Use of solute carrier family 25a33 in the preparation of a medicament for the treatment of presbycusis

By using an AAV vector to deliver the SLC25A33 gene to the inner ear, the problem of blood-labyrinthine barrier dysfunction in age-related hearing loss was solved, resulting in improved hearing function and protection of the blood-labyrinthine barrier, and a significant reduction in hearing threshold.

CN120919281BActive Publication Date: 2026-07-28THE FIRST AFFILIATED HOSPITAL OF ARMY MEDICAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511096143.1
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-08-06
Publication Date
2026-07-28
Estimated Expiration
2045-08-06

AI Technical Summary

Technical Problem

Currently, there is a lack of effective clinical treatments for age-related hearing loss, especially for sensorineural hearing loss caused by mitochondrial dysfunction and pericyte differentiation in the blood-labyrinth barrier. SLC25A33, as a potential target, has not been fully utilized.

Method used

The SLC25A33 gene was delivered to the inner ear using an AAV vector. By maintaining the stability of pericyte function, inhibiting pericyte differentiation into smooth muscle cells, and protecting the integrity of the blood-labyrinth barrier structure, the gene was enhanced by increasing the expression of tight junction proteins ZO-1 and Claudin-5 and inhibiting the activation of the TGFβ/SMAD signaling pathway.

Benefits of technology

It achieved therapeutic effects on age-related hearing loss, significantly reduced α-SMA expression, increased E-Cadherin expression, improved hearing function, reduced ABR threshold by 7.5-10 dB, and enhanced the structural and functional integrity of the blood labyrinth barrier.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure HDA0005535422670000011
    Figure HDA0005535422670000011
  • Figure HDA0005535422670000021
    Figure HDA0005535422670000021
  • Figure HDA0005535422670000031
    Figure HDA0005535422670000031
Patent Text Reader

Abstract

The application discloses a use of a solute carrier family 25A33 gene in preparation of a medicament for treating presbycusis, and the use is achieved by enhancing SLC25A33 expression on an endolymphatic vascular stripe, by maintaining mitochondrial function stability of pericyte cells around the vascular stripe, by reducing active oxygen free radical (ROS) generation, and by blocking TGFbeta / SMAD pathway-mediated pericyte differentiation, so as to protect the integrity of the blood labyrinth barrier. Animal experiments show that overexpression of SLC25A33 can significantly reduce the hearing threshold of a presbycusis model mouse, protect the structure of the blood labyrinth barrier, and improve the expression of tight junction proteins, and the SLC25A33 gene has the potential to treat presbycusis.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of biomedical technology, specifically relating to the use of a solute carrier family 25A33 in the preparation of drugs for treating age-related hearing loss. Background Technology

[0002] Age-related hearing loss affects approximately one-third of the global population aged 65 and over, often manifesting as bilateral symmetrical sensorineural hearing loss, frequently accompanied by tinnitus, sleep disturbances, and cognitive decline. Currently, there are no effective clinical treatments. Research indicates that blood-labyrinthine barrier (BLB) disruption is a core mechanism of sensorineural hearing loss, with pericyte differentiation-related barrier dysfunction not yet fully understood. The solute carrier family 25A33 (SLC25A33, formerly known as PNC1) is a mitochondrial pyrimidine nucleotide carrier responsible for regulating mitochondrial nucleotide metabolism; however, the mechanisms of mitochondrial dysfunction occurring within the blood-labyrinthine barrier remain unclear.

[0003] In their proteomics research, the inventors have discovered for the first time that SLC25A33 expression is significantly reduced in the plasma of patients with age-related hearing loss. Furthermore, in the stria vascularis tissue of the cochlea of ​​C57B / L6 age-related hearing loss model mice, they confirmed that the downregulation of SLC25A33 expression is closely related to increased reactive oxygen species (ROS) in the blood-labyrinthine barrier and pericyte differentiation. Currently, there are no reports of SLC25A33 being used as an independent therapeutic target for age-related hearing loss, nor are there any reports of its use in the preparation of drugs for treating age-related hearing loss. Summary of the Invention

[0004] The purpose of this invention is to provide the use of the SLC25A33 gene in the manufacture of drugs for treating age-related hearing loss. This invention addresses the current lack of effective treatments for age-related hearing loss by providing a method for delivering the SLC25A33 gene to the inner ear using an AAV vector, thereby achieving the goal of treating age-related hearing loss.

[0005] To achieve the above-mentioned objectives, the present invention provides the following implementation scheme:

[0006] In some embodiments, the present invention provides the use of the solute carrier family 25A33 (SLC25A33) gene in the preparation of a drug for treating age-related hearing loss.

[0007] In the above-described uses of the present invention, the SLC25A33 gene functions by maintaining the functional stability of pericytes.

[0008] In the above-described uses of the present invention, the SLC25A33 gene can prevent pericytes from differentiating into smooth muscle cells, specifically by reducing α-SMA expression and increasing E-Cadherin expression.

[0009] The above-described uses of the present invention involve the SLC25A33 gene inhibiting pericyte differentiation by suppressing the activation of the TGFβ / SMAD signaling pathway.

[0010] As described above, the SLC25A33 gene can protect the structural integrity of the blood labyrinth barrier by enhancing the expression of tight junction proteins ZO-1 and Claudin-5.

[0011] In other embodiments, the present invention provides a medicament for treating age-related hearing loss, the medicament comprising an expression vector carrying the SLC25A33 gene.

[0012] Preferably, in the drug of the present invention described above, the expression vector is an AAV vector.

[0013] In some embodiments, the present invention provides a pharmaceutical composition for treating age-related hearing loss, comprising an AAV vector carrying the SLC25A33 gene or a drug thereof, and pharmaceutically acceptable excipients.

[0014] The pharmaceutical composition of the present invention described above is in the form of an injection.

[0015] In some embodiments, the present invention also provides the use of an AAV-delivered gene in the manufacture of a medicament for treating age-related hearing loss and sensorineural hearing loss.

[0016] In some embodiments, the present invention provides a pharmaceutical composition for treating age-related hearing loss and sensorineural hearing loss, comprising the SLC25A33 gene and a pharmaceutically acceptable AAV vector.

[0017] Specifically, the above-mentioned application of the present invention involves delivering the SLC25A33 gene to the inner ear via the AAV vector to achieve the purpose and therapeutic effect of treating age-related hearing loss. The specific effects of the SLC25A33 gene are as follows:

[0018] 1. Maintain pericyte mitochondrial function;

[0019] 2. Inhibits pericyte differentiation into smooth muscle cells (α-SMA expression significantly decreased by 33% (p<0.05), E-Cadherin significantly increased by 1.2-fold (p<0.05));

[0020] 3. Protects the integrity of the blood labyrinth barrier structure and function (increased expression of tight junction proteins);

[0021] 4. Improves hearing function in aged mice (ABR threshold reduced by 7.5-10 dB).

[0022] These results indicate that the SLC25A33 gene is effective in treating age-related hearing loss and has the potential to be developed into a gene therapy drug. Attached Figure Description

[0023] Figure 1 The difference in SLC25A33 expression levels and curves between elderly patients with hearing loss and healthy young and elderly individuals in Example 1;

[0024] Figure 2 The graph shows the correlation between SLC25A33 expression in cochlear tissue and hearing threshold in aged mice and young mouse control groups in Example 2, along with the correlation curve.

[0025] Figure 3 The bar chart shows the effect of ROS production in perivascular cells of aged mice in Example 3.

[0026] Figure 4 The graph shows the comparison of hearing thresholds at different kHz in aged mice in the SLC25A33 AAV overexpression group, AAV interference group, and control group after intraoral administration of SLC25A33AAV overexpression group, AAV interference group, and control group in Example 5.

[0027] Figure 5 The following are fluorescence micrographs and bar charts showing the effects of intraoral administration of SLC25A33 overexpressing AAV in Example 6 on the reduction of pericyte differentiation marker α-SMA and the enhancement of E-Cadherin expression in the stria vascularis of aged and young mice.

[0028] Figure 6 This is a fluorescence micrograph showing the expression intensity of tight junction proteins ZO-1 and Claudin-5 in the blood labyrinth barrier of aged mice after intraoral administration of SLC25A33-overexpressed AAV in the aged mouse control group, as described in Example 6.

[0029] Figure 7 The images show fluorescence micrographs and expression intensity bar graphs of TGFβ and SMAD in the stria vascularis of aged and young mice after intraoral administration of SLC25A33-overexpressing AAV in Example 6. Detailed Implementation

[0030] The following embodiments are provided to describe the present invention in more detail. However, these embodiments are provided only to help further understand the present invention and are not intended to limit the present invention. Those skilled in the art should understand that equivalent substitutions or corresponding improvements made to the content of the present invention still fall within the protection scope of the present invention.

[0031] Example 1: Validation of SLC25A33 expression in age-related hearing loss

[0032] 1. Plasma samples were collected from healthy young adults (21-30 years old), healthy elderly adults (>65 years old), and individuals with pre-existing hearing loss (>65 years old, PTA>40 dB) for proteomics analysis. Results are shown below. Figure 1The results showed that SLC25A33 expression was lowest and persistently decreased in the elderly with hearing loss. Western blot analysis showed that SLC25A33 expression progressively decreased in all three groups, with the expression level in the elderly with hearing loss group being only 32.7±5.1% of that in the young adult group (p<0.01).

[0033] Example 2: Correlation between SLC25A33 expression in cochlear tissue of aged mice and hearing threshold

[0034] Experimental preparation: SPF-grade wild-type C57 / BL6 mice were purchased from the Experimental Animal Center of Army Medical University. Young mice (3 months old) and old mice (18 months old) were both male and weighed 22-24g.

[0035] 1. The specific audiometry method is as follows: All mouse ABR and DPOAE tests were performed using the TDT BioSigRP system (Tucker-Davis Technologies, Inc., TDT, USA), with the mice placed in a soundproof audiometry chamber. Mice were anesthetized via right-sided intraperitoneal injection with tribromoethanol (TBE, delivector™ Avertin, 20 μL / g) and kept warm using a small animal heating blanket. Before testing, the mice were checked for external auditory canal obstruction, tympanic membrane infection, and middle ear effusion. Electrode needles were inserted subcutaneously into the skull (connected to the reference electrode), the mastoid process of the test ear (right ear) (connected to the recording electrode), and the buttocks (ground electrode). A closed-tube sound transmission system was used, sealed within the external auditory canal, with stimulation applied to the right ear in all cases.

[0036] ABR measurement: Short clicks and short pure tones (4k, 8k, 12k, 16k, 32k) were used as stimuli. The bandpass filter was 300-3000Hz, with 512 superpositions and a scan time of 10ms. The stimulus intensity started at 90dB SPL and gradually decreased in 10dB increments, decreasing in 5dB increments as it approached the threshold, until no hearing waveform was detected. The ABR threshold was determined by the lowest stimulus intensity at which a repeatable ABR wave II could be distinguished.

[0037] DPOAE measurement: Using short pure tones f1 and f2 (f2 / f1 = 1.2) as initial stimuli, the hearing thresholds of mice at 4, 8, 12, 16, and 32 kHz were tested. The highest sound intensity during testing was set at 80 dB SPL, decreasing by 5 dB each time, with the lowest stimulus intensity required to elicit DPOAE as the threshold, which was then recorded. The average noise floor at all frequencies was below 0 dB.

[0038] 2. Fluorescence detection of changes in SLC25A33 expression in stria vascularis tissue of aged and young mice.

[0039] Mice were euthanized under overdose anesthesia, and their heads and necks were decapitated. The auditory bullae were quickly dissected and placed in a culture dish filled with fresh, cold perilymphatic fluid. The mice were fixed with 4% paraformaldehyde for 2 hours, then transferred to clean fixative and fixed at 4°C for 24 hours. They were then decalcified with 10% EDTA for 3 days, followed by dehydration with a series of sucrose solutions. The sections were then cryostated. The prepared frozen sections were thawed at room temperature and blocked with 10% goat serum for 30 minutes. The sections were then incubated with rabbit-derived SLC25A33 primary antibody (1:200) and incubated overnight at 4°C on a shaker. The next day, the working solution of the primary antibody was discarded, and the mice were washed three times with PBS for 10 minutes each time. Then, Alexa Fluor 647-labeled goat anti-rabbit IgG (H+L) fluorescent secondary antibody (1:1000) was added, and the mixture was shaken on a shaker to ensure uniform binding. The mixture was incubated at 37°C in the dark for 30 minutes. After removing the secondary antibody working solution, the cells were washed three times with PBS and counterstained with DAPI. Antifluorescence quenching mounting medium was added, the slides were mounted, and observed under a fluorescence confocal microscope. The localization and expression intensity of SLC25A33 in mouse blood labyrinth barrier tissue were observed.

[0040] See results Figure 2 Figure A shows the fluorescence staining of SLC25A33 expression in the stria vascularis tissue of aged and young mice; Figure B represents the percentage of SLC25A33 and SV area in aged and young mice; Figure C shows the SPL curves of sound intensity in aged and young mice; and Figure D shows the ABR and DPOAE hearing thresholds of aged and young mice at different audio frequencies. The results indicate that the ABR and DPOAE hearing thresholds of aged mice are significantly higher than those of young mice.

[0041] Example 3: Effects of ROS production in perivascular cells of aged mice

[0042] Experimental preparation: SPF-grade wild-type C57 / BL6 mice were purchased from the Experimental Animal Center of Army Medical University. Young mice (3 months old) and old mice (18 months old) were both male and weighed 22-24g.

[0043] (1) Sample collection: Mice were euthanized by overdose anesthesia, and the head and neck were removed and disinfected with 75% ethanol. The auditory bullae were quickly dissected and placed in a culture dish filled with fresh, cold artificial perilymphatic fluid. The stria vascularis tissue on the spiral ligament of the cochlea was gently dissected, minced, digested with trypsin, and digested with serum-containing cell culture medium to stop the digestion. The cell suspension was collected by filtration through a cell filter screen; the cells were reselected with PBS buffer, washed 1-2 times, and resuspended.

[0044] (2) Immunofluorescence probe technology: MitoTracker Green, MitoSOX Red, and TMRE molecular probes were used to double-stain specimens with the primary antibody against the pericyte marker PDGFRβ. Flow cytometry was used to analyze and detect mitochondrial mass (MitoTracker Green) and ROS production (MitoSOX Red) in pericytes (PDGFRβ). Cell suspensions were prepared, sorted, stained with MitoSOX Red, and then analyzed by flow cytometry to detect the production of reactive oxygen species (ROS). Results are shown in […]. Figure 3 .

[0045] The results showed that the amount of ROS produced in the blood labyrinth barrier tissue of aged mice was significantly increased compared with that of young mice (n=3, p<0.01).

[0046] Example 4: Construction of AAV overexpression using SLC25A33

[0047] The SLC25A33 AAV gene protein is produced by Heyuan Biotechnology Co., Ltd. (Shanghai, China).

[0048] Preparation of rAAV titer (AAV serotype: AAV-ie): Overexpression of AAV-ie 4.71 × 10 12 vg / ml, overexpression blank control AAV-ie 2.88×10 12 vg / ml, AAV interference control AAV-ie 1.24×10 13 vg / ml.

[0049] Cloning Information: Gene Name: SLC25A33, belonging to the mouse gene family, with GenBank ID NM_027460.2 and a gene size of 963 bp. Restriction Sites and Vector: The upstream and downstream restriction enzyme sites are EcoRI and EcoRV, respectively, and the prokaryotic resistance is Amp (ampicillin resistance). The blank vector is named GL3010pAAV-CMV-MCS-EF1-zsGreen1-WPRE. The overexpression vector after construction is named pAAV-CMV-SLC25A33-3xFLAG-EF1-sGreen1-PRE.

[0050] The interference vector was named pAAV-U6-shRNA(SLC25A33)-CMV-EGFP-WPRE.

[0051] The shRNA sequence number of the interference group is Y37127SLC25A33 NM_027460.2, and the nucleotide sequence is TAGAGGCCTGGGTCCAAATTT.

[0052] The shRNA of this interference group binds to the mRNA of the target gene, triggering an intracellular RNA interference mechanism that degrades the mRNA of SLC25A33, thereby reducing the expression of the gene.

[0053] Sequencing primers used for genotyping:

[0054] The forward sequencing primer was CMV-F, with the sequence CGCAAATGGGCGGTAGGCGTG; the reverse sequencing primer was EF1a-SEQR, with the sequence CCAACTTCTCGGGGACTGTG. Sequencing confirmed that the SLC25A33 gene was correctly inserted into the vector and that the inserted fragment sequence was correct.

[0055] Example 5: Intraocular administration of SLC25A33 for the treatment of age-related hearing loss

[0056] Experimental preparation: SPF-grade wild-type C57 / BL6 mice were purchased from the Experimental Animal Center of Army Medical University. The mice were aged (18 months), all male, and weighed 22-24g. They were randomly divided into three groups: an AAV-SLC25A33 overexpression group, an AAV-shSCL25A33 interference group, and an AAV blank control group.

[0057] Drug preparation: Take pAAV-CMV-SLC25A33-3xFLAG-EF1-sGreen1-PRE (hereinafter referred to as the AAV-SLC25A33 overexpression group) prepared in Example 4, GL3010

[0058] pAAV-CMV-MCS-EF1-zsGreen1-WPRE (referred to as the AAV blank control group in the following experiments) and pAAV-U6-shRNA(SLC25A33)-CMV-EGFP-WPRE (referred to as the AAV-shSCL25A33 interference group in the following experiments).

[0059] The 18-month-old C57 / BL6 mice prepared earlier were divided into the following groups, and 5 μL of the drug was injected into the left and right ears respectively:

[0060] Overexpression group: AAV-SLC25A33 was administered, and AAV-Ie 4.71×10 12 vg / ml;

[0061] Interference group: AAV-shSLC25A33 and AAV-ie 1.24×10 13 vg / ml;

[0062] Control group: AAV-NS administered, AAV-Ie 2.88×10 12 vg / ml.

[0063] Administration procedure: After each group of mice was anesthetized by inhalation, the external auditory canal and tympanic membrane were examined under a stereomicroscope. If no abnormalities were found, the auricle and external auditory canal were disinfected with 75% medical alcohol. Then, under a microscope, a disposable microsyringe (0.3 ml) was used to administer the drug into the ear. After observing for any bleeding and after the mice regained consciousness from anesthesia, they were returned to their cages for rearing.

[0064] Tested 4 weeks later:

[0065] The mice showed no redness or swelling in their external auditory canal and no discharge from their tympanic membrane.

[0066] ABR threshold detection (specific steps are the same as before):

[0067] Hearing threshold (12kHz) in aged mice: The mean value in the AAV-SLC25A33 overexpression group was 65.83±3.76dB, the mean value in the AAV control group was 75.83±5.85dB, and the mean value in the AAV-shSLC25A33 interference group was 81.667±6.83dB. Compared with the AAV control group, the 12kHz hearing threshold of aged mice in the AAV-SLC25A33 overexpression group was significantly improved (p<0.001).

[0068] Hearing threshold (16kHz) detection in aged mice: The mean value in the AAV-SLC25A33 overexpression group was 67.5±2.74dB, the mean value in the AAV control group was 75±5.48dB, and the mean value in the AAV-shSLC25A33 interference group was 86.667±4.08dB. Compared with the AAV control group, the 16kHz hearing threshold of aged mice in the AAV-SLC25A33 overexpression group was significantly improved (p<0.001). See results below. Figure 4 .

[0069] Example 6 Mechanism Verification

[0070] 1. Investigation of the localization and expression intensity of α-SMA and E-Cadherin in mouse blood-labyrinth barrier tissue

[0071] Specific experimental steps:

[0072] The following verification experiments used young mice (3 months old) and old mice (18 months old), and set up AAV control group, AAV-SLC25A33 overexpression group (SCL+), and AAV-shSLC25A33 interference group (SLC-), respectively. The drug administration was the same as in Example 5, with 6 mice in each group.

[0073] After each group of mice was anesthetized by inhalation, the external auditory canal and tympanic membrane were examined under a stereomicroscope. If no abnormalities were found, the auricle and external auditory canal were disinfected with 75% medical alcohol. Then, the medication was administered into the ear using a disposable microsyringe (0.3 ml) under a microscope.

[0074] Each mouse was injected with 5 μL of AAV-SLC25A33 overexpression group, 5 μL of AAV control group, and 5 μL of AAV-shSLC25A33 interference group into its left and right ears, respectively. After observing no bleeding and the mice regaining consciousness from anesthesia, they were returned to their cages for rearing.

[0075] Four weeks later, mice were over-anesthetized and euthanized. The head and neck were severed, and the auditory bullae were quickly dissected and placed in a culture dish filled with fresh, chilled perilymphatic fluid. The mice were fixed with 4% paraformaldehyde for 2 hours, then transferred to clean fixative and fixed at 4°C for 24 hours. They were then decalcified with 10% EDTA for 3 days, followed by dehydration with a series of sucrose solutions. The sections were then cryostated. The prepared frozen sections were thawed at room temperature and blocked with 10% goat serum for 30 minutes. The sections were then incubated with rabbit-derived α-SMA primary antibody (1:50) and mouse-derived E-Cadherin primary antibody (1:50) overnight at 4°C. The next day, the working solution was discarded, and the mice were washed three times with PBS for 10 minutes each time. Then, add Alexa Fluor 647-labeled goat anti-rabbit IgG (H+L) fluorescent secondary antibody (1:1000) and Alexa Flour 555-labeled goat anti-mouse antibody (1:1000), shake on a shaker to ensure uniform binding, and incubate at 37°C in the dark for 30 min. After removing the working solution of the secondary antibody, wash three times with PBS, and counterstain the cell nuclei with DAPI. Add anti-fluorescence quenching mounting medium, mount the slides, and observe under a fluorescence confocal microscope. Observe the localization and expression intensity of α-SMA and E-Cadherin in mouse blood labyrinth barrier tissue. The results are shown in […]. Figure 5 In the figure, A represents a fluorescence micrograph, and B and C represent the localization and expression intensity of α-SMA and E-Cadherin in the blood labyrinth barrier tissue, respectively.

[0076] Results: In the stria vascularis (SV) tissue of the cochlea of ​​aged mice: In the AAV-SLC25A33 overexpression group, compared with the control group, the pericyte differentiation marker α-SMA was significantly reduced by 33% (P<0.05); E-Cadherin expression was increased by 1.2 times (P<0.05), and pericyte differentiation into mesenchymal cells was reduced.

[0077] 2. Investigation of expression intensity of tight junction proteins ZO-1 and Claudin-5 in stria vascularis tissue of mice

[0078] Specific experimental steps:

[0079] The following verification experiment used aged mice (18 months old) and set up an AAV control group and an AAV-SLC25A33 overexpression group. The drug administration was the same as in Example 5, with 6 mice in each group.

[0080] After each group of mice was anesthetized by inhalation, the external auditory canal and tympanic membrane were examined under a stereomicroscope. If no abnormalities were found, the auricle and external auditory canal were disinfected with 75% medical alcohol. Then, the medication was administered into the ear using a disposable microsyringe (0.3 ml) under a microscope.

[0081] Each mouse was injected with 5 μL of AAV-SLC25A33 overexpression group and 5 μL of AAV control group into its left and right ears, respectively. After observing no bleeding and the mice regaining consciousness from anesthesia, they were returned to their cages for rearing.

[0082] Four weeks later, samples were collected. Mice were euthanized under excessive anesthesia, decapitated, and the head and neck were removed. The auditory bullae were quickly dissected and placed in a culture dish filled with fresh, cold peritumoral fluid. The mice were fixed with 4% paraformaldehyde for 2 hours, then transferred to clean fixative and fixed at 4°C for 24 hours. They were then decalcified with 10% EDTA for 3 days, followed by dehydration with a series of sucrose solutions. The sections were then cryostated. The prepared frozen sections were thawed at room temperature and blocked with 10% goat serum for 30 minutes. The sections were then incubated with rabbit-derived ZO-1 primary antibody (1:200) and rabbit-derived Claudin-5 primary antibody (1:200) overnight at 4°C. The next day, the working solution of the primary antibody was discarded, and the mice were washed three times with PBS for 10 minutes each time. Add Alexa Fluor 647-labeled goat anti-rabbit IgG (H+L) fluorescent secondary antibody (1:1000), shake on a shaker to ensure uniform binding, and incubate at 37°C in the dark for 30 min. After removing the working solution of the secondary antibody, wash three times with PBS, and counterstain cell nuclei with DAPI. Add anti-fluorescence quenching mounting medium, mount the slides, and observe under a fluorescence confocal microscope. Observe the expression intensity of tight junction proteins ZO-1 and Claudin-5 in mouse stria vascularis tissue. Results are shown below. Figure 6 In the figure, A and B represent the expression intensities of tight junction proteins ZO-1 and Claudin-5 in stria vascularis, respectively.

[0083] Results: In the SLC25A33 overexpression AAV injection group, the expression of tight junction proteins ZO-1 and Claudin-5 in stria vascularis tissue was enhanced, confirming that SLC25A33 is related to the function and structure of maintaining the blood labyrinth barrier.

[0084] 3. Investigation of the localization and expression intensity of TGFβ and SMAD in the stria vascularis of mice.

[0085] Specific experimental steps:

[0086] The following validation experiments used young mice (3 months old) and aged mice (18 months old), and set up an AAV control group and an AAV-SLC25A33 overexpression group (SCL). + ), AAV-shSLC25A33 jamming group (SLC) -The administration was the same as in Example 5, with 6 animals in each group.

[0087] After each group of mice was anesthetized by inhalation, the external auditory canal and tympanic membrane were examined under a stereomicroscope. If no abnormalities were found, the auricle and external auditory canal were disinfected with 75% medical alcohol. Then, the medication was administered into the ear using a disposable microsyringe (0.3 ml) under a microscope.

[0088] Each mouse was injected with 5 μL of AAV-SLC25A33 overexpression group, 5 μL of AAV control group, and 5 μL of AAV-shSLC25A33 interference group into its left and right ears, respectively. After observing no bleeding and the mice regaining consciousness from anesthesia, they were returned to their cages for rearing.

[0089] Four weeks later, samples were collected. Mice were euthanized under excessive anesthesia, decapitated, and the head and neck were removed. The auditory bullae were quickly dissected and placed in a culture dish filled with fresh, cold peritumoral fluid. The mice were fixed with 4% paraformaldehyde for 2 hours, then transferred to clean fixative and fixed at 4°C for 24 hours. They were then decalcified with 10% EDTA for 3 days, followed by dehydration with a series of sucrose solutions. The sections were then cryostated. The prepared frozen sections were thawed at room temperature and blocked with 10% goat serum for 30 minutes. The sections were then incubated with rabbit-derived TGFβ primary antibody (1:50) and rabbit-derived SMAD7 primary antibody (1:50) overnight at 4°C. The next day, the working solution of the primary antibody was discarded, and the mice were washed three times with PBS for 10 minutes each time. Then, Alexa Fluor 647-labeled goat anti-rabbit IgG (H+L) fluorescent secondary antibody (1:1000) was added, and the mixture was shaken on a shaker to ensure uniform binding. The cells were incubated at 37°C in the dark for 30 min. After removing the working solution of the secondary antibody, the cells were washed three times with PBS, and the nuclei were counterstained with DAPI. Antifluorescence quenching mounting medium was added, the slides were mounted, and observed under a fluorescence confocal microscope. The localization and expression intensity of TGFβ and SMAD in the stria vascularis of mice were observed. Results are shown below. Figure 7 In the figure, A is a fluorescence micrograph, and B and C are bar charts showing the expression intensity of TGFβ and SMAD in stria vascularis, respectively.

[0090] Results: In the stria vascularis tissue of the cochlea of ​​aged mice, the expression of TGFβ and SMAD was downregulated in the AAV injection group with SLC25A33 overexpression, confirming the inhibition of the TGFβ / SMAD signaling pathway.

Claims

1. Use of a substance overexpressing solute carrier family 25 A33 (SLC25A33) gene in the preparation of a medicament for treating presbycusis.

2. Use according to claim 1, characterized in that: The SLC25A33 plays a role in maintaining the functional stability of pericytes.

3. Use according to claim 1, characterized in that: The SLC25A33 prevents pericyte differentiation into smooth muscle cells, specifically by reducing the expression of α-SMA and increasing the expression of E-Cadherin.

4. The use according to claim 1, characterized in that: SLC25A33 inhibits pericyte differentiation by inhibiting the activation of the TGFβ / SMAD signaling pathway.

5. The use according to claim 1, characterized in that: SLC25A33 protects the structural integrity of the blood labyrinth barrier, specifically by enhancing the expression of tight junction proteins ZO-1 and Claudin-5.