × 10⁻⁶ solution prepared above at a concentration of 50 μg / mL. 6 After culturing inflammatory chondrocytes at 37°C and 5% CO2 for 72 hours, RNA was extracted for reverse transcription and qPCR amplification to verify the therapeutic effect. The results are as follows: Figure 7 As shown.

[0094] Depend on Figure 7It was found that the targeted peptide exosome treatment group and the LGR5-overexpressing targeted peptide exosome treatment group showed better therapeutic effects after intervention with inflamed chondrocytes. Both the gene Col2a1, which promotes chondrogenesis, and the gene Sox9, which regulates chondrogenesis, showed an increasing trend with statistically significant differences. The LGR5-overexpressing targeted peptide exosome treatment group was significantly better than the target peptide exosome treatment group, while the target peptide exosome treatment group was significantly better than the control exosome treatment group. The gene Mmp13, which promotes chondrogenesis, showed a decreasing trend in both the targeted peptide exosome treatment group and the LGR5-overexpressing targeted peptide exosome treatment group with statistically significant differences. The LGR5-overexpressing targeted peptide exosome treatment group had significantly lower levels than the target peptide exosome treatment group, while the target peptide exosome treatment group had significantly lower levels than the control exosome treatment group. Exosomes are small membrane vesicles containing complex RNA and proteins secreted by cells via exocytosis. Transfection with the LGR5-LAMP2B-CAP overexpression plasmid may have altered the cells, leading to the better therapeutic effect of exosomes.

[0095] 2. Targeted Experiment

[0096] 50 μg of control exosomes and LGR5-targeting peptide-overexpressing exosomes were labeled with 10 μM DIO and added to a 1×10⁻⁶ molecule, respectively. 6 It was applied to chondrocytes for 8 hours.

[0097] 1×10⁻⁶ cells were stained with 10 μM DID. 6 Chondroitin cells were cultured for 20 minutes, and then fluorescence was observed using a fluorescence microscope for data analysis. The fluorescence images of control exosomes and exosomes overexpressing the LGR5 targeting peptide transfected chondrocytes are shown below. Figure 8 As shown, the fluorescence statistical analysis of chondrocytes transfected with control exosomes and exosomes overexpressing LGR5 targeting peptides is as follows: Figure 9 As shown.

[0098] Depend on Figure 8 It can be seen that the exosomes overexpressing the LGR5 targeting peptide exhibit more green fluorescence than the exosomes themselves, indicating that the exosomes overexpressing the LGR5 targeting peptide are more likely to be phagocytosed by chondrocytes, while the red fluorescence of the exosomes in both groups is the same, indicating a more targeted effect. Figure 9 Quantitative analysis of fluorescence intensity showed the same result, indicating that exosomes overexpressing the LGR5 targeting peptide have a targeting effect.

[0099] 3. LGR5 expression levels

[0100] The expression level of LGR5 in human umbilical cord mesenchymal stem cells and human umbilical cord mesenchymal stem cells transfected with the LGR5-LAMP2B-CAP overexpression plasmid was measured using cellular fluorescence and qPCR techniques. The results are as follows: Figure 10-11As shown in the figure, the untransfected group consists of human umbilical cord mesenchymal stem cells, while the transfected group consists of human umbilical cord mesenchymal stem cells transfected with the LGR5-LAMP2B-CAP overexpression plasmid.

[0101] Figure 10 To determine the expression of LGR5 in human umbilical cord mesenchymal stem cells (HMCs) transfected with the LGR5-LAMP2B-CAP overexpression plasmid, a cellular fluorescence image was used. Green fluorescence represents the autofluorescence of cells after plasmid transfection. Figure 10 It can be seen that the LGR5-LAMP2B-CAP overexpression plasmid was successfully transfected and expressed.

[0102] Figure 11 A statistical chart showing the relative expression levels of LGR5 in human umbilical cord mesenchymal stem cells and human umbilical cord mesenchymal stem cells transfected with the LGR5-LAMP2B-CAP overexpression plasmid. Figure 11 It can be seen that the expression level of LGR5 in cells transfected with plasmid increased more than twofold.

[0103] Example 3

[0104] The present invention prepared hydrogel microspheres from the exosomes overexpressing the LGR5 targeting peptide obtained in Example 1, and the effects of these exosomes on osteoarthritis model animals were confirmed through animal experiments, as detailed below:

[0105] 1. Preparation of hydrogel microspheres

[0106] Hyaluronic acid (product number H874944, purchased from Maclean's) was dissolved in PBS at pH 7.4 to prepare a 2% (w / w) hyaluronic acid solution. This hyaluronic acid solution was then mixed with methacrylic anhydride (product number M102519, purchased from Aladdin) at a molar ratio of 2.6:1 in an ice bath with continuous stirring, maintaining the pH at 8.0. After reacting for 12 hours, the reaction solution was purified by dialyzing in deionized water for 3 days using a dialysis bag with a molecular weight cutoff of 100 kDa. The purified solution was then freeze-dried to obtain methacrylated hyaluronic acid.

[0107] Hydrogel microspheres with a diameter of approximately 200 μm were prepared using microfluidic technology by combining methacrylated hyaluronic acid with exosomes overexpressing the LGR5 targeting peptide. The composition and mass ratio of the microspheres were methacrylated hyaluronic acid: exosomes: initiator = 40:6:4. The generated microspheres were cross-linked and cured by irradiation with a 405 nm UV lamp for 5 minutes. After cross-linking and curing, hydrogel microspheres containing exosomes overexpressing the LGR5 targeting peptide were obtained. The initiator was lithium phenyl phosphate.

[0108] Bright-field microscopy images of the hydrogel microspheres containing exosomes overexpressing the LGR5 targeting peptide are shown below. Figure 12 As shown. By Figure 12It can be seen that the hydrogel has been successfully prepared into microspheres. The microspheres have similar particle size and regular shape, and are uniformly dispersed in the field of view without adhesion or aggregation. The whole exhibits good uniformity and stability.

[0109] 2. Animal experiments

[0110] Thirty-five 12-week-old male C57BL / 6J rats were randomly divided into five groups. Four groups underwent medial meniscus instability surgery (DMM), followed by intra-articular injections of appropriate hydrogel microspheres or PBS every two weeks for a total of four injections, 10 μl per injection. The remaining group was a sham-operated group, specifically: 1. Sham-operated group: only the joint capsule was opened, without medial meniscus instability surgery; 2. PBS group: intra-articular injection of PBS after medial meniscus instability surgery; 3. Empty microsphere group: intra-articular injection of empty microspheres after medial meniscus instability surgery; 4. Microsphere + CAP / EXO group: intra-articular injection of hydrogel microspheres containing mesenchymal stem cell exocrine bodies overexpressing CAP after medial meniscus instability surgery; 5. Microsphere + LGR5-CAP / EXO group: intra-articular injection of hydrogel microspheres containing exosomes overexpressing LGR5 targeting peptides after medial meniscus instability surgery.

[0111] The preparation method of the empty microspheres is basically the same as the preparation method of the "hydrogel microspheres of overexpressing LGR5 target peptide exosomes" in this embodiment. The only difference is that the composition and mass ratio of the microspheres are methacrylated hyaluronic acid: initiator = 40:4. All other steps are the same.

[0112] The preparation method of "microspheres containing mesenchymal stem cell exocrine bodies overexpressing CAP" is basically the same as the preparation method of "hydrogel microspheres containing exosomes overexpressing LGR5 targeting peptide" in this embodiment. The only difference is that "exosomes overexpressing LGR5 targeting peptide" are replaced with an equal amount of "mesenchymal stem cell exocrine bodies overexpressing CAP". All other steps are the same.

[0113] (1) Eight weeks after the operation, mouse knee joint samples were collected, and sagittal paraffin sections of mouse knee joint cartilage were prepared and stained with safranin and fast green to assess the degree of articular cartilage wear.

[0114] Sagittal and Fast Green staining images of sagittal paraffin sections of knee cartilage from different groups of mice are shown below. Figure 13 As shown. By Figure 13 It can be seen that the cartilage wear in the PBS group was very severe, with very little safranin staining. The cartilage wear in the empty microsphere group, the microsphere + CAP / EXO group, and the microsphere + LGR5-CAP / EXO group was alleviated, and the safranin staining gradually deepened. The microsphere + LGR5-CAP / EXO group showed the most significant effect on alleviating the wear of articular cartilage.

[0115] (2) OARSI score

[0116] Samples were prepared using consecutive 4μm thick sagittal sections. Ten consecutive sections (approximately 40μm apart) were selected from each mouse knee joint to ensure coverage of the entire joint surface and to perform a systematic assessment. This allowed for histological scoring of the entire joint surface, localization of the most severely damaged areas, and evaluation of the overall condition.

[0117] Statistical graphs of OARSI scores for knee joints in mice from different groups are shown below. Figure 14 As shown. By Figure 14 The results showed that the PBS group had the highest OARSI score, followed by the empty microsphere group, the microsphere + CAP / EXO group, and the microsphere + LGR5-CAP / EXO group, with the microsphere + LGR5-CAP / EXO group having the lowest OARSI score. These results indicate that the microsphere + LGR5-CAP / EXO group has the best therapeutic effect on knee osteoarthritis in mice.

[0118] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions or improvements made within the spirit and principles of the present invention should be included within the protection scope of the present invention.

Claims

1. Use of an exosome overexpressing a CAP gene and a LGR5 gene in the preparation of a drug for treating cartilage inflammation, characterized in that, The nucleotide sequence of the CAP gene is shown in SEQ ID No. 1; The exosomes overexpressing the CAP and LGR5 genes are exosomes of human umbilical cord-derived mesenchymal stem cells overexpressing the CAP and LGR5 genes; The method for preparing exosomes overexpressing the CAP and LGR5 genes includes the following steps: The gene sequence of CAP was added to the end of the LAMP2B gene to obtain the encoding gene of the targeting peptide CAP; the encoding gene of the targeting peptide CAP was linked with the encoding gene of LGR5 protein via a 2A peptide to construct the LGR5-LAMP2B-CAP overexpression plasmid. The LGR5-LAMP2B-CAP overexpression plasmid was transfected into human umbilical cord-derived mesenchymal stem cells, cultured, and after solid-liquid separation, the liquid phase was collected by differential centrifugation to obtain the precipitate, which was then resuspended to obtain mesenchymal stem cell exocrine bodies overexpressing CAP / LGR5. The nucleotide sequence of the LGR5-LAMP2B-CAP is shown in SEQ ID No. 2; The cartilage inflammation is at least one of osteoarthritis or patellar chondromalacia.

2. The application of exosomes overexpressing the CAP gene and LGR5 gene as described in claim 1 in the preparation of drugs for treating chondritis, characterized in that, The culture time is 48h-60h; and / or The differential centrifugation conditions are as follows: centrifugation at 300g for 10 minutes at 4℃, centrifugation at 3000g for 10 minutes at 4℃, centrifugation at 10000g for 30 minutes at 4℃, and centrifugation at 100000g for 70 minutes at 4℃ to obtain the precipitate.

3. The application of exosomes overexpressing the CAP gene and LGR5 gene as described in claim 1 in the preparation of drugs for treating chondritis, characterized in that, The method for constructing the LGR5-LAMP2B-CAP overexpression plasmid includes the following steps: synthesizing the LGR5-LAMP2B-CAP gene containing the LGR5 gene, LAMP2B gene and CAP gene, inserting it into the GV658 plasmid to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

4. The application of exosomes overexpressing the CAP gene and LGR5 gene as described in claim 3 in the preparation of drugs for treating chondritis, characterized in that, The construction method of the LGR5-LAMP2B-CAP overexpression plasmid specifically includes the following steps: The LGR5-LAMP2B-CAP gene and GV658 plasmid were digested with KpnI / PacI, homologous recombination was performed, and then PCR amplification was performed to obtain the LGR5-LAMP2B-CAP overexpression plasmid.

Citation Information

Patent Citations

  • Lgr5+ SOMATIC STEM CELLS

    US20140161774A1

  • Methods and compositions for developing target specific exosome and growth factor products

    US20220136053A1