Application of host factor RAB10 in regulating and controlling hepatitis B virus antigen expression and resisting hepatitis B virus

Abstract

The invention discloses application of a host factor RAB10 in regulation and control of hepatitis B virus antigen expression and anti-hepatitis B virus. The invention provides an application of a host factor RAB10 or a coding gene thereof in regulation and control of hepatitis B virus replication or hepatitis B virus antigen expression level in host cells, and an application of the host factor RAB10 or an expression promoter thereof in preparation of drugs for resisting hepatitis B virus or inhibiting hepatitis B virus antigen. The invention also discloses application of the host factor RAB10 or the coding gene thereof as a drug target in screening drugs for resisting hepatitis B virus or inhibiting hepatitis B virus antigen. Researches show that RAB10 can significantly inhibit HBsAg expression, HBV DNA replication, HBV RNA transcription and HBs protein level, is expected to be used for developing a novel therapeutic drug for inhibiting hepatitis B virus surface antigen, and provides a new strategy for HBV functional cure.

Description

Technical Field

[0001] This invention relates to the field of biopharmaceutical technology, specifically to the application of host factor RAB10 in regulating hepatitis B virus antigen expression and anti-hepatitis B virus activity. Background Technology

[0002] Hepatitis B (HBV) is a globally prevalent infectious disease caused by the hepatitis B virus. HBV infection can lead to liver failure, cirrhosis, or hepatocellular carcinoma (HCC). Although hepatitis B vaccination is widespread, it only blocks viral transmission and cannot eliminate existing infection. Therefore, eradicating chronic hepatitis B (CHB) remains a major challenge in global public health.

[0003] HBV is a DNA-enveloped virus belonging to the Hepatoviridae family. The HBV viral particle consists of a nucleocapsid and envelope proteins. The HBV genome is a 3.2kb relaxed circular DNA (rcDNA) genome, with the longer strand designated as the negative strand (-) and the shorter strand as the positive strand (+). The negative strand is the coding strand, containing four overlapping open reading frames (ORFs) (preC / C, P, preS / S, and X), four promoters (core promoter, PreS1 promoter, PreS2 / S promoter, and X promoter), and two enhancers (EnhⅠ and EnhⅡ), which can transcribe four types of RNA (3.5kb PreC / C mRNA, 2.4kb PreS1 mRNA, 2.1kb PreS2 / S mRNA, and 0.7kb X mRNA). The PreC / C ORF encodes HBeAg and HBcAg; the PORF encodes HBV DNA polymerase; the PreS / S ORF encodes large (L), medium (M), and small (S) envelope proteins; and the XORF encodes the X protein (HBx). After the HBV viral particle's envelope proteins bind to the sodium taurocholate cotransport polypeptide (NTCP) receptor, it enters the cell. Once inside the cell, the nucleocapsid releases rcDNA, which is then transcribed, replicated, and translated. HBV infection produces various viral particles, such as Dane particles, HBV RNA viruses, empty viruses, naked capsids, and subviral particles. The quantity of these different viral particles varies considerably. For example, Dane particles are produced in quantities 1-100 times more than HBV RNA viruses, but 100-144 times less than empty viruses, and 10,000-100,000 times less than subviral particles.

[0004] In chronic infection, the body's inability to clear HBV may be due to the secretion of an excessive amount of subviral particles (SVP, also known as hepatitis B surface antigen (HBsAg or HBs) particles). SVP is considered a decoy for the immune system, which can deplete B and T cell responses, thus contributing to persistent viral infection. Clinically, the disappearance of HBs or the appearance of anti-HBs antibodies signifies durable immune control or functional cure of hepatitis B virus infection. Therefore, developing antiviral drugs targeting HBs to achieve this therapeutic goal is of great significance.

[0005] Nucleoside (acid) analogues and interferon (IFN) are currently the most widely used antiviral therapies. Nucleoside (acid) analogues are polymerase inhibitors that can effectively inhibit HBV replication, reduce serum HBV load in most patients for a certain period, and improve transaminase levels and liver histology. However, they cannot completely eliminate HBV, and patients must take medication for life. Furthermore, long-term use may lead to viral resistance. High-dose INF-α may help degrade viral DNA, but its effect is limited, and most patients experience adverse reactions. Very few patients achieve clinical cure (or functional cure) within a limited treatment course.

[0006] Currently, there are two main definitions of HBV cure: the first is complete cure, which involves the complete elimination of HBV cccDNA; the second is functional cure, where serum HBsAg continues to disappear, with or without anti-HBs seroconversion, and HBV DNA levels are below the detection limit. It is believed that a 0.5 log decrease in HBsAg levels per year can serve as a predictive indicator for achieving HBsAg serological clearance within 3 years. Therefore, clearing HBsAg through treatment is considered key to restoring the host's antiviral immune response and achieving functional cure.

[0007] Several candidate molecules targeting HBsAg have been identified, including natural products, synthetic compounds, siRNA, and NAP. siRNA and NAP have undergone clinical trials, but due to drawbacks such as the short half-life of RNA interference and its susceptibility to mutational escape, and the unclear safety profile of NAP in patients with cirrhosis, they have not yet been approved for marketing. Therefore, it is still necessary to develop other drugs targeting HBsAg, and elucidating the mechanisms by which drugs act on HBsAg is crucial for the development of new drugs.

[0008] Host factors are proteins in host cells that participate in regulating the transcription and translation of the viral genome after hepatitis B virus (HBV) infection, thereby affecting viral replication. These host factors may promote viral entry into host cells, assembly, and release of progeny viral particles by interacting with viral proteins. Research on the role of host factors in HBV infection helps to understand the interaction between the virus and the host, providing clues for developing new antiviral strategies. Because host factors are involved in all stages of the HBV life cycle, current research on the interaction between HBV and host factors is extensive, including identifying receptors for viral entry into cells, identifying factors affecting viral cccDNA synthesis, and identifying host factors affecting cccDNA transcription. These studies often focus on the impact on viral replication, i.e., the progeny viral DNA, with less attention paid to the impact on surface antigens, and even less systematic screening of host factors related to surface antigen expression.

[0009] The Ras-related protein RAB10 gene, or RAB10 for short, is a member of the RAB protein family of small GTPases. It plays a crucial role in various important cellular activities, regulating vesicle formation, transport, and fusion to ensure the accurate transport and distribution of intracellular substances among different organelles, thereby maintaining normal cellular physiological functions. For example, in insulin secretion, RAB10 facilitates the transport and release of insulin granules, which is essential for maintaining stable blood glucose levels. Furthermore, RAB10 participates in cellular signal transduction, influencing various cellular behaviors such as growth, differentiation, and apoptosis through interactions with other proteins. Summary of the Invention

[0010] The purpose of this invention is to address the above-mentioned problems by providing an application of host factor RAB10 in regulating hepatitis B virus antigen expression and anti-hepatitis B virus activity.

[0011] To achieve its objective, the present invention employs the following technical solution:

[0012] A first aspect of the present invention provides the use of a host factor or its encoding gene in regulating the replication of hepatitis B virus or the expression level of hepatitis B virus antigen in host cells, wherein the host factor is RAB10.

[0013] The hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg, and hepatitis B core antigen HBcAg.

[0014] The host factor inhibits the expression level of hepatitis B virus antigen in host cells.

[0015] The host factor reduces the expression levels of HBV RNA and HBs protein, and inhibits HBV DNA replication.

[0016] A second aspect of the present invention provides the use of a host factor or an expression promoter thereof in the preparation of a medicament for the treatment of hepatitis B virus or the inhibition of hepatitis B virus antigen, wherein the host factor is RAB10.

[0017] The expression promoter is an overexpression virus or overexpression plasmid of RAB10; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg, and hepatitis B core antigen HBcAg.

[0018] A third aspect of the present invention provides the use of a host factor or its encoding gene as a drug target in screening drugs against hepatitis B virus or inhibiting hepatitis B virus antigen, wherein the host factor is RAB10.

[0019] The drug promotes RAB10 expression, thereby inhibiting the expression level of hepatitis B virus antigens in host cells, reducing the expression levels of HBV RNA and HBs protein, and inhibiting HBV DNA replication; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg, and hepatitis B core antigen HBcAg.

[0020] A fourth aspect of the present invention provides a product whose active ingredient is RAB10 protein, said product having any of the following functions:

[0021] (1) Inhibit the expression level of hepatitis B virus antigens in host cells; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg.

[0022] (2) Prevention or treatment of HBV infection;

[0023] (3) Inhibit HBV RNA expression levels;

[0024] (4) Inhibit HBs protein expression levels;

[0025] (5) Inhibit HBV invasion and replication.

[0026] Preferably, the product is a drug.

[0027] In the above technical solution, the nucleotide sequence of the gene encoding RAB10 is shown in SEQ ID NO.50.

[0028] The beneficial effects of this invention are as follows: By studying the mechanism of action of compound D2, a series of novel host factors regulating HBsAg expression were identified using proteomics. Screening these host factors revealed that RAB10 exhibits a strong inhibitory effect on hepatitis B virus surface antigen in cell models, providing the first evidence of the role of the RAB10 gene in inhibiting hepatitis B virus. This invention also found that compound D2 can inhibit HBsAg secretion by upregulating RAB10 expression. In a liver cancer cell model, RAB10 overexpression dose-dependently inhibits HBsAg and HiBiT expression, and knockdown of RAB10 significantly increases HBsAg levels. In a high-pressure hydrodynamic HBV mouse model, RAB10 significantly inhibits HBV DNA replication, HBV RNA transcription, and HBs protein levels, and holds promise for developing novel therapeutic drugs to inhibit hepatitis B virus surface antigen, providing a new strategy for functional cure of HBV. Attached Figure Description

[0029] Figure 1 The study evaluated the antiviral effects of compound D2 in different cell models: (A) IC50 and CC50 of D2 in HepG2.2.15 cells using the CCK8 assay; (B) IC50 and CC50 of D2 in HepAD38 cells using the CCK8 assay; (C) Effect of D2 on HBs expression in HepG2.2.15 and HepAD38 cells using Western blot; (D) Effect of D2 on HBV DNA replication in HepG2.2.15 and HepAD38 cells using Southern blot; (E) Effect of D2 on HBV RNA in HepG2.2.15 and HepAD38 cells using Northern blot; (F) Effect of D2 on HBeAg and HBsAg secretion in HepG2-NTCP cells using ELISA; (G) Effect of D2 on HBs expression in HepG2-NTCP cells using Western blot; (H) Effect of D2 on HBV in HepG2-NTCP cells using Southern blot. The effect of DNA replication; (I) Northern blot detection of the effect of D2 on HBV RNA in HepG2-NTCP cells.

[0030] Figure 2The study demonstrated that compound D2 inhibits HBs RNA production and HBs secretion: (A, B) RT-qPCR detection of the effect of D2 on total RNA and 3.5kb RNA; (C) ELISA and luciferase assay detection of the effect of actinomycin D on HBs transcription; (D) RT-qPCR detection of the effect of D2 on mRNA stability; (E) ELISA and luciferase assay detection of the effect of D2 on the extracellular / intracellular ratio of HBs and HiBiT tags; (F) RT-qPCR detection of the effect of D2 on total RNA and 3.5kb RNA in HepAD38 cells, and ELISA detection of the effect of D2 on intracellular and extracellular HBs levels; (G) RT-qPCR detection of the effect of D2 on total RNA in HepG2 cells transfected with pS-HiBiT, and ELISA and luciferase assay detection of intracellular and extracellular HBs and HiBiT expression levels.

[0031] Figure 3 The following data show that RAB10 upregulation inhibits HBs secretion: (A) Overall differential protein profile and KOG classification map; (B) Volcano map of differential proteins involved in intracellular transport, secretion, and vesicle transport with a fold change greater than 1.5; (C) Effects of candidate gene knockdown or overexpression on HBV1.3 and S-HiBiT expression in HepG2 cells detected by ELISA and luciferase assay; (D) Effects of D2 treatment on the expression of RAB10, VAMP8, VTI1A, and STX6 proteins detected by Western blot. (E, F) Effects of RAB10 overexpression on S-HiBiT expression in HepG2 cells detected by ELISA, luciferase assay and Western blot; (G, H, I) Effects of RAB10 knockdown on HBsAg expression in HepG2.2.15 cells detected by ELISA and Western blot; (J, K) Effects of RAB10 knockdown on D2 inhibition of HBsAg expression in HepG2.2.15 cells detected by ELISA and Western blot.

[0032] Figure 4 The following data demonstrate the inhibitory effect of RAB10 on HBsAg expression in mice: (A) Schematic diagram of the high-pressure hydrodynamic HBV mouse experiment; (B) Peripheral blood ELISA detection of RAB10's inhibition of HBsAg expression in mice; (C) qPCR detection of RAB10's inhibitory effect on HBV DNA in mouse peripheral blood; (D) Gross images of the livers of mice in different treatment groups; (E) qPCR detection of RAB10's inhibitory effect on HBV DNA in mouse liver tissue; (F) RT-qPCR detection of the effect of RAB10 on the expression levels of total HBV RNA and 3.5kb RNA in mouse liver tissue; (G) Western blot detection of the effect of RAB10 on HBsAg expression in mouse liver tissue. Detailed Implementation

[0033] The present invention will be further described below with reference to embodiments, but these embodiments are not intended to limit the scope of the invention.

[0034] Unless otherwise specified, the experimental methods described in the following examples are conventional methods.

[0035] The reagent materials used in the embodiments of this invention are sourced from:

[0036] 2×PrimeSTARMaxPremix: Takara Corporation, Japan;

[0037] Gel extraction kit, plasmid mini-extraction kit, viral genome extraction kit: Magen, China;

[0038] Top 10 E. coli strains; Nano Glo HiBiTLytic Detection System: Promega, USA;

[0039] BsmBI, Tangobuffer, DTT: Thermo Scientific, USA;

[0040] ATP, T7 ligase, T4 ligase buffer, T4 polynucleotide kinase: New England Biolabs, USA;

[0041] Southern blot, Northern blot detection kits, reverse transcription kits, and qPCR kits: Roche, Germany;

[0042] HBV surface antigen and E antigen detection kit: Shanghai Kehua Bioengineering Co., Ltd., China;

[0043] Lipo8000 transfection reagent, β-Actin mouse monoclonal antibody: Beyotime, China;

[0044] Trypsin, DMEM medium, PBS, Opti-MEM, penicillin and streptomycin, fetal bovine serum: Gibco, USA;

[0045] Anti-HBsAg antibody: Abcam, UK;

[0046] Anti-RAB10 antibody, anti-VAMP8 antibody, anti-VTL1A antibody, anti-STX6 antibody: Proteintech, USA;

[0047] Plasmids: pCH9 / 3091 plasmid, stored in our laboratory, is a plasmid containing the HBV 1.1-ploid genome driven by the CMV promoter. pAAV-CMV-EGFP plasmid, also stored in our laboratory.

[0048] Plasmid S-HiBiT (pS-HiBiT): This is a simple and effective HBsAg characterization model successfully constructed by our research team previously. S-HiBiT is formed by fusing an 11-amino acid HiBiT luciferase tag to the C-terminus of HBV surface proteins (HBs) via a G4S linker. Previous studies have shown that the fusion of the HiBiT tag does not affect the biological behavior of HBs, and the secreted S-HiBiT can be quantified using luciferase activity (Nano-Glo HiBiT Lytic detection system). Specific information about the model can be found in Chinese patent application CN202311448773.1, publication number CN 117503772A, invention title: Compounds that inhibit hepatitis B surface antigen and their applications, specifically S-HiBiT in CN202311448773.1.

[0049] Cells: The human liver cancer cell lines HepG2, HepG2.2.15, HepG2-NTCP, and HepAD38 were all preserved by our research group. Among them, HepAD38 cells were constructed by the Seeger laboratory and were kindly donated by Professor Tang Hong of West China Hospital of Sichuan University.

[0050] Compound D2: (1-{4-[3-(4-chlorophenyl)-1,2,4-oxadiazol-5-yl]piperazin-1-yl}-3-(3,4-dimethoxyphenyl)prop-2-en-1-one), CAS No.: 932985-37-0, molecular formula: C 23 H 23 ClN4O4, the chemical structural formula of which is shown below:

[0051]

[0052] C57BL / 6 mice were purchased from the Experimental Animal Center of Chongqing Medical University. The animals were housed in a specific pathogen-free (SPF) clean environment at a temperature maintained at (23±0.5)℃ and a relative humidity maintained at (50±5)%. The animals had free access to food and water during the rearing period. The animal experiments were approved by the university's Animal Experiment Ethics Review Committee.

[0053] The amplification primer sequences used in the embodiments of this invention are shown in Table 1 below:

[0054] Table 1

[0055]

[0056]

[0057]

[0058] The siRNA sequences used for gene knockdown in this invention embodiment are shown in Table 2:

[0059] Table 2

[0060] siRNA name siRNA positive strand sequence (5'-3') SEQ ID NO SISNAP29 GAAGCUAUAAGUACAAGUA SEQ ID NO.43 SICHMP4C CAGAUUGAUGGCACACUUU SEQ ID NO.44 SITOMM40 GCAAGGAGCUGUUUCCCAU SEQ ID NO.45 SIRAB20 CCUCUUUGAAACCUUGUUU SEQ ID NO.46 SIARPP19 AAGCCTGGAGGTTCAGATTTCTTAA SEQ ID NO.47 SIRAB10 GCAAGGGAGCAUGGUAUUA SEQ ID NO.48 SINC UUCUCCGAACGUGUCACGU SEQ ID NO.49

[0061] I. Experimental Methods

[0062] 1. Cell Culture and Transfection Methods: HepG2, HepG2.2.15, HepG2-NTCP, and HepAD38 cell lines were cultured in DMEM medium containing 10% fetal bovine serum and incubated at 37°C with 5% CO2 using standard methods. Plasmids were transfected according to Lipo8000... TM Transfection according to the instructions for the transfection reagent.

[0063] 2. HBV virus collection and concentration: Collect 500 mL of HepAD38 cell culture supernatant, centrifuge at 2000 g for 10 min at 4 °C, filter the supernatant through a 0.45 μm bacterial filter into a new sterile collection bottle, add 10 mL of 30% PEG8000 to every 40 mL of virus supernatant, seal the tube with sealing film, and incubate overnight at 4 °C. The next day, centrifuge at 4000 g for 35 min at 4 °C, discard the supernatant, add 400 μL of opti-MEM to dissolve the precipitate, gently pipette to mix, and aliquot into EP tubes and store at -80 °C.

[0064] 3. HBV infection of HepG2-NTCP cells: HepG2-NTCP cells were pretreated with pretreatment medium (2% DMSO + 2 μg / mL doxycycline). After 24 h, the pretreatment medium was discarded and replaced with infection medium containing HBV virus (4% PEG8000, 2% DMSO, and 2 μg / mL doxycycline), and the cells were gently inverted to mix. After 24 h of infection, the medium was discarded, the cells were washed three times with PBS, and the cells were re-cultured with the pretreatment medium.

[0065] 4. HBsAg and HBeAg detection: The levels of HBsAg and HBeAg in the cell culture supernatant were detected according to the instructions of the enzyme-linked immunosorbent assay kit (Kehua).

[0066] 5. Detection of HiBiT luciferase: According to... HiBiT Lytic Detection System (Promega) Operation Instructions: Detect fluorescence values ​​in cell culture supernatant.

[0067] 6. CCK-8 assay for cytotoxicity: The effect of drug D2 on cell viability was detected according to the CCK-8 kit (Li Ji) instructions.

[0068] 7. Western blot analysis: 72 h after cell transfection, wash twice with PBS. Add 50 μL RIPA lysis buffer and protease inhibitor to each well (for a 24-well plate), lyse on ice for 30 min, extract total cell protein, and determine protein concentration using the BCA method. Denature an equal volume of total cell protein at 100 °C for 10 min. Separate proteins in 12.5% ​​SDS-PAGE, transfer to a membrane at 200 mA on ice for 2 h, block with skim milk for 1 h, then replace with primary antibody, and incubate overnight at 4 °C on a shaker. The next day, wash three times with TBST for 10 min each time. Then add secondary antibody, incubate on a shaker at room temperature for 1 h, wash three times with TBST, and develop with ECL.

[0069] 8. RNA extraction and real-time quantitative PCR: (Taking 12-well plate cells as an example) Wash cells twice with PBS, add 1 mL of Trizol lysis buffer, lyse at room temperature for 10 min, add 200 μL of chloroform, vortex thoroughly, carefully aspirate the supernatant into a new EP tube, add an equal volume of isopropanol, vortex thoroughly, centrifuge at 13000g for 10 min at 4℃, discard the supernatant, add 500 μL of 75% ethanol to wash the precipitate, centrifuge at 13000g for 10 min at 4℃, discard the supernatant and dry the RNA precipitate, dissolve in 20 μL of water, measure the concentration, and use a reverse transcription kit to remove genomic DNA and synthesize cDNA. After the qPCR reaction, export the results and use 2... -ΔΔCt The method calculates the relative expression level.

[0070] 9. Construction of overexpression plasmids (taking RAB10 as an example):

[0071] The human RAB10 gene sequence involved in plasmid construction is (SEQ ID NO.50):

[0072] ATGGCGAAGAAGACGTACGACCTGCTTTTTCAAGCTGCTCCTGATCGGGGATTCCGGAGTGGGGA

[0073] AGACCTGCGTCCTTTTTCGTTTTTCGGATGATGCCTTCAATACTACCTTTATTTCCACCATAGGAAT

[0074] AGACTTCAAGATCAAAACAGTTGAATTACAAGGAAAGAAGATCAAGCTACAGATATGGGATACA

[0075] GCAGGCCAGGAGCGATTTCACACCATCACAACCTCCTACTACAGAGGCGCAATGGGTATCATGCT

[0076] AGTATATGACATCACCAATGGTAAAAGTTTTGAAAACATCAGCAAATGGCTTAGAAACATAGATG

[0077] AGCATGCCAATGAAGATGTGGAAAGAATGTTACTAGGAAACAAGTGTGATATGGACGACAAAAG

[0078] AGTTGTACCTAAAGGAAAAGGAGAACAGATTGCAAGGGAGCATGGTATTAGGTTTTTTGAGACTA

[0079] GTGCAAAAGCAAATATAAACATCGAAAAGGCGTTCCTCACGTTAGCTGAAGATATCCTTCGAAAG

[0080] ACCCCTGTAAAAGAGCCCAACAGTGAAAATGTAGATATCAGCAGTGGAGGAGGCGTGACAGGCTGGAAGAGCAAATGCTGCTGA.

[0081] Using pCH9 / 3091 plasmid as a template, fragment 1 was amplified by FSV40GG2+RG4S, and fragment 2 was amplified by FRAB10+RRAB10 using cDNA as a template. Fragments 1 and 2 were then ligated by restriction enzyme digestion using the Golden Gate cloning method to obtain plasmid RAB10.

[0082] The PCR reaction system consisted of: 10 ng plasmid as template plasmid, 0.4 μL each of primers F (10 μM) and R (10 μM), 10 μL of 2×PrimeSTAR Max Premix, and sterile ultrapure water to a final volume of 20 μL. Reaction conditions were: 98℃ pre-denaturation for 2 min; 35 cycles of 98℃ for 10 s, 55℃ for 5 s, and 72℃ for 30 s. The amplified fragments were recovered using a gel extraction kit, and their concentration was determined.

[0083] The Golden Gate ligation reaction system consisted of: 1 μL Tango buffer, 1 μL DTT, 1 μL ATP, 0.75 μL BsmBI enzyme, 0.25 μL T7 DNA ligase, and the fragments to be ligated. The amount of each fragment added was calculated based on the Kb*20 / Gel recovery concentration (ng / μL), and sterile ultrapure water was added to bring the total volume to 10 μL. Reaction conditions were: 37℃ for 4 min, 20℃ for 4 min, 20 cycles, followed by 65℃ for 20 min. The Golden Gate ligation product was transformed into TOP10 competent bacteria, plated, and single colonies were picked for culture. The bacterial culture was sequenced for identification. Selected colonies with correct sequencing were extracted to obtain the target overexpression plasmid.

[0084] 10. High-pressure hydrodynamic method for establishing a mouse model: 6-8 week old C57BL / 6J mice weighing 17-22g were randomly divided into Vector and RAB10 groups. A PBS solution containing 15μg plasmid was prepared, with a solution volume of 10% of the mouse's body weight. The mouse tail was fixed using a restraint device, and the tail skin was disinfected with a 75% alcohol swab. The solution was injected into the mouse through the tail vein within 5 seconds.

[0085] 11. Extraction of HBV DNA from mouse serum and liver tissue: Extraction was performed according to the instructions of the Virus Genome Extraction Kit (Magen).

[0086] II. Experimental Results

[0087] 1. Evaluate the antiviral effects of compound D2 in different cell models.

[0088] First, we tested the HBs inhibitory effect and cytotoxicity of compound D2 (1-{4-[3-(4-chlorophenyl)-1,2,4-oxadiazol-5-yl]piperazin-1-yl}-3-(3,4-dimethoxyphenyl)prop-2-en-1-one) in HepG2.2.15 and HepAD38 cells. The IC50 in HepG2.2.15 cells was 2.78 μM, and the CC50 was greater than 10 μM; in HepAD38 cells, the IC50 was 1.74 μM, and the CC50 was greater than 10 μM. Figure 1 A and 1B). Western blot results showed that compound D2 dose-dependently inhibited intracellular HBs levels in HepG2.2.15 and HepAD38 cells. Figure 1 C). Southern blotting results showed that compound D2 dose-dependently inhibited HBV replication in both cell lines. Figure 1 D). Northern blotting results showed that compound D2 dose-dependently inhibited HBV transcription in both cell lines. Figure 1E). Subsequently, we further examined the results in HBV-infected HepG2-NTCP cells, and the results showed that compound D2 exhibited dose-dependent inhibition of HBsAg, HBeAg, HBV DNA, and HBV RNA levels. Figure 1 (FI). In summary, these data collectively confirm that compound D2 can inhibit HBsAg levels in different cell models.

[0089] 2. Compound D2 inhibits HBs RNA production and HBs secretion.

[0090] To elucidate the mechanism by which compound D2 inhibits HBsAg, we examined the HBV RNA levels in D2-treated HepG2.2.15, HepAD38, and HepG2-NTCP cells. The results showed that in all three cell models, total HBV RNA and pgRNA were inhibited in a dose-dependent manner. Figure 2 A and Figure 2 B). To investigate whether D2 reduces HBV RNA levels by accelerating RNA degradation or inhibiting RNA synthesis, HepG2 cells transfected with plasmid S-HiBiT were treated with 10 μM actinomycin D (this treatment reduced S-HiBiT reporter system expression to baseline levels, see [link]). Figure 2 C) The HBV RNA decay rate was then measured. Figure 2 As shown in Figure D, D2 treatment did not change the half-life of HBV RNA, indicating that D2 achieves RNA-level inhibition by suppressing RNA synthesis.

[0091] To investigate whether compound D2 affects HBsAg secretion, we simultaneously measured the ratio of secreted HBsAg to intracellular HBsAg (sHBs / iHBs). Using the sHBs / iHBs values ​​of DMSO-treated HepG2.2.15, HepAD38, and S-HiBiT-transfected HepG2 cells as baseline 1, we calculated the sHBs / iHBs ratio after treatment with different concentrations of D2. Figure 2 As shown in Figure E, D2 treatment decreased the sHBs / iHBs ratio in a dose-dependent manner in all three cell models, suggesting that D2 may affect HBsAg secretion. To distinguish the confounding effects of D2 on HBV RNA synthesis and HBsAg secretion, HBV RNA synthesis in HepAD38 cells was completely blocked with 10 μM actinomycin D before the effect of D2 on HBsAg secretion was examined. Figure 2 F indicates that in cells where RNA synthesis has been blocked, D2 treatment did not inhibit the levels of total HBV RNA and pgRNA; however, the combination of D2 and brefidobacterium A (BFA) further reduced the levels of secreted HBs (rather than intracellular HBs). Similar results were obtained in S-HiBiT transfected HepG2 cells. Figure 2G) confirmed that D2 does indeed have the effect of inhibiting HBsAg secretion.

[0092] In summary, D2 reduces HBsAg levels through a dual mechanism of inhibiting HBV RNA production and HBs secretion.

[0093] 3. RAB10 upregulation inhibits HBs secretion.

[0094] To further elucidate the mechanism by which D2 inhibits HBs secretion, we used quantitative mass spectrometry to detect differentially expressed proteins after D2 treatment. Figure 3 The results showed that 494 proteins were upregulated and 636 were downregulated, with 68 proteins enriched in intracellular transport and secretion pathways. We cloned the five most significantly downregulated genes (SNAP29, CHMP4C, TOMM40L, RAB20, ARPP19) and 13 upregulated genes (LRPAP1, CHMP2B, COPZ1, TGFBRAP1, GOSR1, RAB10, SPCS2, ANXA4, SNAP23, VTI1A, STX6, VAMP7, VAMP8), and evaluated their effects on HBsAg secretion in HepG2 cells transfected with pHBV1.3 and S-HiBiT, respectively, through gene knockdown and overexpression experiments.

[0095] like Figure 3 As shown in Figure C, knockdown of the five downregulated genes did not affect HBsAg levels in either cell model; however, overexpression of the four upregulated genes, RAB10, VTI1A, STX6, and VAMP8, inhibited HBsAg levels in both cell models. Further analysis revealed that only RAB10 showed significantly increased expression after D2 treatment. Figure 3 D), consistent with the mass spectrometry results. Therefore, we focused on RAB10 for further research. After co-transfecting HepG2 cells with different doses (0 ng, 100 ng, 250 ng, 500 ng) of RAB10 overexpression plasmid and S-HiBiT, the levels of HBsAg and HiBiT tags were detected. It was found that RAB10 overexpression dose-dependently inhibited the expression of both (…). Figure 3 E, 3F). Conversely, knockdown of RAB10 in HepG2.2.15 cells significantly increased HBsAg levels compared to the siRNA control group, and significantly reduced the inhibition rate of HBsAg. Figure 3 (G, H, I). Next, the inhibitory effect of D2 on HBs was detected in HepG2.2.15 cells pre-transfected with siRAB10, and the results are as follows: Figure 3As shown in J and K, knocking down RAB10 weakened the inhibitory effect of D2 on HBs compared to the control group siRNA. These results indicate that upregulation of RAB10 expression helps D2 exert its inhibitory effect on HBsAg secretion.

[0096] 4. RAB10 inhibits HBsAg expression and HBV DNA and RNA replication in mice.

[0097] Next, we verified the anti-HBV effect of RAB10 in HBV mice using high-pressure hydrodynamic injection. Six- to eight-week-old C57BL / 6J mice, weighing 17-22g, were randomly divided into Vector and RAB10 groups. Using high-pressure hydrodynamic injection, 5μg pAAV-HBV1.2 + 10μg pAAV-Vector / pAAV-RAB10 was injected via the tail vein, with an injection volume (mL) of 10% of the mouse's body weight. Figure 4 As shown in Figure A, blood samples were collected from the orbital fossa on days 3, 5, and 7 after injection to detect HBsAg and HBV DNA levels. Liver tissue was also taken on day 7 to detect HBV DNA, HBV RNA, and HBs protein levels in the liver tissue.

[0098] Similar to the results in in vitro cell models, in the high-pressure hydrodynamic HBV mouse model, RAB10 overexpression significantly reduced the level of HBsAg in peripheral blood. Figure 4 B), and can also inhibit the replication of HBV DNA in peripheral blood. Figure 4 C). The liver tissue obtained from mouse dissection on day 7 showed no significant differences or lesions. Figure 4 D). Compared with the Vector group, RAB10 overexpression significantly reduced the level of HBV DNA replication in liver tissue. Figure 4 E), the expression levels of total HBV RNA and 3.5kb RNA were significantly reduced. Figure 4 F), the expression level of HBs protein in liver tissue was significantly reduced (F). Figure 4 G).

[0099] Based on the above research findings, this invention provides for the first time the role of the RAB10 gene in inhibiting hepatitis B virus, revealing that compound D2 can inhibit HBsAg secretion by upregulating RAB10 expression. In vitro and in vivo studies have for the first time confirmed that RAB10 overexpression can significantly inhibit HBV DNA replication and has a strong inhibitory effect on hepatitis B virus surface antigen, demonstrating superior anti-HBV efficacy. This holds promise for developing novel therapeutic drugs and strategies to inhibit hepatitis B virus surface antigen.

Claims

1. The application of a host factor or its encoding gene in regulating the replication of hepatitis B virus or the expression level of hepatitis B virus antigen in host cells, wherein the host factor is RAB10.

2. The application according to claim 1, characterized in that: The hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg, and hepatitis B core antigen HBcAg. The host factor inhibits the expression level of hepatitis B virus antigen in host cells.

3. The application according to claim 1, characterized in that: The host factor reduces the expression levels of HBV RNA and HBs protein, and inhibits HBV DNA replication.

4. The use of a host factor or its expression promoter in the preparation of a drug for treating hepatitis B virus or inhibiting hepatitis B virus antigen, wherein the host factor is RAB10.

5. The application according to claim 4, characterized in that: The expression promoter is an overexpression virus or overexpression plasmid of RAB10; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg, and hepatitis B core antigen HBcAg.

6. The application of a host factor or its encoding gene as a drug target in screening drugs against hepatitis B virus or inhibiting hepatitis B virus antigen, wherein the host factor is RAB10.

7. The application according to claim 6, characterized in that: The drug promotes RAB10 expression, thereby inhibiting the expression level of hepatitis B virus antigens in host cells, reducing the expression levels of HBV RNA and HBs protein, and inhibiting HBV DNA replication; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg, and hepatitis B core antigen HBcAg.

8. A product whose active ingredient is RAB10 protein, said product having any of the following functions: (1) Inhibit the expression level of hepatitis B virus antigens in host cells; the hepatitis B virus antigens include hepatitis B surface antigen HBsAg, hepatitis B e antigen HBeAg and hepatitis B core antigen HBcAg. (2) Prevention or treatment of HBV infection; (3) Inhibit HBV RNA expression levels; (4) Inhibit HBs protein expression levels; (5) Inhibit HBV invasion and replication.

9. The product according to claim 8, characterized in that: The product is a medicine.

10. The application according to any one of claims 1 to 7 or the product according to claim 8 or 9, characterized in that: The nucleotide sequence of the gene encoding RAB10 is shown in SEQ ID NO.50.

Images