Ligustrum lucidum ait triterpene synthase LlucOSC1 gene and application thereof in preparation of cycloartenol

Abstract

The invention relates to a ligustrum lucidum ait triterpenoid synthase LlucOSC1 gene and application thereof in preparation of cycloartenol, and belongs to the technical field of biology. The nucleotide sequence of the ligustrum lucidum ait triterpene synthase LlucOSC1 gene is as shown in SEQ ID NO.1, and the full length of the sequence is 2283bp; the amino acid sequence of the encoded protein is shown as SEQ ID NO.2, and 760 amino acid residues are encoded. The ligustrum lucidum triterpene synthase LlucOSC1 gene can be used as a biosynthesis regulation gene of cycloartenol, is applied to preparation of cycloartenol, and is remarkable in application prospect and easy to popularize and apply.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to the Ligustrum lucidum triterpenoid synthase LlucOSC1 gene and its application in the preparation of cycloatinol. Background Technology

[0002] Cycloartenol is a triterpenoid compound, a precursor to phytosterols, and a class of naturally occurring compounds widely found in plants. It not only lowers cholesterol and prevents cardiovascular disease but also possesses pharmacological effects such as anti-tumor activity, anti-inflammation, and blood sugar reduction, making it significant for human health. Cycloartenol forms the backbone of sterol compounds and is a key intermediate in the formation of all sterol compounds.

[0003] In plant secondary metabolic pathways, the biosynthesis of triterpenoids and sterols both use 2,3-squalene oxide as a common precursor, which is cyclized by oxidosqualene cyclases (OSCs) to form diverse skeletons. OSCs can catalyze the formation of various triterpenoid skeletons from 2,3-squalene oxide, including lanosterol, cucurbitadienol, cycloartenol, dammarenediol, α-amyrin, β-amyrin, and lupeol. After skeleton construction, under the action of modifying enzymes such as cytochrome P450 monooxygenase (CYP), glycosyltransferase (UGT), acyltransferase (ACT), and oxygen methyltransferase (OMT), a series of modification reactions such as hydroxylation, glycosylation, acylation, and oxygen methylation are carried out, ultimately forming structurally complex and functionally diverse triterpenoid compounds.

[0004] Triterpenoids are the main medicinal components of Ligustrum lucidum, possessing immunomodulatory, cardiotonic, hypoglycemic, hypolipidemic, antioxidant, anti-aging, anti-inflammatory, and anti-tumor effects. Ligustrum lucidum has high medicinal value and has attracted widespread attention. With the rapid development of synthetic biology, heterologous synthesis of plant natural products is becoming an alternative method for the large-scale production of high-value triterpenoids. However, current research on Ligustrum lucidum mainly focuses on the extraction, separation, and pharmacological activity identification of compounds, while the molecular mechanisms of their synthesis remain unclear. To obtain triterpenoids from Ligustrum lucidum through biosynthesis, it is essential to elucidate their biosynthetic pathways. Cycloatinol, as a key intermediate in the formation of triterpenoids, makes the identification of the enzymes involved in its biosynthesis crucial. However, to date, the functions of the enzymes involved in the formation of triterpenoids from Ligustrum lucidum have not been verified, hindering the progress of triterpenoid biosynthesis research. Therefore, overcoming the shortcomings of existing technologies is a pressing issue in the field of biotechnology. Summary of the Invention

[0005] The purpose of this invention is to overcome the shortcomings of existing technologies and provide a *Ligustrum lucidum* triterpenoid synthase Lluc OSC1 gene, which can serve as a regulatory gene for the formation of cyclic atenol in the biosynthesis of triterpenoid compounds and its applications.

[0006] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0007] The first aspect of the present invention provides the privet triterpenoid synthase LlucOSC1 gene, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0008] The second aspect of the present invention provides a protein encoded by the above-mentioned privet triterpenoid synthase LlucOSC1 gene, the amino acid sequence of which is shown in SEQ ID NO.2.

[0009] A third aspect of the present invention provides a recombinant plasmid containing the above-mentioned Ligustrum triterpenoid synthase LlucOSC1 gene.

[0010] Furthermore, preferably, the privet triterpenoid synthase LlucOSC1 gene is homologously recombined with the pYES2 vector to obtain the pYES2-LlucOSC1 recombinant plasmid.

[0011] A fourth aspect of the present invention provides a transgenic engineered bacterium containing the above-mentioned recombinant plasmid, or wherein the genome of the genetically engineered bacterium is integrated with the exogenous above-mentioned Ligustrum lucidum triterpenoid synthase LlucOSC1 gene.

[0012] Furthermore, preferably, the genetically engineered bacteria is the Saccharomyces cerevisiae GIL77 strain.

[0013] The fifth aspect of this invention provides the application of the above-mentioned Ligustrum triterpenoid synthase LlucOSC1 gene in the preparation of cycloatinol.

[0014] Furthermore, preferably, using 2,3-squalene oxide as a substrate, under the catalysis of privet triterpenoid synthase LlucOSC1 encoded by the privet triterpenoid synthase LlucOSC1 gene, 2,3-squalene oxide undergoes carbo-ion rearrangement cyclization to generate cycloartenol.

[0015] The nucleotide sequence of the privet triterpenoid synthase LlucOSC1 gene of this invention is shown in SEQ ID NO.1, with a full length of 2283 bp. The above-mentioned privet triterpenoid synthase LlucOSC1 gene encodes a protein, the amino acid sequence of which is shown in SEQ ID NO.2, encoding 760 amino acid residues.

[0016] The *Ligustrum lucidum* triterpenoid synthase LlucOSC1 gene described in this invention was cloned in vitro by PCR from *Ligustrum lucidum* plants using transcriptome sequencing and bioinformatics techniques. The amplification primers for the *Ligustrum lucidum* triterpenoid synthase LlucOSC1 gene are shown below:

[0017] 5'F: atgtggaggctgaaaattgcag;

[0018] 3'R:tcatctacagttcttattcatgagaacccg.

[0019] Furthermore, when performing homologous recombination with the pYES2 vector, the LlucOSC1 gene requires amplification and recovery using primers with homologous arms. The primers with homologous arms are as follows:

[0020] Upstream homologous arm primer:

[0021] 5'F: ctagcagctgtaatacgactcactatagggaatattatgtggaggctgaaaattgcag;

[0022] Downstream homologous arm primer:

[0023] 3'R: gcgtgacataactaattacatgatgcggctcatctacagttcttattcatgagaaccc.

[0024] The LlucOSC1 gene, a triterpenoid synthase isolated and identified from Ligustrum lucidum in this invention, can serve as an important marker gene for molecular-assisted breeding of Ligustrum lucidum, and can also serve as a candidate gene for the production of cycloartenol and sterol compounds in yeast chassis cell construction.

[0025] Compared with the prior art, the beneficial effects of this invention are as follows:

[0026] (1) The biosynthetic regulatory gene of cycloatinol in this invention, namely the triterpenoid synthase LlucOSC1 gene, was first identified and successfully verified in Ligustrum lucidum, opening up a new method for the biosynthesis of cycloatinol. This invention obtains the target product by heterologous expression of the protein in Saccharomyces cerevisiae and catalysis, adopting in vivo biosynthesis for targeted production, which has the advantages of high yield.

[0027] (2) This invention provides a recombinant plasmid containing the LlucOSC1 gene of the triterpenoid synthase, and a genetically engineered bacterium, which lays the foundation for the large-scale synthesis of cycloatinol through bioengineering methods and further for the research on the construction of cell factories that produce cycloatinol.

[0028] (3) The heterologous biosynthesis of cycloatinol is highly controllable, which can reduce the need for raw material cultivation, produce high product yields, and facilitate the subsequent separation and purification of cycloatinol; it can also reduce the difficulties of chemical synthesis and the complexity of the synthesis pathway. The cycloatinol synthase LlucOSC1 gene, as a key gene for cycloatinol biosynthesis, can also be used for breeding research of plants rich in cycloatinol, such as privet. Attached Figure Description

[0029] Figure 1 This is a schematic diagram of the synthetic route derived from cycloatinol;

[0030] Figure 2 A schematic diagram illustrating the construction of the recombinant expression plasmid pYES2-LlucOSC1;

[0031] Figure 3 The images show the GC-MS results of the LlucOSC1 fermentation product derivatization. A represents the TIC (Transient Indicator) results of the GC-MS analysis of the LlucOSC1 fermentation product derivatization, where Standard represents cycloartenol, LlucOSC1 represents the derivatized sample of the pYES2-LlucOSC1 true positive yeast strain fermentation product, and Control represents the derivatized sample of the pYES2 true positive yeast strain fermentation product (i.e., negative control). B represents the EIC (Extractable Indicator) mass spectrometry results of the LlucOSC1 fermentation product derivatization, where cycloartenol standard represents the characteristic peak ion map of the cycloartenol standard, and LlucOSC1Product represents the characteristic peak ion map of cycloartenol in the pYES2-LlucOSC1 true positive yeast strain fermentation product derivatization sample (theoretical molecular weight 426.72). Detailed Implementation

[0032] The present invention will now be described in further detail with reference to the embodiments.

[0033] Those skilled in the art will understand that the following embodiments are for illustrative purposes only and should not be construed as limiting the scope of the invention. Where specific techniques or conditions are not specified in the embodiments, they are performed in accordance with the techniques or conditions described in the literature in the field or according to the product instructions. Materials or equipment whose manufacturers are not specified are all conventional products that can be obtained by purchase.

[0034] LB liquid medium: 5g yeast extract, 10g tryptone, 10g NaCl, adjust pH to 7.2, bring volume to 1L with deionized water, and sterilize at 121℃ for 20min.

[0035] LB solid medium (LB solid plates): Add 1.5% agar powder to LB liquid medium, adjust the pH to 7.2, bring the volume to 1L with deionized water, and sterilize at 121℃ for 20min.

[0036] Ergosterol and Tween 80 mixed stock solution: Weigh 400mg of ergosterol and dissolve it in 100mL of anhydrous ethanol. Sonicate until completely dissolved, then mix with an equal volume of Tween 80 to prepare 200mL. Store at 4℃ for later use.

[0037] Heme chloride stock solution: Weigh 13 mg of heme chloride, dissolve it in 0.5 mL of 0.1 M NaOH, then add an equal volume of anhydrous ethanol and mix well. Prepare and use immediately.

[0038] YPD liquid medium: 10g yeast extract and 20g peptone were diluted to 950mL with deionized water and sterilized at 121℃ for 20min; a 40% glucose solution was prepared and sterilized at 115℃ for 20min. 50mL of the 40% glucose solution was added to 950mL of the above medium, along with 1mL of heme chloride stock solution and 10mL of a mixed stock solution of ergosterol and Tween 80.

[0039] YPD solid medium (YPD plate): Add 2.0% agar powder to the YPD liquid medium.

[0040] SC-Ura-deficient liquid culture medium: 6.67g yeast basic nitrogen source (containing ammonium sulfate), a mixture of Ura-deficient amino acids (components: methionine 20mg, arginine 20mg, lysine 30mg, isoleucine 30mg, tyrosine 30mg, phenylalanine 50mg, adenine 50mg, aspartic acid 100mg, glutamic acid 100mg, histidine 100mg, tryptophan 100mg, leucine 100mg, threonine 150mg, serine 400mg, valine 150mg), diluted to 950mL with deionized water, adjusted pH to 5.6, and sterilized at 121℃ for 20min. Add 50mL of 40% glucose solution, 1mL of heme chloride stock solution, and 10mL of a mixed stock solution of ergosterol and Tween 80.

[0041] SC-Ura defective solid medium (SC-Ura defective plate): Add 2% agar powder to SC-Ura defective liquid medium, adjust the pH to 6.5, and sterilize at 121℃ for 20 min.

[0042] 50% PEG4000: Accurately weigh 50g of PEG4000, dilute to 100mL with deionized water, sterilize at 115℃ for 20min, and store at 4℃ for later use.

[0043] 1M LiAC: Weigh 6.60g of lithium acetate, adjust the pH to 7.5 with glacial acetic acid, bring the volume to 100mL with deionized water, sterilize at 115℃ for 20min, and store at 4℃ for later use.

[0044] 0.1M phosphate buffer: Take 26.2 g of potassium dihydrogen phosphate and 70.18 g of dipotassium hydrogen phosphate, add deionized water to a final volume of 1 L, and dissolve by sonication.

[0045] 20% KOH / 50% anhydrous ethanol solution: Take 200g of potassium hydroxide, dissolve it in about 300mL of deionized water, add 500mL of anhydrous ethanol, and then dilute to 1L with deionized water. Mix well and use immediately.

[0046] Example 1

[0047] Based on the basic functional annotation information of the Unigene in the privet transcriptome, candidate OSC genes were screened from the sequencing annotation results. Simultaneously, using oxidosqualene cyclases (OSCs) identified in plants as reference sequences, sequence-local BLAST analysis was performed. The screening results were then analyzed and compiled, ultimately identifying three OSC genes, named LlucOSC1, LlucOSC2, and LlucOSC3 as candidate genes. LlucOSC1 was functionally annotated as cyclic atrinol synthase (CAS). Finally, based on the Unigene ID number, the Unigene nucleotide sequence was extracted from the fasta file for further analysis. Following a series of procedures including in vitro cloning, homologous recombination, in vivo yeast induction expression, incubation reaction, yeast metabolite extraction, and GC-MS detection, the LlucOSC1 gene was finally identified as capable of cyclizing the endogenous substrate 2,3-oxidosqualene to generate cyclic atrinol (CAS). Figure 1 The steps for each stage of the synthesis of cycloatinol are as follows (all reagents, raw materials, instruments, and equipment used in the following procedures are commercially available):

[0048] 1. Source of LlucOSC1 gene DNA sequence and construction of target gene expression vector

[0049] RNA was extracted from leaves, stems and fruits of Ligustrum lucidum. The TIANGEN polysaccharide and polyphenol plant total extraction kit was used for Ligustrum lucidum RNA extraction, and the TIANGEN reverse transcription kit was used to reverse transcribe the Ligustrum lucidum RNA into cDNA.

[0050] (1) The full-length LucoSC1 gene was amplified by PCR using specific primers. The reaction system was prepared according to the instructions of Phanta-Max Super-Fidelity DNA Polymerase.

[0051] The primers used in the PCR reaction are:

[0052] 5'F: atgtggaggctgaaaattgcag (SEQ ID No. 3);

[0053] 3'R: tcatctacagttcttattcatgagaacccg (SEQ ID No. 4);

[0054] The PCR reaction system is shown in Table 1. The PCR reaction program is as follows: 95℃ pre-denaturation for 180s; 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 120s, for a total of 35 cycles; 72℃ further extension for 300s, 4℃ ± ∞.

[0055] Table 1

[0056] reagents Volume (μL) Phanta 25 Forward primer (10 μM) 1.5 Reverse primer (10 μM) 1.5 Privet cDNA (200 ng / uL) 2.0 <![CDATA[ddH2O]]> 20 Overall system 50.0

[0057] Note: The reaction system was prepared according to the instructions for Phanta-Max Super-Fidelity DNA Polymerase. Phanta is a reagent in the Phanta-Max Super-Fidelity DNA Polymerase for high-fidelity PCR.

[0058] (2) Then, using SnapGene software, specific primers for the full-length sequence of the gene coding region were screened through data analysis, and primers with pYES2 homologous arms were designed: upstream homologous arm primer Prime F: cta gcagctgtaatacgactcactatagggaatattatgtggaggctgaaaattgcag (SEQ ID No. 5); downstream homologous arm primer Prime R: gcgtgacataactaattacatgatgcggctcatctacagttcttattcatgagaaccc (SEQ ID No. 6), so that the target gene and the vector can recombine homologously.

[0059] (3) The enzymes used to amplify DNA fragments were all high-fidelity enzymes (2×Phanta Max Master Mix), and the reaction system for in vitro cloning in the PCR instrument is shown in Table 2.

[0060] Table 2

[0061] Components Amount added (μL) 2×Phanta Max Master Mix 25 10mM Prime F 1.5 10mM Prime R 1.5 Template(amplification product of step (1)) 2 <![CDATA[ddH2O]]> To 50μL

[0062] After mixing the above system, proceed with the standard procedure: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 2 min, 35 cycles; 72℃ for 5 min, 10℃∞. After the reaction, the results were detected by 1% agarose gel electrophoresis. The target band was recovered using a standard agarose gel DNA recovery kit to obtain the target gene LlucOSC1 with the pYES2 homologous arm.

[0063] (4) The pYES2 plasmid was digested with the restriction endonuclease BamHI to obtain the linearized vector pYES2. The digestion was then checked by agarose gel electrophoresis; a single band indicated successful digestion. The linearized vector was recovered using the DNA gel recovery kit from Jereh Biotechnology Co., Ltd. The kit steps were followed sequentially, and the concentration was determined after recovery. The vector was then stored at -20℃ for later use. The digestion system is shown in Table 3, and the digestion conditions were: 37℃ for 1 h, 65℃ for 15 min, and 10℃ ± ∞.

[0064] Table 3

[0065]

[0066]

[0067] (5) Use The Basic Seamless Cloning and Assembly Kit (Beijing TransGen Biotechnology) recombines the linearized vector pYES2 with the target gene LlucOSC1 containing a homologous arm of pYES2 to obtain the recombinant plasmid pYES2-LlucOSC1. The recombination system is as follows:

[0068] 0.7 μL linearized vector pYES2, 2.3 μL target gene fragment (target gene LlucOSC1 with pYES2 homologous arm), 3 μL 2×SDMM (homologous recombinase).

[0069] The recombination reaction program was 50℃ for 20 min, then 10℃ ± ∞.

[0070] (6) The recombinant plasmid pYES2-LlucOSC1 was transformed into DH5α competent cells and cultured overnight at 37°C on LB agar plates containing 100 mg / L lambda. The specific method is as follows:

[0071] (6.1) Take 10 μL of recombinant plasmid pYES2-LlucOSC1 and add it to 50 μL of competent E. coli cells and mix thoroughly (carefully pipette). Place the resulting mixture on an ice box (to keep the E. coli competent cells so that the plasmid can easily enter the E. coli) for 30 minutes.

[0072] (6.2) After heat shock at 42℃ for 90s, remove and place in an ice bath for 2-5 minutes.

[0073] (6.3) Add 450 μL of LB liquid culture medium and place it in a shaker at 37°C and 220 r / min for 1 h.

[0074] (6.4) After 1 hour, take 100 μL of the bacterial culture obtained by (6.3) shaking culture and spread it on LB solid medium containing 100 mg / L Amp. Incubate at 37°C for 8-12 hours.

[0075] (6.5) When a single colony is observed to grow, perform pick-and-shake inoculation (add 500 μL of LB liquid medium containing 100 mg / L Amp to a 2 mL centrifuge tube, and shake at 220 r / min on a shaker at 37°C to obtain the bacterial suspension. Pick-and-shake refers to taking the plate with a single colony (monoclonal colony) to a sterile operating table, using a special picker to select a single colony and transfer it to a centrifuge tube containing LB liquid medium containing 100 mg / L Amp, sealing the tube, and then shaking it on a shaker until the bacterial suspension becomes turbid.

[0076] (7) Select single-clone colony suspensions for PCR. The primers used for PCR are shown in Table 4, the reaction system is shown in Table 5, and the reaction program is as follows: 95℃ pre-denaturation for 300s; 95℃ denaturation for 15s, 58℃ annealing for 15s, 72℃ extension for 100s, for a total of 35 cycles; 72℃ extension for 300s, 4℃ +∞.

[0077] Table 4

[0078]

[0079]

[0080] Table 5

[0081] reagents Volume (μL) 2×FastTaq Premix 12.5 Detection of PY-F (10mM) 1.0 Detection of PY-R (10mM) 1.0 Monoclonal colony culture 2.0 <![CDATA[ddH2O]]> 8.5 Overall system 25.0

[0082] After the PCR reaction was completed, 5 μL of the PCR product was subjected to agarose gel electrophoresis at 185 V, 180 mA for 20 min. The gel was then removed and observed in a gel imaging system. The bands were as expected, indicating positive sequencing results. This was used to verify the authenticity of the target gene transfer into E. coli cells.

[0083] (8) Preparation of competent cells of GIL77 yeast strain (lanosterol synthase-deficient type)

[0084] First, spread GIL77 glycerol bacteria onto YPD plates and incubate upside down in a 30℃ incubator for 3 days. After identifying single colonies, inoculate them into 2 mL of YPD liquid medium and incubate at 30℃ and 220 rpm for 2 days. Then, transfer 1 mL of the culture to 50 mL of YPD liquid medium and incubate at 30℃ and 220 rpm until the OD value reaches 0.8–0.9. Separate the cells using 50 mL centrifuge tubes and collect the cells by centrifugation at 8000 rpm for 5 min. Wash twice with 25 mL of sterile water, resuspend the washed cells in 1 mL of ddH2O, mix well, and aliquot into 100 μL tubes for transformation.

[0085] (9) GIL77 yeast conversion

[0086] GIL77 competent cells were centrifuged for 20 seconds using a handheld centrifuge, the supernatant was discarded, and the transformation system was added: 240 μL of 50% EG4000, 36 μL of 1.0 M LiAC (lithium acetate), and 10 μL of 2.0 μg / μL SSDNA (salmon sperm). After mixing the system, 74 μL of recombinant plasmid pYES2-LlucOSC1 (400 ng plasmid mass) and ddH2O were added. The same procedure was performed, but the recombinant plasmid pYES2-LlucOSC1 was replaced with the empty pYES2 plasmid as a negative control. After mixing all the systems thoroughly, the system was incubated at 30 °C for 20 min, and then heat-shocked at 42 °C for 40 min. 200 μL of the mixture was then plated on SC-Ura defective plates and incubated upside down in a 30 °C incubator for 2–4 days. Single clones were then selected for verification.

[0087] (10) Screening of positive strain clones

[0088] Add 20 μL of ddH2O to each of the 8-tube PCR series. Pick 8 monoclonal strains cultured above and place them into each tube. Incubate the PCR tube at 95℃ for 10 min to break down the cell walls and obtain monoclonal templates dissolved in water. Add the following reaction mixture to the PCR tube: 12.5 μL Super 2x Mix, 10.5 μL sterile water, 0.5 μL universal forward primer (10 mM), 0.5 μL universal reverse primer (10 mM), and 1 μL monoclonal template dissolved in water. The universal primers for detection were designed using software (SnapGene 3.2.1). The universal upstream primer for detection is cctctatactttaacgtcaaggagaaaaaac (SEQ ID No. 9), and the universal downstream primer is cttttcggttagagcggatgtg (SEQ ID No. 10). The PCR amplification cycle parameters were: 95℃ for 3 min; 95℃ for 15 s, 58℃ for 15 s, 72℃ for 2 min, 35 cycles; 72℃ for 5 min, 10℃ at ∞.

[0089] Note: When screening positive strain clones, there are two types of single clones: one is obtained by transforming GIL77 yeast with the recombinant plasmid pYES2-LlucOSC1; the other is obtained by transforming GIL77 yeast with the empty vector pYES2. Both are subjected to the same test for easy comparison.

[0090] (11) Detection and sequencing

[0091] Take 1.0 μL of loading buffer and add 5 μL of the PCR product from step (10), mix well, and detect the amplification results by 1% agarose gel electrophoresis. Inoculate the pYES2-Lluc OSC1 and pYES2 strains that meet the target fragment size into 2 mL of SC-Ura-deficient liquid medium, and culture for 2 days at 30℃ and 220 rpm. Take 100 μL of the bacterial solution and send it to a sequencing company for sequencing. If the sequencing confirms that there are no errors, it is a true positive yeast strain. The true positive yeast strain is then preserved. The preservation method is to add 50% glycerol and the bacterial solution that has been shaken at 30℃ and 220 rpm for two days to the preservation tube at a 1:1 ratio, mix thoroughly, and store in a -80℃ ultra-low temperature freezer for later use.

[0092] (12) Yeast-induced expression and detection

[0093] 500 μL of the pYES2-LlucOSC1 and pYES2 true positive yeast strains obtained in step (11) with normal growth were selected and cultured in 50 mL of SC-Ura-deficient liquid medium at 30 °C with shaking at 220 rpm. After 2 days of culture, the cells were collected by centrifugation at 8000 rpm for 5 min, the supernatant was removed, and the cells were washed twice with ddH2O. The cells were then transferred to 50 mL of SC-Ura-deficient liquid medium with galactose added (i.e., the 40% glucose in the SC-Ura-deficient liquid medium was replaced with 40% galactose). The cells were induced at 30 °C for 48 h. The cells were collected by centrifugation at 8000 rpm for 5 min and 5 mL of SC-Ura-deficient liquid medium was added. 0.1M potassium phosphate buffer (with 2% glucose and 5 μL heme chloride stock solution added) was incubated at 30℃ for 12 h. Then, 5 ml of saponification reagent (20% KOH / 50% EtOH) was added, and the mixture was boiled in water for 5 min. After cooling, the mixture was extracted three times with the same volume of petroleum ether. The organic phase was concentrated to recover the solvent, yielding an extract. The extract was derivatized with 200 μL of cyanotrimethylsilane at 65℃ for 30 min to obtain the derivatized sample, which was then used for GC-MS analysis.

[0094] The GC-MS detection conditions are as follows:

[0095] The derivatized sample was transferred to a glass insert in a glass autosampler vial. Fermentation products were analyzed using an Agilent Technologies 7890A / 5975CGC-MS system. Gas chromatography conditions: Agilent 19091S-433 capillary column (HP-5MS 5% Phenyl Methyl Silox, 30m × 250μm × 0.25μm); injection port temperature 250℃; carrier gas: high-purity helium; flow rate: 1.2mL / min; injection volume: 1μL; split: 1:10. Mass spectrometry conditions: electron impact (E) spectroscopy; ion source: ion source temperature 230℃; quadrupole temperature 150℃; electron energy 70eV; interface temperature 250℃; mass scan range 30-500 amu; search library: NIST version 2.3 standard library. Temperature rise program: 80℃ for 2 minutes, rise to 319℃ at 20℃ / min, hold for 20 minutes, total running time is 35 minutes.

[0096] Gas chromatography-mass spectrometry (GC-MS) analysis of the fermentation products showed that, compared with the pYES2 empty negative control, the pYES2-LlucOSC1 positive strain exhibited a characteristic chromatographic peak at 21.25 min, and the retention time of this peak was completely consistent with that of the cycloatinol standard (3A). Further analysis of its mass spectrometric characteristics revealed that the ion fragmentation pattern of this product was highly consistent with the mass spectrum of the cycloatinol standard. Figure 3 B) indicates that the protein encoded by LlucOSC1 can catalyze the formation of cycloatinol from 2,3-oxidized squalene.

[0097] The foregoing has shown and described the basic principles, main features, and advantages of the present invention. Those skilled in the art should understand that the present invention is not limited to the above embodiments. The embodiments and descriptions in the specification are merely illustrative of the principles of the invention. Various changes and modifications can be made to the invention without departing from its spirit and scope, and all such changes and modifications fall within the scope of the present invention as claimed. The scope of protection of this invention is defined by the appended claims and their equivalents.

Claims

1. The privet triterpenoid synthase LlucOSC1 gene, characterized in that, The nucleotide sequence of the privet triterpenoid synthase LlucOSC1 gene is shown in SEQ ID NO.

1.

2. The protein encoded by the LlucOSC1 gene, a triterpenoid synthase according to claim 1, is characterized in that... The amino acid sequence of the encoded protein is shown in SEQ ID NO.

2.

3. A recombinant plasmid containing the LlucOSC1 gene of privet triterpenoid synthase as described in claim 1.

4. The recombinant plasmid of the privet triterpenoid synthase LlucOSC1 gene according to claim 3, characterized in that, The LlucOSC1 gene of privet triterpenoid synthase was homologously recombined with the pYES2 vector to obtain the pYES2-LlucOSC1 recombinant plasmid.

5. A transgenic engineered bacterium containing the recombinant plasmid of claim 3, or wherein the genome of the transgenic engineered bacterium is integrated with an exogenous LlucOSC1 gene of privet triterpenoid synthase of claim 1.

6. The genetically engineered bacteria according to claim 5, characterized in that, The genetically engineered bacteria is the Saccharomyces cerevisiae strain GIL77.

7. The use of the Ligustrum lucidum triterpenoid synthase LlucOSC1 gene as described in claim 1 in the preparation of cycloatinol.

8. The application of the Ligustrum lucidum triterpenoid synthase LlucOSC1 gene according to claim 7 in the preparation of cycloatinol, characterized in that: Using 2,3-oxidized squalene as a substrate, under the catalysis of the privet triterpenoid synthase LlucOSC1 encoded by the privet triterpenoid synthase gene, 2,3-oxidized squalene undergoes carbo-ion rearrangement cyclization to generate cycloartenol.

Images