Regulator of chromosome 9 open reading frame 72 gene expression and application thereof

Abstract

The present disclosure provides compositions and methods for modulating C9orf72 gene transcription in patients in need thereof, including patients suffering from C9orf72 related diseases, such as amyotrophic lateral sclerosis (ALS) and frontotemporal dementia (FTD).

Description

[0001] This application is a divisional application of Chinese Patent Application No. 202080031118.4, filed on April 23, 2020, which claims priority to U.S. Patent Application No. 62 / 837,523, filed on April 23, 2019, and U.S. Provisional Patent Application No. 61 / 964,844, filed on January 23, 2020, the disclosures of which are incorporated herein by reference in their entirety. The disclosure of these priority applications is incorporated herein by reference.

[0002] Cross Reference to Related Applications

[0003] This application claims priority to U.S. Patent Application No. 62 / 837,523, filed on April 23, 2019, and U.S. Provisional Patent Application No. 61 / 964,844, filed on January 23, 2020. The disclosures of these priority applications are incorporated herein by reference.

[0004] SEQUENCE LISTING

[0005] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII format was created on April 21, 2020, is named 025297_WO017_SL.txt and is 19,880 bytes in size. BACKGROUND

[0006] The Chromosome 9 Open Reading Frame 72 (C9orf72) gene encodes a protein that is found in abundance in neurons. The C9orf72 protein is believed to play an important role in endosomal trafficking. Although the function of the C9orf72 protein is not fully understood, recent data suggests that it plays a role in membrane trafficking along the endolysosomal pathway by regulating the function of Rab proteins.

[0007] The C9orf72 gene contains a six-nucleotide segment (G4C2; SEQ ID NO: 1) in intron 1. This segment can be repeated in tandem up to 30 times without discernible biological effect. However, repeats beyond 30 times (a phenomenon known as hexanucleotide expansion) cause C9orf72-associated disorders (Renton et al., Neuron (2011) 72:257-68; Douglas, Non-coding RNA Res. (2018) 3:178-87). This expansion creates a somatic dominant phenotype, and patients are typically heterozygous for the expanded allele. The hexanucleotide expansion appears to cause the formation of intracellular RNA foci, leading to sequestration of RNA-binding proteins and perturbation of RNA metabolism. Via non-AUG-dependent translation, the hexanucleotide expansion also appears to cause the production of non-native proteins containing dipeptide repeat (DPR) sequences from all six frames in both the sense and antisense directions (Freibaum and Taylor, Front Mol Neurosci. (2017) 10:35; Douglas, supra). These proteins tend to aggregate (Gendron et al., Acta Neuropathol. (2013) 126:829). DPRs have been reported as inclusions in post-mortem brain material of patients with C9orf72-associated diseases (Riemslagh et al., Acta Neuropathol Commun. (2019) 7:39).

[0008] C9orf72-associated disorders include amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD). ALS is characterized by progressive muscle weakness, loss of muscle mass, and gradual decline in the ability to move, speak, swallow, and / or breathe. The annual incidence of ALS is 1 to 3 cases per 100,000 people, and it is the most common adult-onset motor neuron disorder. For most patients, the disease is fatal within three to five years of the first symptom. Mutations in the C9orf72 gene are responsible for about 30% to 40% of familial ALS and 5% to 10% of sporadic ALS in the United States and Europe. Some C9orf72-associated ALS patients also suffer from a condition known as C9 frontotemporal dementia (FTD) or C9FTD, which is a neurodegenerative disease affecting personality, behavior, and language (Benussi et al., Front Aging Neurosci. (2015) 7:171). Subjects suffering from both conditions are diagnosed with ALS-FTD.

[0009] There is no effective treatment for C9orf72-associated disorders. Thus, there is an urgent need to develop effective therapies for these disorders. SUMMARY

[0010] This disclosure provides zinc finger protein-based human C9orf72 transcriptional regulators and their use in the treatment of C9orf72-related conditions. In one aspect, the disclosure provides a fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intronic segment (intron 1a) between exons 1a and 1b of a mutant allele of the human C9orf72 gene. The mutant allele has an amplified G4C2 (SEQ ID NO:1) repeat sequence region in intron 1a, and the fusion protein targets this amplified repeat sequence region. The mutant allele may contain more than 30 tandem G4C2 repeat sequences (e.g., more than 100, 200, 300, 400, 500, 600, 700, 800, 900, or 1000 repeat sequences). Wild-type alleles may contain no more than 30 such repeating sequences (e.g., no more than 25, 20, 15, 10, or 5 repeating sequences).

[0011] In some implementations, the fusion protein inhibits the transcription of RNA transcripts (e.g., mRNA) containing repetitive sequences from mutant alleles, but does not inhibit the transcription of wild-type RNA transcripts (e.g., mRNA) from genes.

[0012] In some embodiments, the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises one to three six-nucleotide tandem repeats of GGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5), or CGGGGC (SEQ ID NO:6). In some embodiments, the fusion protein represses sense transcription of the self-mutant allele in human cells. In a particular embodiment, the fusion protein represses sense transcription from the C9orf721a promoter but does not repress sense transcription from the C9orf721b promoter.

[0013] In some embodiments, the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of the hexanucleotide sequence GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11), or CGGCCC (SEQ ID NO:12). In some embodiments, the fusion protein inhibits antisense transcription of the self-mutant allele in human cells.

[0014] In some implementations, the fusion protein inhibits both sense and antisense transcription of the self-mutant C9orf72 allele in human cells. In some implementations, the fusion protein preferentially inhibits the mutant C9orf72 allele compared to the wild-type C9orf72 allele.

[0015] In other embodiments, the fusion protein represses the positive and / or negative transcription of the mutant allele by at least about 30%, 40%, 75%, 90%, or 95%.

[0016] In some embodiments, the fusion protein has one or more ZFP domains, each optionally containing six zinc fingers; binds to the target sequence shown in Table 1; and / or contains six zinc fingers (arranged F1 to F6), each zinc finger containing the DNA-binding (recognition) helical sequence shown in a single column of Table 1, optionally containing one or more mutations to residues outside the recognition helical region as indicated in Table 1. In other embodiments, the fusion protein binds to the target sequence and contains zinc fingers corresponding to SBS IDs shown in Table 1, said zinc fingers containing the DNA-binding (recognition) helical sequence of that SBS ID shown in a single column of Table 1, wherein the SBS ID is 78021, 75114, 75115, 74969, 79895, 79898, 74986, 79899, ​​79901, 79902, 79904, 79916, 75027, or 79921.

[0017] In some embodiments, the fusion protein has one or more transcription repressor domains, each optionally containing a KRAB domain amino acid sequence from human KOX1, as further described below. In a particular embodiment, the ZFP domain is linked to the transcription repressor domain via a peptide linker.

[0018] In another aspect, this disclosure provides nucleic acid constructs comprising coding sequences of one or more of the fusion proteins described herein, wherein the coding sequences are optionally operably linked to transcriptional regulatory elements. In some embodiments, the transcriptional regulatory element comprises a mammalian promoter that is constitutively active or inducible in brain cells, and wherein the promoter is optionally a human synaptic protein I promoter. In some embodiments, the construct is a recombinant adeno-associated virus (“AAV” or “rAAV”) construct. rAAV constructs comprising a recombinant AAV construct and a capsid of serotypes 1 to 10 (e.g., AAV2, AAV6, or AAV9) or pseudotypes derived therefrom (e.g., AAV2 / 9, AAV2 / 6, or AAV2 / 6 / 9) are also provided.

[0019] In another aspect, this disclosure provides a host cell comprising one or more fusion proteins and / or one or more nucleic acid constructs as described herein. The host cell may be, for example, a human cell, such as a neuron or a pluripotent stem cell (e.g., an embryonic stem cell or an induced pluripotent stem cell).

[0020] Pharmaceutical compositions are also provided comprising one or more fusion proteins as described herein, one or more nucleic acid constructs (e.g., AAV constructs), recombinant viruses containing nucleic acid constructs (e.g., rAAV), and / or one or more host cells, typically in combination with one or more pharmaceutically acceptable excipients.

[0021] In another aspect, this disclosure provides a method for inhibiting the transcription of a mutant C9orf72 allele in human cells (e.g., neurons, glial cells, ependymal cells, or neuroepithelial cells), wherein the mutant allele contains an amplified G4C2 repetitive sequence region in intron 1a. The method comprises introducing into the cell one or more fusion proteins as described herein, one or more nucleic acid constructs (e.g., AAV), one or more recombinant viruses, one or more host cells, and / or one or more pharmaceutical compositions. In some embodiments, the cells are in the brain or spinal cord of a patient suffering from a C9orf72-related condition such as ALS or C9FTD.

[0022] In one related aspect, this disclosure provides a method for treating a patient with a C9orf72-related condition optionally selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), the method comprising introducing the patient with one or more fusion proteins, one or more nucleic acid constructs (e.g., AAV), one or more host cells, and / or one or more pharmaceutical compositions as described herein.

[0023] In the treatment methods of the present invention, the fusion protein can be introduced using a recombinant virus expressing the fusion protein (e.g., an AAV vector). In some embodiments, the recombinant virus is administered to the patient via intraventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisional routes. In some embodiments, two or more different fusion proteins of the present invention are introduced, wherein the coding sequences of the two or more fusion proteins may be carried on the same or different recombinant viral vectors.

[0024] This disclosure also provides one or more fusion proteins and / or one or more nucleic acid constructs, one or more recombinant viruses and one or more pharmaceutical compositions for use in the treatment methods described herein, and uses of the fusion proteins, nucleic acid constructs and recombinant viruses for manufacturing pharmaceuticals for use in the treatment methods described herein.

[0025] Other features, objectives, and advantages of the present invention will become apparent from the following embodiments. However, it should be understood that while the embodiments indicate implementations and aspects of the invention, they are given by way of illustration only and not limitation. Various changes and modifications within the scope of the invention will become apparent to those skilled in the art from the embodiments. Attached Figure Description

[0026] Figures 1A-1C A schematic diagram depicting the C9orf72 gene and its resulting transcripts.

[0027] Figure 1A The structures of the wild-type C9orf72 allele and the amplified mutant C9orf72 allele are shown. The location of the G4C2 amplification on the amplified mutant allele is indicated (in the genomic region between exons 1a and 1b, i.e., in intron 1a). Exons are shown as boxes. Adapted from Douglas, above; see also Rizzu et al. (2016) Acta Neuropathologica Communications 4:37.

[0028] Figure 1B This is a magnified view of the region near the G4C2 amplification on the mutant amplified C9orf72 allele, depicting the promoters and transcripts associated with the amplified allele. The approximate locations of promoters involved in positive strand transcription (solid arrows) and antisense transcription (hollow arrows) are shown. Five different positive transcripts previously described are also shown, along with their approximate locations and antisense transcription directions. Ibid.

[0029] Figure 1C This model demonstrates the inhibition of the 1a promoter and antisense promoter by ZFP-TF targeting the amplified region, where ZFP-TF binds downstream of both promoters and at an optimal position for promoter regulation. The 1b promoter is not inhibited in this model because ZFP-TF binds upstream of the 1b promoter.

[0030] Figures 2A-2D The diagram shows the inhibition of C9orf72 expression (“total C9”) in a specified cell type using the specified ZFP-TF. Additionally, the diagram shows the inhibition of expression of the longer mRNA isoform (amplified) containing intron 1a, which is primarily generated by the amplified mutant allele (“isoform specific with repetitive sequences”). The amplified isoform is primarily expressed in C9 patient lines.

[0031] Figure 2AThis diagram illustrates the PCR analyses used for total C9 analysis and isotype-specific analyses containing sense and antisense repeat sequences. The top of the figure depicts the genomic structures of the wild-type and amplified alleles, while the bottom shows the mRNA products derived from each allele. The arrows on the mRNA plot depict the PCR targets used in the total C9 analysis.

[0032] Figures 2B-2D Figure 1 shows the results of C9orf72 expression analysis of different exemplary ZFP-TFs in wild-type cell lines derived from healthy subjects and fibroblast cell lines “C9” derived from ALS patients. The C9 cell line is characterized as “5 / 850”, which refers to the number of G4C2 repeat sequences in wild-type alleles (5) and in amplified alleles (850). Leftmost figure: Total C9orf72 expression (“Total C9”) in wild-type cells in round 3 screening (“Round 3”). Second figure from the left: Total C9 in C9 cells in Round 3. Second figure from the right: Total C9 in C9 cells in Round 2 screening (“Round 2”). Rightmost figure: Expression of amplified C9orf72 alleles as determined by isotype-specific C9orf72 analysis. A second round of screening was performed in C9 cells to assess isotype (or disease)-specific C9orf72 transcript levels relative to total C9 transcript levels following ZFP-TF treatment. In a third round, total C9 was measured in both C9 and wild-type cells to assess the effect of ZFP-TF on wild-type (WT) alleles in C9 cells. For each ZFP-TF, mRNA concentrations of 1, 3, 10, 30, 100, and 300 ng are shown from left to right. Figure 2B The top plot shows the results for ZFP-TF74949, 74951, 74954, 74955 and 74964, and the bottom plot shows the results for 74969, 74971, 74973, 74978 and 74979. Figure 2B SEQ ID NO:1, 1 and 3 are disclosed in the order of their appearance. Figure 2C The top plot shows the results for ZFP-TF 74983, 74984, 74986, 74987 and 74988, and the bottom plot shows the results for 74997, 74998, 75001 and 75003. Figure 2C SEQ ID NO:4 and 5 are revealed in the order of their appearance. Figure 2D The top plot shows the results for ZFP-TF 75023, 75027, 75031, 75032, 75055 and 75078, and the bottom plot shows the results for 75090, 75105, 75109, 75114 and 75115. Figure 2DSequences SEQ ID NO: 8-11 are shown in the order of appearance. The sequences at the bottom of the figure represent the DNA-binding motif of the ZFP-TF. Each ZFP-TF binds to three hexanucleotide repeat sequences containing this motif. Transcript levels are normalized relative to the level of green fluorescent protein (GFP) expressed by GFP mRNA transfected with ZFP-TF mRNA. The dotted lines in the figure indicate 50% or 70% inhibition, as indicated. For example, for ZFP-TF 75115, there is approximately 50% inhibition of total isotype transcripts and approximately 70% inhibition of isotype-specific transcripts containing repeat sequences in the C9 lineage, while the inhibition of total isotypes is minimal in the WT lineage. The figure indicates that 30% of the transcripts remain, which indicates 70% inhibition.

[0033] Figure 3 A diagram showing the promoter regions of the sense and antisense transcripts in the C9orf72 amplified alleles. Primer pairs for specific detection of sense, total, and antisense transcripts are indicated. AS: antisense. ddPCR: droplet digital PCR. The figures show SEQ ID NOs 1, 1, and 7 in the order they appear.

[0034] Figure 4A and Figure 4B This demonstrates primer-specific detection of antisense precursor mRNA (pre-mRNA) targeting intron 1b. Strand-specific PCR was used to generate positive (S) or antisense (AS) cDNA templates from healthy controls (Con) or C9 cells (C9). For example, C9-AS indicates ddPCR results obtained using antisense cDNA templates generated from RNA isolated from C9 cells. Figure 4A The results showed that only the cDNA template C9-AS produced PCR products, indicating the specificity of the primer pair for detecting antisense precursor mRNA. Figure 4B Will Figure 4A The experiment was extended to seven different C9orf72 patient-derived cell lines with different G4C2 repeat sequence lengths and six different healthy control lines.

[0035] Figures 5A-5C A graph showing the inhibition of transcripts in C9 cells obtained using isotype-specific analysis with repetitive sequences. Figure 5A Three experiments are shown, in which ZFP-TF 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74960 and 74967 are given in three different doses (30, 100 or 300 ng), and the amount of disease-positive transcripts is subsequently measured. Figure 5B This shows three experiments measuring disease antisense transcripts. Figure 5C This shows three operations of total C9orf72 transcripts.

[0036] Figure 6 This study demonstrates the inhibition of total C9 transcripts and amplified positive and negative transcripts (disease isotype) in three different fibroblast cell lines derived from different ALS patients, each containing varying numbers of G4C2 repeat sequences (approximately 600, 800, and 850 repeat sequences, respectively) in their amplified alleles. Isotype selectivity analysis was used to assess the level of inhibition after cells were exposed to 100 ng of ZFP-TF 75109, 75114, and 75115. All three ZFP-TFs maintained selective inhibition in all three cell lines.

[0037] Figure 7 This study demonstrated the inhibition of total C9 transcripts in two cell lines from healthy subjects who had a greater number of G4C2 repeat sequences on their alleles than the typical number. Healthy subjects typically have 2 to 5 G4C2 repeat sequences on each of their C9orf72 alleles. However, some healthy subjects contain even more repeat sequences. To ensure sufficient ZFP-TF binding sites, cell lines containing more than the typical number of repeat sequences (5 / 8 and 5 / 20 repeat sequences) were used. In these cell lines, total C9 transcripts were minimally affected.

[0038] Figures 8A-8C The results of microarray analysis in primary fibroblasts (C921, also known as C9021) derived from ALS patients, primary mouse neurons, and primary human neurons demonstrate the specificity of the designated inhibitors (75027, 75109, 75114, and 75115). ZFP-TF 75027 targets the repeating GCCCCG (SEQ ID NO:8) motif, while ZFP-TF 75109, 75114, and 75115 target the CCGGCC (SEQ ID NO:11) motif in the antisense strand of the C9orf72 gene.

[0039] Figure 8A This image shows the results of a microarray analysis using Thermo Fisher Clariom™ S assays in patient-derived primary fibroblasts (C9021). Thermo Fisher Clariom™ S assays contain 21,000 well-annotated genes in its database. Analysis was performed 24 hours after administration of 300 ng of the inhibitor in mRNA form to C9021 cells. The figure shows genes upregulated or downregulated in response to specified ZFP-TFs.

[0040] Figure 8BThis image shows the results of a microarray analysis of primary mouse neurons using Thermo Fisher Clariom™ D analysis, which contains 140,000 labeled and unlabeled coding and non-coding transcripts in its database. Analysis was performed 7 days after AAV transduction. All cells were transduced at 3,000 MOI. The figure illustrates genes upregulated or downregulated in response to specified ZFP-TFs.

[0041] Figure 8C The results of a microarray analysis using Thermo Fisher Clariom™ D assays in primary human neurons are shown. Analysis was performed 19 days after AAV transduction at an MOI of 3,000. The figure illustrates genes upregulated or downregulated in response to specified ZFP-TFs.

[0042] Figures 9A-9E This demonstrates in vivo target binding of ZFP in C9orf72 BAC gene transgenic mice. Figure 9A The AAV construct for injection is shown. The construct contains a synaptic protein promoter, a ZFP-KRAB coding sequence, and a Venus tag. Figure 9B and Figure 9C The study design involved injecting newborn mice with an AAV intraventricular (ICV) containing a ZFP-KRAB expression construct, followed by dissection one month later for downstream analysis. Figure 9D This shows the levels of positive, negative, and total C9 RNA in the hippocampus and cortex of animals injected with ZFP-KRAB (75027). Figure 9E This image shows representative images of positive and negative RNA aggregation sites in animals injected with ZFP-KRAB (75027) and quantifications from the cornu ammonis (CA) and dentategyrus (DG) regions. Detailed Implementation

[0043] This disclosure provides a zinc finger protein-based transcription factor (ZFP-TF) that preferentially targets human C9orf72 gene alleles with amplified G4C2 repeat sequences and inhibits the transcription of these mutant alleles into RNA. This amplified region may have more than 30 G4C2 repeat sequences. The ZFP-TF of this invention is a fusion protein containing (i) at least one zinc finger protein (ZFP) domain that specifically binds to a DNA motif within a repeat sequence on the sense or antisense strand of a mutant allele, and (ii) at least one transcriptional repressor domain that reduces transcription of the allele in either or both the sense and antisense directions. It is anticipated that by introducing ZFP-TF into the nervous system (e.g., the brain and spinal cord), the level of mutant C9orf72 transcripts in neurons will be reduced, thereby inhibiting (e.g., reducing or stopping) the formation of pathogenic cytotoxic substances within cells. The ZFP-TF of this invention can be used to treat (including prevent and alleviate) C9orf72-related conditions such as ALS and C9FTD.

[0044] This document discloses methods and compositions for the diagnosis, prevention, and / or treatment of ALS and FTD. Specifically, this document provides methods and compositions for modifying specific genes (e.g., regulating their expression) to treat these diseases, including the use of engineered transcription factor repressors and nucleases. In some embodiments, regulating expression includes regulating both sense and / or antisense expression.

[0045] Therefore, this document describes methods (in vivo, in vitro, and / or extracellular) for suppressing the sense and / or antisense transcription of repetitive sequence amplification mutant alleles of the C9orf72 gene in cells (e.g., neurons). The methods involve treating cells with one or more repressors of the mutant C9orf72 gene allele, each repressor comprising a transcriptional repressor domain and a DNA-binding domain that binds to a target site in the mutant C9orf72 gene allele. The repressors may comprise one or more zinc finger protein transcription factors (ZFP-TF containing a ZFP DNA-binding domain), one or more TAL effector domain transcription factors (TALE-TF containing a TAL effector domain DNA-binding domain), and / or one or more CRISPR / Cas transcription factor systems (containing a single guide RNA DNA-binding domain). In some embodiments, two or more different repressors are used (e.g., one or more pharmaceutical compositions comprising the two or more different repressors). In some embodiments, the C9orf72 gene comprises a mutant allele including one or more (G4C2) repeat sequences, optionally wherein the target site of the DNA-binding domain of the repressor is within the one or more (G4C2) repeat sequences. Therefore, the present invention provides the use of one or more ZFP-TF, TALE-TF, or CRISPR / CasTF repressors (e.g., formulated as one or more pharmaceutical compositions comprising the one or more repressors) binding to a mutant C9orf72 amplified allele comprising one or more (G4C2) repeat sequences for use in subjects in need (e.g., subjects with ALS and / or FTD, where the disease is treated and / or symptoms are improved) for the inhibition of sense and / or antisense transcription (e.g., inhibition of 50%, 70%, or higher compared to untreated cells / subjects). In some embodiments, sense and / or antisense transcription is not inhibited to more than 90% of normal (control) levels. In some embodiments, antisense and sense transcription are suppressed at the same or different levels (e.g., antisense and sense transcription are similarly suppressed); antisense transcription is suppressed more than sense transcription, or sense transcription is suppressed more than antisense transcription. In some embodiments, certain sense transcripts are suppressed while others are not. In some embodiments, promoter transcription from the 1b intron region is not suppressed, while promoter transcription from the 1a intron and antisense transcripts are suppressed. In some embodiments, transcripts containing amplified repetitive sequences are selectively suppressed (e.g., antisense transcription is suppressed, sense transcription from the 1a promoter is suppressed, and / or sense transcription from the 1b promoter is not suppressed).In some embodiments, one or more ZFP-TF inhibitors comprising recognizing helical regions as shown in Table 1 are used in the methods and uses described herein, optionally in combination with one or more different inhibitors (e.g., other different ZFP-TFs, such as one or more additional ZFP-TFs comprising ZFPs as shown in Table 1). In some embodiments, one or more inhibitors are administered to cells using one or more nonviral vectors (e.g., in mRNA form) and / or viral vectors (e.g., AAV, such as AAV2 / 9). Multiple copies of one or more regulators (e.g., inhibitors) may be administered using the same or different modalities (e.g., mRNA and / or AAV). In some embodiments, the same or different modalities may be used to deliver one or more different regulators (e.g., inhibitors). In vivo methods and uses in live subjects (e.g., humans) may involve intravenous administration by any suitable means, including but not limited to intraventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisional administration (e.g., one or more pharmaceutical compositions comprising inhibitors and / or polynucleotides encoding inhibitors). Brain administration may be unilateral or bilateral (e.g., administration to the hippocampus). Any amount (dosage) may be administered, such as 1E10 to 1E13 (e.g., 6E11) vg / hemispheric. In any of the methods and uses described herein, the subject's ALS and / or FTD is treated (and / or one or more symptoms of these diseases are treated).

[0046] This document provides genetic regulators of the C9orf72 gene comprising a DNA-binding domain (e.g., zinc finger protein (ZFP), TAL effector protein (TALE), or single guide RNA) that binds to a target site of at least 12 nucleotides in the C9orf72 gene; and a transcriptional regulatory domain (e.g., a repressor domain). One or more polynucleotides (e.g., viral or non-viral gene delivery agents, such as AAV vectors) encoding one or more of the genetic regulators described herein are also provided. In other aspects, pharmaceutical compositions comprising one or more polynucleotides and / or one or more gene delivery agents as provided herein are described. In some embodiments, the genetic regulator comprises a regulatory domain, and the genetic regulator (and pharmaceutical compositions comprising one or more genetic regulators or polynucleotides encoding one or more genetic regulators) regulates (e.g., inhibits or activates) C9orf72 gene expression. The sense and / or antisense strands of the gene may be bound and / or regulated. This document also provides isolated cells (including cell populations) comprising one or more genetic regulators as described herein; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions. Methods and uses (in vitro, in vivo, or ex vivo) for regulating (e.g., inhibiting) the expression of the C9orf72 gene in cells are also provided, said methods comprising administering to cells (via any method, including but not limited to intraventricular, intrathecal, intracranial, retroorbital (RO), intravenous, or intracisional) one or more genetic regulators as described herein; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions. These methods may be used to treat and / or prevent amyotrophic lateral sclerosis (ALS) or frontotemporal dementia (FTD) in a subject. Uses of one or more genetic regulators; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions for treating and / or preventing ALS or FTD in a subject are also provided. Kits are also provided comprising one or more genetic regulators as described herein; one or more polynucleotides; one or more gene delivery agents; and / or one or more pharmaceutical compositions, and optionally instructions for use.

[0047] Therefore, in one aspect, engineered (non-naturally occurring) genetic regulators (e.g., repressors) of one or more genes are provided. These genetic regulators may comprise systems that regulate (e.g., repress) allele expression (e.g., zinc finger proteins, TAL effector (TALE) proteins, or CRISPR / dCas-TF). The expression of wild-type and / or mutant alleles may be regulated together or separately. In some embodiments, the level of regulation of mutant alleles is greater than that of wild-type alleles (e.g., the repression of wild-type alleles is no more than 50% of normal, but the mutant allele is repressed by at least 70% compared to an untreated control). In some embodiments, the regulatory expression may comprise both the sense and antisense transcripts regulating the C9orf72 gene. In some embodiments, the regulatory expression may primarily regulate the sense transcript, while in other embodiments, the regulatory expression may primarily regulate the antisense transcript.

[0048] Amplification mutations in the C9orf72 allele result in the expression of both sense and antisense RNA products associated with ALS and FTD. Therefore, in one embodiment, an engineered transcription factor designed to inhibit the expression of these mutant C9orf72 alleles is provided for the treatment of ALS or FTD. Engineered zinc finger proteins or TALEs are non-naturally occurring zinc finger or TALE proteins whose DNA-binding domains (e.g., recognition helices or RVDs) have been altered (e.g., by selection and / or rational design) to bind to pre-selected target sites. Any of the zinc finger proteins described herein may include 1, 2, 3, 4, 5, 6, or more zinc fingers, each having a recognition helice that binds to a target subsite in a selected sequence (e.g., multiple genes). In some embodiments, ZFP-TF comprises a ZFP having a recognition helical region as shown in a single column of Table 1. Similarly, any of the TALE proteins described herein may include any number of TALERVDs. In some embodiments, at least one RVD has non-specific DNA binding. In some embodiments, at least one recognition helix (or RVD) is not naturally occurring. In some embodiments, TALE-TF comprises a TALE that binds to at least 12 base pairs of target sites as shown in Table 1. CRISPR / Cas-TF comprises a single guide RNA that binds to a target sequence. In some embodiments, an engineered transcription factor binds to (e.g., via a ZFP, TALE, or sgRNA DNA-binding domain) a target site of at least 9 to 12 base pairs in a disease-related gene, such as a target site comprising at least 9 to 20 base pairs (e.g., 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more), including continuous or discontinuous sequences within these target sites (e.g., target sites as shown in Table 1). In some embodiments, a genetic regulator comprises a DNA-binding molecule (ZFP, TALE, single guide RNA) as described herein, operably linked to a transcriptional repressor domain (to form a genetic repressor).

[0049] Therefore, zinc finger proteins (ZFPs), Cas proteins of the CRISPR / Cas system, or TALE proteins, as described herein, can be positioned to be operatively linked to regulatory domains (or functional domains) as part of a fusion molecule. The functional domain can be, for example, a transcriptional activation domain, a transcriptional repressor domain, and / or a nuclease (cleavage) domain. By selecting the activation or repressor domain for use with DNA-binding molecules, such molecules can be used to activate or repress gene expression. In some embodiments, the functional or regulatory domain can function in post-translational histone modifications. In some cases, the domain is a histone acetyltransferase (HAT), histone deacetylase (HDAC), histone methyltransferase, or an enzyme that sumolylates or biotinylates histones, or other enzyme domains that allow post-translational histone modifications to regulate gene repression (Kousarides, (2007) Cell 128:693-705). In some embodiments, a molecule is provided comprising a ZFP, dCas, or TALE fused to a transcriptional repressor domain that can be used to downregulate gene expression and target a gene such as described herein (e.g., C9orf72). In some embodiments, the methods and compositions of the present invention are suitable for processing eukaryotes. In some embodiments, the activity of the regulatory domain is regulated by an exogenous small molecule or ligand such that no interaction with the cellular transcriptional apparatus occurs in the absence of the exogenous ligand. Such exogenous ligands control the degree of interaction between the ZFP-TF, CRISPR / Cas-TF, or TALE-TF and the transcriptional apparatus. The (multiple) regulatory domains may be operatively linked to any (multiple) portions of one or more of the ZFP, dCas, or TALE, including between one or more ZFP, dCas, or TALE, external to one or more ZFP, dCas, or TALE, and any combination thereof. In a preferred embodiment, the regulatory domain causes repression of gene expression of the target gene (e.g., C9orf72). Any of the fusion proteins described herein may be formulated into pharmaceutical compositions.

[0050] In some embodiments, the artificial regulator binds to the promoter region upstream (e.g., at the 5' end) of the transcription start site (TSS) of the gene. In some embodiments, the artificial regulator binds to the downstream region of the TSS. In a preferred embodiment, the artificial regulator preferentially binds to the amplified repetitive sequence region in the C9orf72 gene. In some embodiments, the binding of the artificial regulator to the C9orf72 gene inhibits the expression of the promoter in intron 1a. In some embodiments, the binding of the artificial regulator to the C9orf72 gene inhibits the expression of the promoter in intron 1b. In some embodiments, the binding of the artificial regulator inhibits the expression of both the 1a and antisense promoters, but not the 1b promoter. See also Figure 1B and Figure 1C .

[0051] In some embodiments, the methods and compositions of the present invention include two or more fusion molecules as described herein, such as the use of two or more C9orf72 regulators (artificial transcription factors). The two or more fusion molecules may bind to different target sites and contain the same or different functional domains. Alternatively, the two or more fusion molecules as described herein may bind to the same target site but include different functional domains. In some cases, three or more fusion molecules are used; in others, four or more fusion molecules are used; and in still others, five or more fusion molecules are used. In some embodiments, two or more, three or more, four or more, or five or more fusion molecules (or components thereof) are delivered to cells in the form of nucleic acids. In a preferred embodiment, the fusion molecules cause inhibition of the expression of the target gene. In some embodiments, the two fusion molecules are given at doses where each molecule is active on its own, but the inhibitory activity is additive in combination. In some embodiments, the two fusion molecules are given at doses where neither is active on its own, but the inhibitory activity is synergistic in combination.

[0052] In another aspect, a polynucleotide encoding any of the DNA binding domains described herein is provided.

[0053] In some embodiments, the polynucleotide encoding the DNA-binding protein is mRNA. In some aspects, the mRNA may be chemically modified (e.g., Kormann et al., (2011) Nature Biotechnology 29(2):154-7). In other aspects, the mRNA may contain an ARCA cap (see U.S. Patent Nos. 7,074,596 and 8,153,773). In other embodiments, the mRNA may contain a mixture of unmodified nucleotides and modified nucleotides (see U.S. Patent Publication No. 2012 / 0195936).

[0054] In another aspect, a gene delivery vector comprising any of the polynucleotides (e.g., inhibitors) described herein is provided. In some embodiments, the vector is an adenoviral vector (e.g., Ad5 / F35 vector); a lentiviral vector (LV), including integration-capable or integration-deficient lentiviral vectors; or an adenovirus-associated viral vector (AAV). In some embodiments, the AAV vector is an AAV2, AAV6, AAV8, or AAV9 vector, or a pseudotyped AAV vector, such as AAV2 / 8, AAV2 / 5, AAV2 / 9, and AAV2 / 6. In some embodiments, the AAV vector is an AAV vector capable of crossing the blood-brain barrier (e.g., U.S. Patent Publication No. 2015 / 0079038). In other embodiments, the AAV is a self-complementary AAV (sc-AAV) or a single-stranded (ss-AAV) molecule. This document also provides adenovirus (Ad) vectors, LV or adenovirus-associated viral vectors (AAVs) containing a sequence encoding at least one nuclease (ZFN or TALEN) and / or a donor sequence for targeted integration into a target gene. In some embodiments, the Ad vector is a chimeric Ad vector, such as the Ad5 / F35 vector. In some embodiments, the lentiviral vector is an integrase-deficient lentiviral vector (IDLV) or an integrative lentiviral vector. In some embodiments, the vector is pseudotyped with a VSV-G envelope or other envelope.

[0055] Additionally, pharmaceutical compositions are provided that comprise nucleic acids and / or fusions, such as artificial transcription factors (e.g., ZFP, Cas, or TALE, or fusion molecules comprising ZFP, Cas, or TALE). For example, certain compositions comprise a combination of a nucleic acid containing a sequence encoding one of the ZFP, Cas, or TALE described herein, operably linked to a regulatory sequence, and a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence enables the nucleic acid to be expressed in cells. In some embodiments, the encoded ZFP, Cas, CRISPR / Cas, or TALE regulates wild-type and / or mutant alleles. In some embodiments, mutant alleles are preferentially regulated, e.g., repressed, than wild-type alleles. In some embodiments, the pharmaceutical composition comprises a ZFP, CRISPR / Cas, or TALE that preferentially regulates mutant alleles and a ZFP, CRISPR / Cas, or TALE that regulates neurotrophic factors. Protein-based compositions comprise one or more ZFP, CRISPR / Cas, or TALEs as disclosed herein and a pharmaceutically acceptable carrier or diluent.

[0056] In another aspect, isolated cells comprising any of the proteins, fusion molecules, polynucleotides, and / or compositions described herein are also provided. The isolated cells may be used for non-therapeutic purposes (such as providing cell or animal models for diagnostic and / or screening methods) and / or for therapeutic purposes (such as ex vivo cell therapy).

[0057] In another aspect, pharmaceutical compositions are also provided comprising one or more genetic regulators as described herein, one or more polynucleotides (e.g., gene delivery agents), and / or one or more (e.g., a group of) isolated cells. In some embodiments, the pharmaceutical composition comprises two or more genetic regulators. For example, some compositions comprise nucleic acids containing sequences of one or more genetic regulators encoding one of the genes associated with rare diseases as described herein (e.g., C9orf72). In some embodiments, (multiple) genetic regulators (e.g., comprising ZFP, Cas, or TALE as described herein) are operatively linked to a regulatory sequence in combination with a pharmaceutically acceptable carrier or diluent, wherein the regulatory sequence enables the nucleic acid to be expressed in cells. In some embodiments, the encoded ZFP, CRISPR / Cas, or TALE is specific for mutant or wild-type alleles (e.g., C9orf72). In some embodiments, the pharmaceutical composition comprises a ZFP-TF, CRISPR / Cas-TF, or TALE-TF that regulates mutant and / or wild-type alleles (e.g., C9orf72), including TFs that preferentially regulate (e.g., suppress mutant alleles at a greater level) compared to wild-type alleles. Protein-based compositions comprise one or more genetic regulators as disclosed herein and a pharmaceutically acceptable carrier or diluent. In some embodiments, a composition comprising two or more genetic regulators (loaded on the same or different types of vectors, such as AAV vectors) is used, optionally wherein one of the genetic regulators comprises a ZFP-TF inhibitor containing a ZFP named 74949, 74978, 75027, or 75109.

[0058] This invention also provides methods and uses for inhibiting gene expression in subjects in need (e.g., subjects suffering from rare diseases as described herein), including by providing the subject with one or more polynucleotides, one or more gene delivery agents, and / or pharmaceutical compositions as described herein. In some embodiments, the compositions described herein are used to inhibit mutant C9orf72 expression in subjects, including for the treatment and / or prevention of ALS or FTD. The compositions described herein inhibit gene expression in the brain (including but not limited to the frontal cortex, including but not limited to the prefrontal cortex; parietal cortex; occipital cortex; temporal cortex, including but not limited to the entorhinal cortex; hippocampus; brainstem; striatum; thalamus; midbrain; cerebellum) and spinal cord (including but not limited to the lumbar, thoracic, and cervical vertebrae) for a duration of time (4 weeks, 3 months, 6 months to one year or longer). The compositions described herein can be provided to the subject by any means of administration, including but not limited to intraventricular, intrathecal, intracranial, intravenous, orbital (retroorbital (RO)), intranasal, and / or cisternsal administration. Kits are also provided that contain one or more of the compositions described herein (e.g., genetic regulators, polynucleotides, pharmaceutical compositions, and / or cells) and instructions for use of these compositions.

[0059] In another aspect, this document provides methods for treating and / or preventing CNS (e.g., ALS and / or FTD) using the methods and compositions described herein. In some embodiments, the methods involve compositions that deliver polynucleotides and / or proteins using viral vectors, non-viral vectors (e.g., plasmids), and / or combinations thereof. In some embodiments, the methods involve compositions comprising stem cell populations containing artificial transcription factors (e.g., ZFP-TF, TALE-TF, or dCas-TF). Administration of the compositions described herein (proteins, polynucleotides, cells, and / or pharmaceutical compositions containing these proteins, polynucleotides, and / or cells) results in therapeutic (clinical) effects, including but not limited to improvement or elimination of any clinical symptoms associated with ALS and / or FTD, and enhancement of function and / or increase in number of CNS cells (e.g., neurons, stellate cells, myelin, etc.). In some embodiments, the compositions and methods described herein reduce the expression of the sense and / or antisense transcripts of a target gene (e.g., C9orf72) by at least 30% or 40%, such as at least 50%, at least 70%, at least 80%, at least 90%, at least 95%, or more than 95%, compared to a control that has not received an artificial repressor as described herein. In some embodiments, a reduction of at least 50% is achieved. In some embodiments, the artificial repressor preferentially suppresses mutant alleles (e.g., amplified alleles) by, for example, at least 20% (e.g., suppressing no more than 50% of wild-type alleles and suppressing mutant alleles by at least 70%) compared to wild-type alleles. In some embodiments, the repressor preferentially suppresses the sense transcripts on mutant alleles, while in other embodiments, the repressor preferentially suppresses the antisense transcripts on mutant alleles. In some embodiments, the repressor suppresses both sense and antisense transcripts on mutant alleles.

[0060] In another embodiment, this document describes methods for delivering gene inhibitors to the brain of a subject using viral or non-viral vectors. In some embodiments, the viral vector is an AAV9 vector. Delivery may be made by any suitable means, including via cannulation to any brain region, such as the hippocampus or entorhinal cortex. Extensive delivery of genetic regulators (e.g., inhibitors) to the brain of a subject is provided, including any AAV vector delivered via anterograde and retrograde axonal transport to brain regions where the vector was not directly administered (e.g., delivery to the putamen results in delivery to other structures, such as the cortex, substantia nigra, thalamus, etc.). In some embodiments, the subject is a human, and in other embodiments, the subject is a non-human primate. Administration may be in the form of a single dose, a series of doses administered simultaneously, or multiple administrations (in any temporal order).

[0061] Therefore, in other aspects, this document describes methods for preventing and / or treating a disease (e.g., ALS and / or FTD) in a subject, comprising administering a gene inhibitor to the subject using an AAV. In some embodiments, the inhibitor is administered to the subject's CNS (e.g., hippocampus and / or entorhinal cortex) or PNS (e.g., spinal cord / spinal fluid). In other embodiments, the inhibitor is administered intravenously. In some embodiments, this document describes methods for preventing and / or treating ALS or FTD in a subject, comprising administering an inhibitor of the C9orf72 allele (wild-type and / or mutant) to the subject using one or more AAV vectors. In some embodiments, the AAV encoding the genetic regulator is administered to the CNS (brain and / or CSF) via any delivery method, including but not limited to intraventricular, intrathecal, intracranial, intravenous, intranasal, retroorbital, or intracisional delivery. In other embodiments, the AAV encoding the inhibitor is administered directly to the subject's brain parenchyma (e.g., hippocampus and / or entorhinal cortex). In other embodiments, the AAV encoding the inhibitor is administered intravenously (IV). In any of the methods described herein, administration may be performed once (single administration) or multiple times (with any interval between administrations) using the same or different doses. When administering multiple times, delivery media of the same or different doses and / or administration modes may be used (e.g., different AAV carriers for IV and / or ICV administration). The methods include methods for reducing muscle function loss, loss of body coordination, muscle stiffness, muscle spasms, loss of language function, dysphagia, and cognitive impairment in ALS subjects, methods for reducing motor function loss, and / or methods for reducing one or more cognitive function losses, all compared to subjects who did not receive the methods or compared to the subjects themselves before receiving the methods. Therefore, the methods described herein induce a reduction in biomarkers and / or symptoms of rare diseases such as ALS or FTD, including one or more of the following: muscle dysfunction, loss of body coordination, muscle stiffness, muscle spasms, loss of speech function, dysphagia, cognitive impairment, ALS-related blood and / or cerebrospinal fluid chemicals, including changes in the levels of G-CSF, IL-2, IL-15, IL-17, MCP-1, MIP-1α, TNF-α, and VEGF (see Chen et al., Front Immunol. (2018) 9:2122) and / or other biomarkers known in the art. In some embodiments, the methods may further comprise, for example, administration of one or more gene inhibitors of tau (MAPT) to subjects with FTD. See, for example, U.S. Patent Publication No. 2018 / 0153921.

[0062] In any of the methods described herein, the allele-targeting repressor may be a ZFP-TF, such as a fusion protein comprising a ZFP that specifically binds to the allele and a transcriptional repressor domain (e.g., KOX, KRAB, etc.). In other embodiments, the allele-targeting repressor may be a TALE-TF, such as a fusion protein comprising a TALE peptide that specifically binds to the gene allele and a transcriptional repressor domain (e.g., KOX, KRAB, etc.). In some embodiments, the allele-targeting repressor is a CRISPR / Cas-TF, wherein the nuclease domain in the Cas protein is inactivated, preventing the protein from cleaving DNA. The resulting CasRNA guides the DNA-binding domain to fuse with a transcriptional repressor (e.g., KOX, KRAB, etc.) to inhibit the targeted allele. In some embodiments, an engineered transcription factor is capable of inhibiting the expression of mutant alleles rather than wild-type alleles. In other embodiments, the DNA-binding molecule preferentially recognizes hexameric GGGGCC (SEQ ID NO:1) amplification.

[0063] In some embodiments, a sequence encoding a gene repressor as described herein (e.g., ZFP-TF, TALE-TF, or CRISPR / Cas-TF) is inserted (integrated) into the genome, while in other embodiments, the sequence encoding the repressor remains free. In some cases, the nucleic acid encoding the TF fusion is inserted at a safe harbor site containing a promoter (e.g., via nuclease-mediated integration), such that an endogenous promoter drives expression. In other embodiments, a repressor (TF) donor sequence is inserted (via nuclease-mediated integration) into the safe harbor site, and the donor sequence contains a promoter that drives repressor expression. In some embodiments, the promoter sequence is widely expressed, while in other embodiments, the promoter is tissue- or cell / type-specific. In a preferred embodiment, the promoter sequence is specific to neuronal cells. In other embodiments, the promoter sequence is specific to muscle cells. In some embodiments, the selected promoter is characterized by low expression. Non-limiting examples of suitable promoters include neuron-specific promoters NSE, synaptic proteins, CAMKiia, and MECP. Non-limiting examples of ubiquitous promoters include CMV, CAG, and Ubc. Other embodiments include the use of self-regulating promoters as described in U.S. Patent Publication No. 2015 / 0267205.

[0064] In any of the methods described herein, the method can produce suppression of a target allele (e.g., mutant or wild-type C9orf72) by approximately 50% or more, 55% or more, 60% or more, 65% or more, approximately 70% or more, approximately 75% or more, approximately 85% or more, approximately 90% or more, approximately 92% or more, or approximately 95% or more, 98% or more, or 99% or more in one or more neurons of a subject (e.g., a subject with ALS). In some embodiments, the expression of the wild-type allele is suppressed by no more than 50% in the subject (compared to an untreated subject), while the expression of the mutant allele is suppressed by at least 70% (70% or any value above 70%) in the subject (compared to an untreated subject). In some embodiments, the expression of the antisense promoter is suppressed by at least 70%. In some implementations, antisense activator expression in regions of C9orf72 introns 1a, 1b and / or 1c is suppressed by at least 70%, while sense promoter expression in region of C9orf72 intron 1b is suppressed by no more than 50%.

[0065] In any of the methods described herein, the regulator (e.g., an inhibitor or activator) may be delivered to the subject in the form of a protein, a polynucleotide, or any combination of a protein and a polynucleotide. In some embodiments, one or more inhibitors are delivered using an AAV vector. In other embodiments, at least one component of the regulator (e.g., sgRNA from a CRISPR / Cas system) is delivered in RNA form. In other embodiments, the regulator is delivered using a combination of any of the expression constructs described herein, such as an inhibitor (or a portion thereof) on an expression construct (AAV9) and an inhibitor (or a portion thereof) on a separate expression construct (AAV or other viral or non-viral construct).

[0066] Furthermore, in any of the methods described herein, regulators (e.g., inhibitors) can be delivered to cells (ex vivo or in vivo) at any concentration (dose) to provide the desired effect. In some embodiments, regulators are delivered using an adeno-associated virus (AAV) vector at 10,000 to 500,000 vector genomes / cell (or any value between therewith). In some embodiments, regulators are delivered using a lentiviral vector at an MOI between 250 and 1,000 (or any value between therewith). In other embodiments, regulators are delivered using a plasmid vector at 0.01 to 1,000 nanograms / 100,000 cells (or any value between therewith). In other embodiments, inhibitors are delivered in mRNA form at 150 to 1,500 nanograms / 100,000 cells (or any value between therewith). Furthermore, for in vivo use, in any of the methods described herein, (multiple) genetic regulators (e.g., inhibitors) can be delivered at any concentration (dose) to provide the desired effect in a subject in need. In some embodiments, the inhibitor is delivered using an adeno-associated virus (AAV) vector at a rate of 10,000 to 500,000 vector genomes per cell (or any value between these). In some embodiments, the inhibitor is delivered using a lentiviral vector at an MOI between 250 and 1,000 (or any value between these). In other embodiments, the inhibitor is delivered using a plasmid vector at a rate of 0.01 to 1,000 nanograms per 100,000 cells (or any value between these). In other embodiments, the inhibitor is delivered as mRNA at a rate of 0.01 to 3,000 nanograms per cell number (e.g., 50,000 to 200,000 (e.g., 100,000) cells) (or any value between these). In other embodiments, the inhibitor is delivered to the brain parenchyma in a fixed volume of 1 to 300 μL using an adeno-associated virus (AAV) vector at 1E11-1E14 V g / mL. In other embodiments, the inhibitor is delivered to the CSF in a fixed volume of 0.5 to 10 mL using an adeno-associated virus (AAV) vector at 1E11-1E14 V g / mL.

[0067] In any of the methods described herein, the method can produce regulation (e.g., suppression) of about 50% or higher, 55% or higher, 60% or higher, 65% or higher, about 70% or higher, about 75% or higher, about 85% or higher, about 90% or higher, about 92% or higher, or about 95% or higher in one or more cells of a subject. In some embodiments, wild-type and mutant alleles are regulated in different ways, for example, mutant alleles are preferentially modified compared to wild-type alleles (e.g., mutant alleles are suppressed by at least 70% and wild-type alleles are suppressed by no more than 50%).

[0068] In any of the methods described herein, the method can produce regulation (e.g., suppression) of antisense expression of one or more target alleles in one or more cells of a subject at approximately 50% or higher, 55% or higher, 60% or higher, 65% or higher, approximately 70% or higher, approximately 75% or higher, approximately 85% or higher, approximately 90% or higher, approximately 92% or higher, or approximately 95% or higher. In some embodiments, sense and antisense expression in mutant alleles are regulated differently, for example, in mutant alleles, antisense transcript expression is preferentially regulated compared to sense transcript expression (e.g., antisense expression is suppressed by at least 70% and sense expression is suppressed by no more than 50%).

[0069] In other respects, transcription factors as described herein, such as those comprising one or more of the following: zinc finger proteins (ZFP-TF), TALE (TALE-TF), and CRISPR / Cas-TF, such as ZFP-TF, TALE-TF, or CRISPR / Cas-TF, are used to inhibit the expression of mutant and / or wild-type alleles (e.g., C9orf72) in the brain (e.g., neurons) of a subject. Inhibition may be approximately 50% or higher, 55% or higher, 60% or higher, 65% or higher, 70% or higher, approximately 75% or higher, approximately 85% or higher, approximately 90% or higher, approximately 92% or higher, or approximately 95% or higher compared to the subject's untreated (wild-type) cells. In some embodiments, suppression of wild-type alleles is no more than 50% (compared to untreated cells or subjects), and suppression of mutants (pathogenic or isotype variants) is at least 70% (compared to untreated cells or subjects). In some embodiments, antisense transcription is completely (total) suppressed. In some embodiments, suppression of sense transcripts is no more than 50% (compared to untreated cells or subjects), and suppression of antisense transcripts is at least 70% (compared to untreated cells or subjects). In some embodiments, targeting regulatory transcription factors can be used to achieve one or more of the methods described herein.

[0070] Therefore, this document describes methods and compositions for regulating gene expression associated with the rare diseases disclosed herein, including repression with or without expression of exogenous sequences (such as artificial TFs). The compositions and methods are available for in vitro use (e.g., to provide cells for studying target genes (via their regulation); for drug discovery; and / or for preparing genetically modified animals and animal models), in vivo use, or ex vivo use, and involve administration of an artificial transcription factor or nuclease comprising a DNA-binding molecule targeting a rare disease-related gene, optionally with the nuclease accompanied by a donor that integrates into the gene after cleavage by the nuclease. In some embodiments, the donor gene (transgenic gene) is maintained extrachromosomally in the cells. In some embodiments, the cells are in a patient with the disease. In other embodiments, the cells are modified by any of the methods described herein, and the modified cells are administered to a subject in need (e.g., a subject with a rare disease). Genetically modified cells (e.g., stem cells, precursor cells, T cells, muscle cells, etc.) comprising a genetically modified gene (e.g., an exogenous sequence) are also provided, including cells prepared by the methods described herein. These cells can be used to deliver (multiple) therapeutic proteins to subjects with rare diseases, for example by administering (multiple) cells to subjects in need, or alternatively by isolating proteins produced by the cells and administering those proteins to subjects in need (enzyme replacement therapy).

[0071] Kits are also provided that contain one or more of the following: genetic regulators (e.g., repressors) as described herein and / or polynucleotides containing components of a target regulator (or a component thereof) and / or polynucleotides encoding a target regulator (or a component thereof). The kits may further include cells (e.g., neuronal or muscle cells), reagents (e.g., for detecting and / or quantifying proteins, for example, in CSF), and / or instructions for use as described herein.

[0072] The methods and compositions of the present invention are described in further detail below.

[0073] I. Zinc Finger Transcription Factors

[0074] The present invention, ZFP-TF, is a fusion protein containing a DNA-binding zinc finger (ZFP) domain and a transcription repressor domain, wherein the two domains may associate with each other by direct peptide linkage or peptide linker, or by dimerization (e.g., via a leucine zipper, the N-terminal domain of a STAT protein, or an FK506-binding protein). As used herein, "fusion protein" refers to a polypeptide having a covalently linked domain and a complex of polypeptides associated with each other via non-covalent bonds. The transcription repressor domain may associate with the ZFP domain at any suitable location, including at the C-terminus or N-terminus of the ZFP domain.

[0075] In some embodiments, the ZFP-TF of the present invention represses transcription of the human mutant C9orf72 gene by 45% or higher (e.g., 50%, 60%, 70%, 80%, 90%, or 95% or higher). In some embodiments, two or more ZFP-TFs of the present invention are used simultaneously in a patient, wherein the ZFP-TF binds to different DNA motifs in the sense and / or antisense strands that amplify the C9orf72 region in order to achieve optimal repression of mutant C9orf72 transcription.

[0076] A. The target of the ZFP domain

[0077] The ZFP domain of the fusion protein of this invention preferentially binds to the amplification region in the allele of the mutant human C9orf72 gene. The human C9orf72 gene is located at position 21.2 (9p21.2) on the short (p) arm of chromosome 9. It spans base pairs 27,546,546 to 27,573,866 on this chromosome. The genomic structure of human C9orf72 is as follows: Figure 1A As shown in the diagram, the DNA-binding ZFP domain of the ZFP-TF guides the fusion protein to the amplified repetitive sequence region of the mutant C9orf72 gene and carries the transcriptional repressor domain of the fusion protein to the target region. The repressor domain then inhibits the transcription of the C9orf72 gene by RNA polymerase.

[0078] In some embodiments, the target sequence in the amplified region is at least 8 bp in length. For example, the target sequence length can be from 8 bp to 40 bp, such as 12, 15, 16, 17, 18, 19, 20, 21, 24, 27, 30, 33, or 36 bp. In some embodiments, the target sequence of the ZFP-TF of the present invention is 12 to 20 bp in length (e.g., 12 to 18, 15 to 19, 15, 18, or 19). In some embodiments, the target sequence comprises discontinuous subsequences.

[0079] The G4C2 repeat sequence causes the following six-nucleotide DNA motifs in both the sense and antisense strands of a gene:

[0080] The motif in the justice C9orf72 chain:

[0081] (i)GGGGCC (SEQ ID NO:1)

[0082] (ii)GGGCCG (SEQ ID NO:2)

[0083] (iii)GGCCGG (SEQ ID NO:3)

[0084] (iv)GCCGGG (SEQ ID NO:4)

[0085] (v)CCGGGG (SEQ ID NO:5)

[0086] (vi)CGGGGC (SEQ ID NO:6)

[0087] The base order in the antisense C9orf72 chain:

[0088] (vii)GGCCCC (SEQ ID NO:7)

[0089] (viii)GCCCCG (SEQ ID NO:8)

[0090] (ix)CCCCGG (SEQ ID NO:9)

[0091] (x)CCCGGC (SEQ ID NO:10)

[0092] (xi)CCGGCC (SEQ ID NO:11)

[0093] (xii)CGGCCC (SEQ ID NO:12)

[0094] In some embodiments, the target sequence of the ZFP-TF of the present invention comprises one or more (e.g., 2, 3, or 4) tandem repeat sequences of these DNA motifs. In some embodiments, the target sequence consists of three tandem repeat sequences of one of the motifs. In some embodiments, the target sequence comprises one or more (e.g., 2 or 3) tandem repeat sequences of the motif, plus several (e.g., 1, 2, 3, 4, or 5) nucleotides (e.g., CC(G4C2)2GG) (SEQ ID NO:75) from upstream and / or downstream adjacent sequences.

[0095] The target sequence can be on either the sense or antisense strand of a gene. In some implementations, the ZFP-TF used in patients binds to both the sense and antisense strands of the mutant allele. To ensure targeting accuracy and to reduce off-target binding of ZFP-TF, the selected C9orf72 target region sequence preferably has less than 75% homology with sequences in other genes in the genome (e.g., less than 70%, less than 65%, less than 60%, or less than 50% homology).

[0096] Other criteria for further evaluation of target segments include the prior availability of ZFPs combined with such or related segments, the ease of designing new ZFPs that combine with a given target segment, and the risk of deviating from the target combination.

[0097] B. Zinc finger protein domain

[0098] "Zinc finger proteins" or "ZFPs" are proteins that have a zinc-stabilized DNA-binding domain. ZFPs bind to DNA in a sequence-specific manner. Individual DNA-binding domains are referred to as "fingers." A ZFP has at least one finger, each finger binding two to four DNA base pairs, typically three or four. Each zinc finger typically contains approximately 30 amino acids and chelates zinc. Engineered ZFPs can possess novel binding specificity compared to naturally occurring zinc finger proteins. Engineering methods include, but are not limited to, rational design and various types of selection. Rational design includes, for example, using a database containing triplet (or tetrad) nucleotide sequences and individual zinc finger amino acid sequences, wherein each triplet or tetrad nucleotide sequence is associated with one or more amino acid sequences of the zinc finger that binds a specific triplet or tetrad sequence. See, for example, the ZFP design method described in detail below: U.S. Patents 5,789,538; 5,925,523; 6,007,988; 6,013,453; 6,140,081; 6,200,759; 6,453,242; 6,534,261; 6,979,539; 8,586,526; 8,841,260; 8,956,828; and 9,234,016; And international patent publications WO95 / 19431; WO96 / 06166; WO98 / 53057; WO98 / 53058; WO98 / 53059; WO98 / 53060; WO98 / 54311; WO00 / 27878; WO01 / 60970; WO01 / 88197; WO02 / 016536; WO02 / 099084; and WO03 / 016496.

[0099] The ZFP domain of the ZFP-TF of this invention may include at least three (e.g., four, five, six, seven, eight, nine, ten, eleven, twelve, thirteen or more) zinc fingers. A ZFP domain with three fingers typically identifies target sites comprising 9 to 12 nucleotides. A ZFP domain with four fingers typically identifies target sites comprising 12 to 15 nucleotides. A ZFP domain with five fingers typically identifies target sites comprising 15 to 18 nucleotides. A ZFP domain with six fingers may identify target sites comprising 18 to 21 nucleotides.

[0100] As described, for example, in U.S. Patent Publication 2018 / 0087072, the target specificity of the ZFP domain can be improved by mutating the ZFP backbone. Mutations include mutations of residues in the ZFP backbone that can nonspecifically interact with phosphate esters on the DNA backbone but are not involved in nucleotide target specificity. In some embodiments, these mutations comprise mutating cationic amino acid residues to neutral or anionic amino acid residues. In some embodiments, these mutations comprise mutating polar amino acid residues to neutral or nonpolar amino acid residues. In other embodiments, the mutations are performed at positions (-5), (-9), and / or (-14) relative to the DNA-binding helix. In some embodiments, the zinc fingers may contain one or more mutations at positions (-5), (-9), and / or (-14). In other embodiments, one or more zinc fingers in a multi-finger ZFP domain may contain mutations at positions (-5), (-9), and / or (-14). In some embodiments, the amino acids (e.g., arginine (R) or lysine (K)) at positions (-5), (-9), and / or (-14) are mutated to alanine (A), leucine (L), Ser (S), Asp (N), Glu (E), Tyr (Y), and / or glutamine (Q). In some embodiments, the R residue at position (-5) is mutated to Q.

[0101] Alternatively, the DNA-binding domain may be derived from nucleases. For example, the recognition sequences of homing endonucleases such as I-SceI, I-CeuI, PI-PspI, PI-Sce, I-SceIV, I-CsmI, I-PanI, I-SceII, I-PpoI, I-SceIII, I-CreI, I-TevI, I-TevII, and I-TevIII, as well as a wide range of nucleases, are known. See also U.S. Patents 5,420,032 and 6,833,252; Belfort et al., Nucleic Acids Res. (1997) 25:3379-88; Dujon et al., Gene (1989) 82:115-8; Perler et al., Nucleic Acids Res. (1994) 22:1125-7; Jasin, Trends Genet. (1996) 12:224-8; Gimble et al., J Mol Biol. (1996) 263:163-80; Argast et al., J Mol Biol. (1998) 280:345-53; and the New England Biolabs catalogue.

[0102] In some embodiments, the ZFP-TF of the present invention comprises one or more zinc finger domains. The domains may be linked together via an extendable flexible adapter, such that, for example, one domain contains one or more (e.g., 4, 5, or 6) zinc fingers, and another domain contains another one or more (e.g., 4, 5, or 6) zinc fingers. In some embodiments, the adapter is a standard finger-to-finger adapter, such that the finger set contains a DNA-binding domain containing 8, 9, 10, 11, or 12 or more fingers. In other embodiments, the adapter is an atypical adapter, such as a flexible adapter. For example, two ZFP domains may be linked to a transcriptional repressor TF in the following configuration (N-terminus to C-terminus): ZFP-ZFP-TF, TF-ZFP-ZFP, ZFP-TF-ZFP, or ZFP-TF-ZFP-TF (two ZFP-TF fusion proteins fused together via an adapter).

[0103] In some implementations, ZFP-TFs are "two-handed," meaning they contain two zinc finger clusters (two ZFP domains) separated by an intermediate amino acid, allowing the two ZFP domains to bind to two discontinuous target sites. An example of a two-handed zinc finger binding protein is SIP1, in which four zinc finger clusters are located at the amino terminus of the protein, and three finger clusters are located at the carboxyl terminus (see Remacle et al., EMBOJ. (1999) 18(18):5073-84). In these proteins, each cluster of zinc fingers can bind to a unique target sequence, and the space between two target sequences can contain many nucleotides.

[0104] In alternative embodiments, a protein functionally similar to ZFP-TF may be used instead of ZFP-TF. For example, the transcriptional repressor fusion protein may include a DNA-binding domain derived from a transcriptional activator, such as an effector (TALE) DNA-binding domain, rather than a ZFP domain. See, for example, U.S. Patents 8,586,526 and 9,458,205; U.S. Patent Publications 2013 / 0196373 and 2013 / 0253040; WO2010 / 079430; Schornack et al., J Plant Physiol (2006) 163(3):256-72); Kay et al., Science (2007) 318:648-51; Moscou and Bogdanove, Science (2009) 326:1501; and Boch et al., Science (2009) 326:1509-12. In another example, the transcriptional repressor fusion protein may include a DNA-binding domain, which is a single guide RNA of the CRISPR / Cas system. See, for example, U.S. Patent Publication 2015 / 0056705; Jinek et al., Science (2012) 337:816; Ramalingam et al., Genome Biol. (2013) 14:107; Hwang et al., (2013) Nature Biotechnology 31(3):227.

[0105] C. Transcription repressor domain

[0106] The ZFP-TF of this invention comprises one or more transcriptional repressor domains that attenuate the transcriptional activity of the mutant C9orf72 allele. Non-limiting examples of transcriptional repressor domains include the KRAB domain of KOX1, KAP-1, MAD, FKHR, EGR-1, ERD, SID, TGFβ-inducible early gene (TIEG), v-ERB-A, MBD2, MBD3, DNMT family members (e.g., DNMT1, DNMT3A, DNMT3B), Rb, and MeCP2. See, for example, Bird et al., Cell (1999) 99:451-54; Tyler et al., Cell (1999) 99:443-46; Knoepfler et al., Cell (1999) 99:447-50; Robertson et al., Nature Genet. (2000) 25:338-42. Other illustrative repressor domains include, but are not limited to, ROM2 and AtHD2A. See, for example, Chem et al., Plant Cell (1996) 8:305-21; and Wu et al., Plant J. (2000) 22:19-27.

[0107] In some implementations, the transcriptional repressor domain comprises a sequence from the Kruppel-associated box (KRAB) domain of human zinc finger protein 10 / KOX1 (ZNF10 / KOX1) (e.g., GenBank NM_015394.4). An illustrative KRAB domain sequence is as follows:

[0108] DAKSLTAWSR TLVTFKDVFV DFTREEWKLL DTAQQIVYRN VMLENYKNLV SLGYQLTKPDVILRLEKGEE PWLVEREIHQ ETHPDSETAF EIKSSV

[0109] (SEQ ID NO:13).

[0110] Variants of this KRAB sequence can also be used, as long as they have the same or similar transcriptional repression function.

[0111] D. Peptide linker

[0112] The ZFP domain and transcriptional repressor domain of the ZFP-TF of the present invention and / or the zinc finger within the ZFP domain can be linked via a peptide linker, such as an uncleavable peptide linker of about 5 to 200 amino acids (e.g., 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20 or more amino acids). Some preferred linkers are flexible amino acid sequences synthesized into recombinant fusion proteins. See, for example, the description above; and U.S. Patents 6,479,626; 6,903,185; 7,153,949; 8,772,453; and 9,163,245; and WO2011 / 139349. The proteins described herein may include any combination of linkers suitable for the protein. Non-limiting examples of connectors are DGGGS (SEQ ID NO:14), TGEKP (SEQ ID NO:15), LRQKDGERP (SEQ ID NO:16), GGRR (SEQ ID NO:17), GGRRGGGS (SEQ ID NO:18), LRQRDGERP (SEQ ID NO:19), LRQKDGGGSERP (SEQ ID NO:20), LRQKD(G3S)2ERP (SEQ ID NO:21), TGSQKP (SEQ ID NO:22), LRQKDAARGS (SEQ ID NO:26) and LRQKDAARGSGG (SEQ ID NO:76).

[0113] In some embodiments, the peptide linker is 3 to 20 amino acid residues in length and is rich in G and / or S. A non-limiting example of such a linker is the G4S type linker (“G4S” disclosed as SEQ ID NO:23), that is, a linker containing one or more (e.g., 2, 3 or 4) GGGGS (SEQ ID NO:23) motifs or variations of the motif (such as having one, two or three amino acid insertions, deletions and substitutions in the motif).

[0114] In some implementations, the ZFP-TF includes a nuclear localization signal (e.g., a nuclear localization signal from the intermediate T antigen in SV40) and / or an epitope tag (e.g., FLAG and hemagglutinin).

[0115] II. Expression of ZFP-TFs

[0116] The ZFP-TF disclosed herein can be introduced into a patient via a nucleic acid molecule encoding it. For example, the nucleic acid molecule is an RNA molecule, and this RNA molecule is introduced into the patient's brain via injection of a composition comprising a lipid:nucleic acid complex (e.g., liposomes). Alternatively, ZFP-TF can be introduced into a patient via a nucleic acid expression vector comprising the coding sequence of ZFP-TF. The expression vector may include expression control sequences (such as promoters, enhancers), transcription signal sequences, and transcription termination sequences that enable the coding sequence of ZFP-TF to be expressed in cells of the nervous system (e.g., the central nervous system). In some embodiments, the expression vector persists in the cell as a stable episome. In other embodiments, the expression vector is integrated into the cell's genome.

[0117] In some implementations, the promoter on the vector used to guide ZFP-TF expression in the brain is a constitutively active promoter or an inducible promoter. Suitable promoters include, but are not limited to, Raúl's sarcoma virus (RSV) long terminal repeat (LTR) promoters (optionally with RSV enhancers), cytomegalovirus (CMV) promoters (optionally with CMV enhancers), CMV immediate early promoters, simian virus 40 (SV40) promoters, dihydrofolate reductase (DHFR) promoters, β-actin promoters, phosphoglycerate kinase (PGK) promoters, EF1α promoters, and Moroni murine leukemia virus (MoMLV). LTR, creatine kinase (CK6)-based promoters, thyroxine transporter promoters (TTR), thymidine kinase (TK) promoters, tetracycline-responsive promoters (TRE), hepatitis B virus (HBV) promoters, human α1-antitrypsin (hAAT) promoters, chimeric liver-specific promoters (LSP), factor E2 (E2F) promoters, human telomerase reverse transcriptase (hTERT) promoters, CMV enhancer / chicken β-actin / rabbit β-hemoglobin promoters (CAG promoter; Niwa et al., Gene (1991) 108(2):193-9), and RU-486-responsive promoters can also be used. Neuron-specific promoters, such as synapticin I promoters, calcium / calcitonin-dependent protein kinase II (CamKII) promoters, methyl CpG-binding protein 2 (MeCP2) promoters, choline acetyltransferase (ChAT) promoters, and calcium-binding protein (Calb) promoters, can also be used. Astrocyte-specific promoters, such as the glial fibrillary acidic protein (GFAP) promoter or the aldehyde dehydrogenase 1 family member L1 (Aldh1L1) promoter, can also be used. Oligodendrocyte-specific promoters, such as the Olig2 promoter, can also be used. Additionally, the promoter may include one or more self-regulating elements, whereby ZFP-TF can bind and suppress its own expression level to a preset threshold. See U.S. Patent 9,624,498.

[0118] Any method can be used to introduce nucleotide sequences into cells, including but not limited to electroporation, calcium phosphate precipitation, microinjection, cationic or anionic liposomes, combinations of liposomes with nuclear localization signals, naturally occurring liposomes (e.g., exosomes), or viral transduction.

[0119] For in vivo delivery of expression vectors, viral transduction can be used. A variety of viral vectors known in the art are suitable for this invention, such as vaccinia vectors, adenovirus vectors, lentiviral vectors, poxvirus vectors, herpesvirus vectors, adeno-associated virus (AAV) vectors, retroviral vectors, and hybrid viral vectors. In some embodiments, the viral vector used herein is a recombinant AAV (rAAV) vector. AAV vectors are particularly suitable for central nervous system (CNS) gene delivery because AAV infects both dividing and non-dividing cells and has very low immunogenicity, and the viral genome exists in a stable episome structure for long-term expression (Hadaczek et al., Mol Ther. (2010) 18:1458-61; Zaiss et al., GeneTher. (2008) 15:808-16). Any suitable AAV serotype can be used. For example, AAV can be AAV1, AAV2, AAV3, AAV3b, AAV4, AAV5, AAV6, AAV7, AAV8, AAV8.2, AAV9, or AAVrh10, or have pseudotypes (e.g., AAV2 / 8, AAV2 / 5, AAV2 / 6, AAV2 / 9, or AAV2 / 6 / 9). See, for example, U.S. Patents 7,198,951 and 9,585,971.

[0120] In some embodiments, the expression vector is an AAV vector and is introduced into target human cells via recombinant AAV virions. The genome of the recombinant AAV virion includes constructs comprising AAV inverted terminal repeat (ITR) sequences at both ends, enabling the production of AAV virions in production systems such as insect cell / baculovirus production systems or mammalian cell production systems. AAVs can be engineered to reduce the immunogenicity of their capsid proteins in humans and enhance their transduction capacity. In some embodiments, AAV9 is used. The viral vectors described herein can be produced using methods known in the art. Any suitable permissible or packaging cell type can be used to produce viral particles. For example, mammalian (e.g., 293) insect (e.g., Sf9) cells can be used as packaging cell lines.

[0121] Methods for expressing therapeutic proteins, including ZFP, in the nervous system of patients in need are also described in U.S. Patents 6,309,634; 6,453,242; 6,503,717; 6,534,261; 6,599,692; 6,607,882; 6,689,558; 6,824,978; 6,933,113; 6,953,575; 6,979,539; 7,013,219; 7,163,824; 7,182,944; 8,309,355; 8,337,458; 8,586,526; 9,050,299; and 9,089,667.

[0122] III. Pharmaceutical Applications

[0123] This invention provides a ZFP-TF for the treatment of patients requiring downregulation of C9orf72 expression, particularly downregulation of mutant C9orf72 allele expression. Patients have C9orf72-related neurodegenerative diseases (such as ALS and C9FTD) or are at risk of developing such diseases. At-risk patients include those genetically predisposed to the disease, those who have suffered recurrent brain injuries (such as concussions), and those exposed to environmental neurotoxins. This invention provides a method for treating subjects (such as human patients in need) with C9orf72-related neurodegenerative diseases (e.g., ALS and C9FTD), comprising introducing a therapeutically effective amount (e.g., an amount sufficient to adequately inhibit mutant C9orf72 allele expression) of ZFP-TF (e.g., an rAAV vector expressing it) into the subject's nervous system (e.g., CNS). The term "treatment" encompasses symptom relief, prevention of symptom onset, slowing disease progression, improving quality of life, and improving survival.

[0124] This invention provides pharmaceutical compositions comprising a viral vector, such as rAAV with a recombinant genome containing an expression cassette of ZFP-TF. The pharmaceutical composition may further comprise a pharmaceutically acceptable carrier, such as water, physiological saline (e.g., phosphate-buffered saline), dextran, glycerol, sucrose, lactose, gelatin, dextran, albumin, or pectin. Additionally, the composition may contain excipients, such as wetting or emulsifying agents, pH buffers, stabilizers, or other agents that enhance the effectiveness of the pharmaceutical composition. The pharmaceutical composition may contain a delivery medium, such as liposomes, nanocapsules, microparticles, microspheres, lipid particles, and vesicles.

[0125] The therapeutic agents of this invention target cells in the brain and / or spinal cord, including but not limited to neurons (e.g., motor neurons, sensory neurons, dopaminergic neurons, cholinergic neurons, glutamatergic neurons, GABAergic neurons, or serotonergic neurons); glial cells (e.g., oligodendrocytes, stellate cells, pericytes, Schwann cells, or microglial cells); ependymal cells; or neuroepithelial cells. The targeted brain regions may be the cortex, frontotemporal lobe, entorhinal cortex, hippocampus, cerebellum, pons, and medulla oblongata. These regions can be reached directly via intrahippocampal injection, intracerebral injection, intracisional injection (ICM), or more generally via intraparenchymal injection, intraventricular injection (ICV), intrathecal injection, or intravenous injection. Other routes of administration include, but are not limited to, intracerebral, intraventricular, intranasal, or intraocular administration. In some embodiments, the viral vector spreads throughout the CNS tissue after administration, for example, directly to the cerebrospinal fluid (CSF) via intrathecal and / or intracerebral injection, intracisional injection, or intraventricular injection. In other embodiments, after intravenous administration, the viral vector crosses the blood-brain barrier and achieves widespread distribution throughout the subject's CNS tissue. In other embodiments, the viral vector is delivered directly to the target area via intraparenchymal injection. In some cases, after intraparenchymal delivery, the viral vector may undergo retrograde or anterograde transport to reach other brain regions. In some aspects, the viral vector possesses unique CNS tissue targeting capabilities (e.g., CNS tissue tropism), enabling stable and non-toxic gene transfer with high efficiency.

[0126] For example, the drug composition can be administered to a patient via intraventricular administration, such as to the ventricular regions of the patient's forebrain, including the right ventricle, left ventricle, third ventricle, or fourth ventricle. The drug composition can also be administered intracerebrally, such as by injection into or near the cerebrum, medulla oblongata, pons, cerebellum, intracranial cavity, meninges, dura mater, arachnoid membrane, or pia mater. In some cases, intracerebral administration may include administering the drug into the cerebrospinal fluid (CSF) surrounding the subarachnoid space of the brain.

[0127] In some cases, intracerebral administration involves stereotactic surgical injection. Stereotactic surgery is well known in this field and typically involves the use of a computer and a 3D scanning device, which together guide the injection to a specific intracerebral region, such as the ventricle. Microinjection pumps (e.g., from World Precision Instruments) may also be used. In some cases, microinjection pumps are used to deliver compositions containing viral vectors. In some cases, the infusion rate of the composition ranges from 1 μL / min to 100 μL / min. As those skilled in the art will understand, the infusion rate will depend on a variety of factors, including, for example, the subject's age, weight / size, AAV serotype, required dose, and the targeted intracerebral region. Therefore, those skilled in the art may consider other infusion rates appropriate in certain settings.

[0128] rAAV can be delivered to the subject, for example, via intravenous administration. In some cases, it may be necessary to deliver rAAV locally to brain tissue, spinal cord, cerebrospinal fluid (CSF), neurons, glial cells, meninges, stellate cells, oligodendrocytes, interstitial spaces, and the like. In some cases, recombinant AAV (e.g., 10) can be delivered to the ventricles and / or to the hippocampus, cortex, cerebellar lobules, or other brain regions. 7 -10 15 AAV (volume / dose) can be delivered directly to the CNS. AAV can be delivered using needles, catheters, or related devices, employing neurosurgical techniques known in the art, such as stereotactic injection. See, for example, Stein et al., J Vir. (1999) 73:3424-9; Davidson et al., PNAS. (2000) 97:3428-32; Davidson et al., Nat Genet. (1993) 3:219-223; and Alisky and Davidson, Hum. Gene Ther. (2000) 11:2315-29; U.S. Patents 7,837,668 and 8,092,429.

[0129] Unless otherwise defined herein, scientific and technical terms used in connection with this invention will have the meanings commonly understood by those skilled in the art. Illustrative methods and substances are described below, but similar or equivalent methods and substances may also be used to practice or test this invention. In case of conflict, this specification (including definitions) shall prevail. Generally, the nomenclature and techniques described herein, combined with those used in neurology, medicine, medical and pharmaceutical chemistry, and cell biology, are well known and commonly used in this art. Enzymatic reactions and purification techniques are performed according to the manufacturer's instructions as commonly practiced in this art or as described herein. Furthermore, unless the context otherwise requires, singular terms shall include plural and plural terms shall include singular. Throughout this specification and embodiments, the words “have” and “comprise”, or variations such as “has / having” and “comprises / comprising,” shall be understood to imply inclusion of the integers or groups of integers stated herein, but do not exclude any other integers or groups of integers. All disclosures and other references mentioned herein are incorporated herein by reference in their entirety. Although multiple documents are cited herein, such citations do not constitute a license for any of those documents to form part of common general knowledge in the art. As used herein, the terms “approximately” or “about” when applied to one or more values ​​of interest mean a value similar to the stated reference value. In some embodiments, unless otherwise stated or otherwise apparent from the context, the term refers to a range of values ​​(greater than or less than) 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in any direction of the stated reference value.

[0130] To enable a better understanding of the present invention, the following embodiments and examples are provided. These embodiments and examples are for illustrative purposes only and should not be construed as limiting the scope of the present invention in any way.

[0131] IV. Exemplary Embodiments

[0132] Non-limiting exemplary embodiments of the present invention are described below.

[0133] 1. A method for inhibiting sense and / or antisense transcription of the C9orf72 gene in a cell, the method comprising treating the cell with one or more C9orf72 gene inhibitors, the one or more inhibitors comprising a transcriptional repressor domain and a DNA-binding domain that binds to a target site in the C9orf72 gene, optionally wherein the one or more inhibitors comprise one or more zinc finger protein transcription factors (ZFP-TF), one or more TAL effector domain transcription factors (TALE-TF), and / or one or more CRISPR / Cas transcription factors.

[0134] 2. The method of embodiment 1, wherein the C9orf72 gene comprises a mutant allele including one or more amplified (G4C2) repeat sequences, optionally wherein the target site is within one or more amplified (G4C2) repeat sequences.

[0135] 3. Use of one or more ZFP-TF, TALE-TF and / or CRISPR / CasTF repressors that bind to mutant C9orf72 amplified alleles containing one or more (G4C2) repeat sequences for the purpose of inhibiting sense and / or antisense transcription in subjects in need.

[0136] 4. The method or use as described in any of the foregoing embodiments, wherein antisense transcription is suppressed by at least 50% compared to untreated cells.

[0137] 5. The method or use as described in any of the foregoing embodiments, wherein antisense transcription is suppressed by at least 70% compared to untreated cells.

[0138] 6. The method or use as described in any of the foregoing embodiments, wherein the transcript comprising the amplified repetitive sequence is selectively repressed, optionally wherein antisense transcription is repressed, sense transcription from the 1a promoter is repressed and / or sense transcription from the 1b promoter is not repressed.

[0139] 7. The method or use as described in any of the foregoing embodiments, wherein the one or more ZFP-TF inhibitors comprise ZFPs having recognizing helical regions in the order shown in Table 1.

[0140] 8. The method or use as described in any of the foregoing embodiments, wherein the one or more ZFP-TF inhibitors are administered to the cells in mRNA form or using a viral vector.

[0141] 9. As in the method or use described in implementation 8, wherein the viral vector is an Ad or AAV vector.

[0142] 10. As in the method or use of embodiment 9, wherein the AAV carrier is an AAV2 / 9 carrier.

[0143] 11. The method or use as described in any of the foregoing embodiments, wherein the cells are in a live subject and the one or more ZFP-TF inhibitors are administered to the subject.

[0144] 12. The method or use as described in embodiment 11, wherein one or more ZFP-TF inhibitors are administered intravenously, intrathecally, intracranially, retro-orbital (RO), intravenously, intranasally, and / or intracisionally to the subject.

[0145] 13. The method or use of embodiment 12, wherein the ZFP-TF inhibitor is administered to one or both sides of the hippocampus of the subject, optionally using an AAV carrier at a dose of 1E10 to 1E13 (e.g., 6E11) vg / hemispheric.

[0146] 14. The method or use as described in any of the foregoing embodiments, wherein the cell is a neuron.

[0147] 15. The method or use as described in any of the previous embodiments, wherein two or more ZFP-TF inhibitors are applied.

[0148] 16. The method or use as described in embodiment 15, wherein the two or more ZFP-TF inhibitors are loaded on the same or different non-viral or viral vectors.

[0149] 17. The method or use as described in any of the foregoing embodiments, wherein the subject's ALS and / or FTD is treated.

[0150] 18. The method or use as described in any of the foregoing embodiments, wherein one or more symptoms of ALS and / or FTD are improved in the subject.

[0151] 19. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 78021.

[0152] 20. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75114.

[0153] 21. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75115.

[0154] 22. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 74969.

[0155] 23. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79895.

[0156] 24. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79898.

[0157] 25. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 74986.

[0158] 26. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79899.

[0159] 27. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79901.

[0160] 28. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79902.

[0161] 29. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79904.

[0162] 30. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79916.

[0163] 31. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 75027.

[0164] 32. A ZFP-TF fusion protein that binds to a target sequence and includes a zinc finger corresponding to an SBS ID as shown in Table 1, the zinc finger including a DNA-binding (recognition) helical sequence of the SBS ID shown in a single column of Table 1, wherein the SBS ID is 79921.

[0165] 33. The ZFP-TF fusion protein of any one of embodiments 19 to 32, wherein the ZFP-TF fusion protein comprises a transcriptional repressor domain including SEQ ID NO:13.

[0166] 34. The ZFP-TF fusion protein of any one of embodiments 19 to 33, wherein the zinc finger domain and the transcription repressor domain are linked by a peptide linker comprising SEQ ID NO:26.

[0167] Non-limiting exemplary embodiments of the present invention are further described below.

[0168] 1. A fusion protein comprising a zinc finger protein (ZFP) domain and a transcriptional repressor domain, wherein the ZFP domain binds to a target region in an intronic segment between exon 1a and exon 1b of a mutant allele of the human C9orf72 gene, wherein the target region contains more than 30 tandem repeat sequences of G4C2 (SEQ ID NO:1).

[0169] 2. The fusion protein of embodiment 1, wherein the fusion protein inhibits the transcription of mRNA containing repetitive sequences from the mutant allele, and does not inhibit the transcription of wild-type mRNA from the gene.

[0170] 3. The fusion protein of embodiment 1 or 2, wherein the ZFP domain binds to a sense sequence in the target region, wherein the sense sequence comprises one to three tandem repeats of the following six nucleotides: GGGGCC (SEQ ID NO:1), GGGCCG (SEQ ID NO:2), GGCCGG (SEQ ID NO:3), GCCGGG (SEQ ID NO:4), CCGGGG (SEQ ID NO:5), or CGGGGC (SEQ ID NO:6).

[0171] 4. A fusion protein as described in any one of embodiments 1 to 3, wherein the fusion protein inhibits positive transcription of the mutant C9orf72 allele in human cells.

[0172] 5. The fusion protein of embodiment 4, wherein the fusion protein inhibits positive transcription from the C9orf72 1a promoter and does not inhibit positive transcription from the C9orf72 1b promoter.

[0173] 6. The fusion protein of embodiment 1 or 2, wherein the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of the following six nucleotides: GGCCCC (SEQ ID NO:7), GCCCCG (SEQ ID NO:8), CCCGG (SEQ ID NO:9), CCCGGC (SEQ ID NO:10), CCGGCC (SEQ ID NO:11), or CGGCCC (SEQ ID NO:12).

[0174] 7. The fusion protein of any of the foregoing embodiments, wherein the fusion protein inhibits antisense transcription from the mutant C9orf72 allele in human cells.

[0175] 8. The fusion protein of any of the foregoing embodiments, wherein the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 allele in human cells.

[0176] 9. The fusion protein of any of the foregoing embodiments, wherein the fusion protein represses at least about 30%, 40%, 75%, 90%, or 95% of the positive and / or negative transcription from the mutant C9orf72 allele, optionally wherein the fusion protein does not repress the positive transcription from the C9orf72 1b promoter.

[0177] 10. The fusion protein of any of the foregoing embodiments, wherein the ZFP domain

[0178] It contains six zinc fingers;

[0179] Combined with the target sequences shown in Table 1; and / or

[0180] The six zinc finger sequences of the ZFP transcription factors shown in Table 1 may optionally contain one or more mutations to the extrahelical residues as indicated in Table 1.

[0181] 11. The fusion protein of any of the foregoing embodiments, wherein the transcriptional repressor domain comprises a KRAB domain amino acid sequence from human KOX1.

[0182] 12. The fusion protein of any of the foregoing embodiments, wherein the ZFP domain is linked to the transcription repressor domain via a peptide linker.

[0183] 13. A nucleic acid construct comprising a coding sequence of a fusion protein as described in any one of embodiments 1 to 12, wherein the coding sequence is operatively linked to a transcriptional regulatory element.

[0184] 14. The nucleic acid construct of embodiment 13, wherein the transcriptional regulatory element is a mammalian promoter that is constitutively active or inducible in brain cells, optionally wherein the promoter is the human synaptic protein I promoter.

[0185] 15. A nucleic acid construct as described in embodiment 13 or 14, wherein the construct is a viral construct, optionally wherein the viral construct is a recombinant adeno-associated virus construct.

[0186] 16. A host cell comprising a nucleic acid construct as described in any one of embodiments 13 to 15.

[0187] 17. The host cell of embodiment 16, wherein the host cell is a human cell.

[0188] 18. The host cell of embodiment 17, wherein the human cell is a neuron or a pluripotent stem cell, wherein the stem cell is optionally an embryonic stem cell or an induced pluripotent stem cell (iPSC).

[0189] 19. A recombinant virus comprising a nucleic acid construct as described in embodiment 15, wherein optionally the recombinant virus is a recombinant adeno-associated virus (rAAV).

[0190] 20. A pharmaceutical composition comprising a nucleic acid construct as described in any one of embodiments 13 to 15, or a recombinant virus as described in embodiment 19, and a pharmaceutically acceptable carrier.

[0191] 21. A method for inhibiting transcription of a mutant allele of the C9orf72 gene in human cells, wherein the mutant allele contains an amplified G4C2 (SEQ ID NO: 1) repeat sequence region in an intronic region between exon 1a and exon 1b, the method comprising introducing into the cells a fusion protein as described in any one of embodiments 1 to 12, a nucleic acid construct as described in any one of embodiments 13 to 15, a recombinant virus as described in embodiment 19, or a pharmaceutical composition as described in embodiment 20.

[0192] 22. The method of embodiment 21, wherein the human cell is a neuron, glial cell, ependymal cell, or neuroepithelial cell.

[0193] 23. The method of embodiment 21 or 22, wherein the cells are in the brain or spinal cord of a patient suffering from a C9orf72-related condition, optionally selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD).

[0194] 24. A method for treating a patient with a C9orf72-related condition, optionally selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD), the method comprising introducing the patient with a fusion protein as described in any one of embodiments 1 to 12, a nucleic acid construct as described in any one of embodiments 13 to 15, a recombinant virus as described in embodiment 19, or a pharmaceutical composition as described in embodiment 20.

[0195] 25. The method of any one of embodiments 21 to 24, wherein the fusion protein is introduced via a recombinant virus expressing the fusion protein.

[0196] 26. The method of embodiment 25, wherein the recombinant virus is an adeno-associated virus (AAV), the adeno-associated virus optionally having serotype 9 or pseudotype AAV2 / 9 or AAV2 / 6 / 9.

[0197] 27. The method of embodiment 25 or 26, wherein the recombinant virus is administered to the patient via intraventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisional routes.

[0198] 28. The method of any one of embodiments 21 to 27, wherein two or more fusion proteins of any one of embodiments 1 to 12 are introduced, optionally wherein the coding sequences of said two or more fusion proteins are on the same recombinant viral vector.

[0199] 29. A fusion protein of any one of embodiments 1 to 12, a nucleic acid construct of any one of embodiments 13 to 15, a recombinant virus of embodiment 19, or a pharmaceutical composition of embodiment 20, used in any one of embodiments 21 to 28.

[0200] 30. Use of a nucleic acid construct as described in any one of embodiments 13 to 15 or a recombinant virus as described in embodiment 19 for the preparation of a medicament for treating a patient in need in a method as described in any one of embodiments 21 to 28. Example

[0201] Example 1: Artificial Transcription Repressor

[0202] A set of ZFP-TFs was generated to target and amplify the human C9orf72 allele. Exemplary ZFP-TFs are shown in Table 1 below. Each of these ZFP-TFs contains a ZFP domain with six fingers and a KRAB domain as described above (SEQ ID NO:13). A peptide linker is used to ligate the ZFP domain to the KRAB domain. The linker has the following amino acid sequence: LRQKDAARGS (SEQ ID NO:26).

[0203] Table 1 shows the DNA sequence of the target site in each ZFP-TF and the amino acid sequence of the DNA-binding helix of each zinc finger (F1 to F6). SEQ ID NO is shown in parentheses. Target sequences bound by the ZFP domain at the target site are shown in uppercase letters, while flanking sequences are shown in lowercase letters. SEQ ID NO:24 is the target site on the sense strand of the gene allele, and SEQ ID NO:25 is the target site on the antisense strand of the gene allele.

[0204] The DNA-binding helix is ​​a variable portion of the zinc finger and typically contains six or seven amino acid residues. As described, for example, in U.S. Patent Publication 2018 / 0087072, the target specificity of the ZFP domain can be increased by mutating the ZFP backbone. The symbol “^” in the table indicates that the arginine (R) residue at position 4 upstream of the first amino acid in the designated helix is ​​replaced with glutamine (Q). In each zinc finger helical sequence, the positions of the seven DNA-binding amino acids are numbered -1, +1, +2, +3, +4, +5, and +6. Therefore, the position for the R to Q substitution is numbered (-5).

[0205] Table 1 Exemplary C9orf72ZFP-TF

[0206]

[0207]

[0208]

[0209]

[0210] ZFP-TFs were evaluated using standard SELEX analysis (see, for example, Miller et al., Nat Biotech. (2010) doi:10.1038 / nbt.1755; Wilen et al., PLoS (2011) 7(4):e1002020). The results showed that all ZFP-TFs bound to their target sites.

[0211] Five human cell lines and one mouse cell line were used in the study. The C9021 fibroblast cell line (obtained from the Columbia University ALS Institute) was derived from ALS-FTD patients. This cell line contains five G4C2 repeat sequences in its normal allele and approximately 850 repeat sequences in its amplified allele. Wild-type fibroblast cell lines (NDS00035), 353TRAD, and 204TDP fibroblast cell lines were obtained from the National Institute of Neurological Disorders and Stroke. The wild-type line contains two G4C2 repeat sequences in each allele. The 353TRAD line contains five repeat sequences in one allele and eight repeat sequences in another. The 204TDP line has two repeat sequences in one allele and 20 repeat sequences in another. For all fibroblast experiments, human neuron lines were obtained from Cell Dynamics International (iCell GABANeurons kit, 01434; catalog number R1013; cell batch number 104901). Mouse cortical neurons were obtained from GIBCO (catalog number A15586). ZFP74960, which binds to its target region but does not have an observable inhibitory effect, was used as a negative control.

[0212] For all experiments performed in patient-derived fibroblasts, ZFP-TF mRNA was transfected into cells using a 96-well Shuttle Nucleofector system from Lonza. ZFP-TF mRNA was transfected at doses of 1, 3, 10, 30, 100, and 300 ng per 40,000 cells using the Amaxa P2 Primary Cells Nucleofector kit with the CA-137 program. After overnight incubation, cDNA was generated from transfected cells using the Cells-to-Ct kit (Thermo Fisher Scientific), followed by qRT-PCR for gene expression analysis.

[0213] For neuronal transduction, ZFP was incorporated into the AAV6 plasmid. Neurons were transduced using AAV6-ZFP. All transductions were performed at 3,000 MOI. Mouse neurons were collected 7 days post-transduction, while human neurons were collected 19 days post-transduction. After cell collection, cells were processed for microarray analysis.

[0214] Screening analyses were performed in multiple rounds. In each round, ZFP was tested at multiple concentrations to identify ZFP-TFs with a suitable on-target (selective inhibition) pattern. A second round of screening was performed in C9 (C9021) cells to assess the amplified positive transcript (disease) C9orf72 level relative to total C9orf72 (“total C9”) mature mRNA after ZFP-TF treatment. RT-PCR analysis used a primer / probe set targeting intron region 1a.

[0215] Amplification of positive C9orf72 transcript:

[0216] Positive: 5' CCCTCTCTCCCCACTACTTG 3' (SEQ ID NO:61)

[0217] Reverse: 5' CTACAGGCTGCGGTTGTTTCC 3' (SEQ ID NO:62)

[0218] Probe: 5' TCTCACAGTACTCGCTGAGGGTGA 3' (SEQ ID NO:63).

[0219] G4C2 amplification leads to inefficient splicing and accumulation of amplified precursor mRNA. Figure 2A In contrast, highly spliced ​​wild-type (WT) precursor mRNA was present at extremely low levels. By using this analysis in C9021 cells, we showed that the ZFP-TF tested exhibited broad-spectrum inhibition of amplified positive (disease) C9orf72 transcripts. Figures 2B-2D ).

[0220] To evaluate the inhibition of total C9orf72 mRNA, different primer / probe sets were used, denoted as "total C9" (…). Figure 2A ):

[0221] Total C9orf72 mRNA:

[0222] Positive: 5' CTATGTGTGTGGTGGGATATGG 3' (SEQ ID NO:58)

[0223] Reverse: 5' CTCCAGGTTATGTGAAGCAGAA 3' (SEQ ID NO:59)

[0224] Probe: 5' AGGCCTGCTAAAGGATTCAACTGGAA 3' (SEQ ID NO:60).

[0225] This primer / probe set detects mRNAs containing a region spanning exons 8 and 9. This region is present in all C9orf72 mRNA isoforms. As shown in Figure 2b, many ZFP-TFs exhibit moderate inhibition of total C9orf72 transcripts. For example, ZFP-TFs 75114 and 75115 inhibited the amplification of positive (disease) transcripts by more than 70% while maintaining total C9orf72 mRNA expression by more than 50%. Figure 2D (Data from the second round).

[0226] In round 3, total C9orf72 mRNA was assessed and compared between C9021 cells and wild-type (WT) cells to further evaluate the effect of the tested ZFP-TF on the amount of total C9orf72 mRNA. Data showed a significantly greater reduction in total C9orf72 mRNA levels in mutant cells compared to WT cells. Figures 2B-2D Furthermore, the levels were significantly less affected in wild-type cells treated with the same ZFP-TF. Overall, the data indicate that for some ZFPs, such as 75109, 75114, and 75115, amplification of isotypes was significantly inhibited (approximately 70%), while maintaining approximately 50% of total C9 transcripts in C9 patient fibroblast cell lines.

[0227] Isotype-selective inhibition of ZFP-TF75109, 75114, and 75115 was evaluated in fibroblasts from three different patient sources, which contained different G4C2 amplified repeat sequences (600, 800, and 850) on their amplified alleles. Figure 6 All three ZFPs exhibited similar behavior independent of the length of the repeat amplification, indicating that the selective inhibition of ZFP-TF is independent of the length of the G4C2 repeat.

[0228] The inhibition of total C9 transcripts was assessed in two cell lines derived from healthy individuals, wherein the number of G4C2 repeat sequences in their alleles was greater than normal. Figure 7 In healthy cell lines, total C9 transcripts were minimally affected. ZFP-mediated inhibition of total C9 mRNA transcripts in the patient-derived cell line (C9021) does not truly represent WT isotype levels because PCR analysis to detect target exons 8 and 9 of total C9 mRNA transcripts showed that they were absent in both amplified and non-amplified (WT) isotypes. Figure 2A The repression of total C9 mRNA transcripts in response to isotype-selective ZFP-TF (75109, 75114, and 75115) was evaluated in two different healthy cell lines with different G4C2 repeat lengths on the alleles. Figure 7Cell line 353TREAD has 5 repeat sequences on one allele and 8 repeat sequences on another allele, while cell line 204TDP has 2 repeat sequences on one allele and 20 repeat sequences on another allele. Although total C9 mRNA transcripts were dose-dependently suppressed in the C9 cell line C921 (5 repeat sequences on the non-amplified allele and 850 repeat sequences on the amplified allele), they were minimally affected in the other two cell lines without amplified alleles, indicating that the suppression of total C9 isotypes in the disease lines (5 / 850) is a result of suppression of amplified isotypes, and that expression of non-amplified isotypes is not affected by selective ZFP-TF. Figure 7 ).

[0229] Without being bound by theory, it is possible that the ZFP-TFs of this invention could function cooperatively to selectively repress alleles with numerous repetitive sequences. This could be mediated by higher-order complexes, for example, via the recruitment of KAP1 co-repressors associated with the KRAB domain linked to the ZFP. Under this assumption, a KAP1 / KRAB "scaffold" spanning multiple ZFP-TFs enhances the stability of the transcriptional repression mechanism and enables preferential repression of the amplified C9orf72 allele compared to the wild-type allele.

[0230] Example 2: Specificity of C9orf72 inhibition

[0231] The global specificity of ZFP-TF shown in Table 1 was evaluated using microarray analysis in three cell lines: C9021 fibroblasts, primary mouse cortical neurons, and human neurons. In short, for C9021 cells, 100 ng of ZFP-TF-encoded mRNA was transfected in quadruplicate into 150,000 C9021 cells. Twenty-four hours later, total RNA was extracted and processed using the manufacturer's protocol (Affymetrix Genechip MTA1.0). Robust multi-array average (RMA) was used to normalize the raw signals from each probe set. Analysis was performed using the "Gene Level Differential Expression Analysis" option in Transcriptome Analysis Console 3.0 (Affymetrix). Samples transfected with ZFP-TF were compared with samples treated with unrelated ZFP-TF (ZFP-TF that does not bind to the C9orf72 target site). Transcript (probe set) reporter changes were called for a mean signal >2-fold difference relative to the control and a p-value <0.05 (one-way variance analysis, unpaired t-test for each probe set). A similar procedure was performed on neurons, except that they were transduced with AAV6 at 3000 MOI and cultured for 7 days in mouse neurons and 19 days in human neurons before collection.

[0232] Example data shows that Figures 8A-8C Data showed that ZFP-TF75027 exhibited several off-target effects, except for C9orf72 (shown as circled areas), while ZFP-TF75109, 75114, and 75115 only inhibited C9orf72, showing very little off-target effect in both human and mouse fibroblasts and neurons. These results demonstrate that representative ZFP-TFs have high specificity for C9orf72.

[0233] Example 3: Detection of antisense-specific inhibition

[0234] Because both sense and antisense transcripts are encoded by overlapping regions of DNA, we developed a detection strategy based on differential processing of transcripts. For sense mRNAs derived from amplified alleles, the intron containing the amplified region (intron 1a) is misspliced ​​and retained, while all other introns are removed, including intron 1b. In contrast, the intron 1b region is the predicted exon of the antisense mRNA transcript and should be retained. Therefore, we designed and tested primers located within intron 1b that exhibited specific detection of antisense transcripts, as described further below.

[0235] To detect C9orf72 transcripts, we used droplet digital PCR (ddPCR). In short, to establish a sense or antisense cDNA template, RNA was purified from C9orf72 patient and healthy control cells (C9orf72 cell lines: C9-3, C9-6, C9-7, C9-5, C9-10, C9-11, C9-2, C9-4; control cell lines: KinALS6, Con3, Kin1ALS17, Con8, Con10, Con1; see Lagier-Tourenne et al., PNAS (2013) 110(47):E4530-9), and this RNA was used to synthesize cDNA using the Superscript III (Thermo Fischer Scientific) first-strand synthesis system as follows:

[0236] 1) Mix 0.5 µg RNA, 0.5 µL of 10 mM strand-specific primers and dNTP mixture, and dilute with water to 10 µL. Primer 5'CTCTAGCGACTGGTGGAATTG3' (SEQ ID NO:64) was used to generate the sense template. Primer 5'GTGCATGGCAACTGTTTGAATA3' (SEQ ID NO:65) was used to generate the antisense template.

[0237] 2) Incubate this reactant at 65°C for 5 minutes to denature it, and place it on ice for at least 1 minute.

[0238] 3) Prepare the cDNA synthesis mixture using these reagents: 10xRT buffer (2 µL); 25 mM MgCl2 (4 µL); 0.1 M DTT (2 µL); RNase OUT (1 µL); Superscript III (1 µL).

[0239] 4) Add 10 µL of this reactant to the RNA mixture and incubate at 50°C for 50 minutes. Then inactivate the reactant by incubating at 85°C for 5 minutes.

[0240] The template was then subjected to ddPCR using labeled probes according to the manufacturer's protocol. In short, PCR was performed using probes in an ABI PCR 96-well plate with dUTP-free ddPCR ultramix (Bio-Rad). The PCR master mixture was prepared according to the manufacturer's instructions. The following shows the antisense primer-probe set located on intron 1b region (…). Figure 3 ).

[0241] Positive: 5' CAAAGCCTGGTGGTGTTCAA 3' (SEQ ID NO:66)

[0242] Reverse: 5' GGACATGACCTGGTTGCTTC 3' (SEQ ID NO:67)

[0243] Probe: 5' CGCGGCCAGATAGACCCAATGAGCA 3' (SEQ ID NO:68).

[0244] The reaction is set as follows:

[0245] 1) Distribute the entire master mixture evenly into 8 wells of an ABI PCR culture plate.

[0246] 2) Add 10 µL of 1:10 diluted RT reactant or water to the sample well.

[0247] 3) Transfer 15 µL of the master mixture into the well containing RT.

[0248] 4) Seal the culture plate, vortex and briefly centrifuge.

[0249] To prepare droplets, use a tube as follows:

[0250] 1) Place 70 µL of probe oil in the well labeled "oil" and 20 µL of ddPCR reaction product in the well labeled "sample".

[0251] 2) Place the rubber pad on top of the cylinder.

[0252] 3) Transfer 40 µL of the solution to a fresh Eppendorf 96-well plate. Seal the plate with aluminum foil and perform PCR according to the manufacturer's protocol.

[0253] Data showed that in the C9orf72 fibroblast cell line, these primers amplified exons in the antisense amplification precursor mRNA (C9-AS), and the complementary region was absent in the sense region (C9-S). Figure 4A Therefore, in this study, the antisense precursor mRNA was specifically detected using ddPCR antisense primers. Compared to six different control fibroblasts, the antisense precursor mRNA level was significantly elevated in seven different fibroblasts derived from C9 patients. Figure 4B ).

[0254] Example 4: Amplification of allele-sense and antisense precursor mRNA repression

[0255] To test the activity of ZFP-TF inhibitors against amplified alleles, cells were treated with ZFP-TF 74949, 74978, 75003, 75027, 75109, 75114, 75115, 74967 (Table 1) or 74960 (negative control), as described above. ZFP-TF-mediated inhibition was assessed by two independent PCR analyses performed by researchers unaware of the sample order. Different primers / probes were used for each analysis. Figures 5A-5C ).

[0256] For operations 1 and 2, the measurements of positive amplification, antisense amplification, and total C9 are performed as described above, with the exception that amplification is performed using random hexamers and primers shown below, according to the standard protocol in this technique:

[0257] Antisense amplification of C9orf72 precursor mRNA ( Figure 5B As shown in Example 3 above.

[0258] Positive amplification of C9orf72 precursor mRNA ( Figure 5A This primer / probe set can detect mRNAs containing regions that span exon 1a and intron 1a.

[0259] Positive: 5' ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO:69)

[0260] Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO:70)

[0261] Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO:71).

[0262] Total C9orf72 mRNA ( Figure 5C This primer / probe set can detect mRNA containing regions within exon 2.

[0263] Positive: 5'TGTGACAGTTGGAATGCAGTGA 3' (SEQ ID NO:72)

[0264] Reverse: 5' GCCACTTAAAGCAATCTCTGTCTTG 3' (SEQ ID NO:73)

[0265] Probe: 5' TCGACTCTTTGCCCACCGCCA 3' (SEQ ID NO:74).

[0266] Operation No. 3 (Figure 5A and Figure 5C Using the primers shown in Example 1 above ( Figures 2B-2D For antisense disease transcripts, the following primers / probes are used to detect intron region 1b( Figure 5B ).

[0267] Positive: 5' CAGCTTCGGTCAGAGAAATGAG 3' (SEQ ID NO:78)

[0268] Reverse: 5' AAGAGGCGCGGGTAGAA 3' (SEQ ID NO:79)

[0269] Probe: 5' CTCTCCTCAGAGCTCGACGCATTT 3' (SEQ ID NO:80).

[0270] Despite the use of different primer / probe sets and different PCR analyses (operations 1 and 2 were performed using similar analyses, but different from operation 3), the data were consistent and the inhibition levels were comparable.

[0271] In summary, all operations consistently demonstrate that some ZFP-TFs can strongly suppress all three transcripts (sense, antisense, and total) (e.g., ZFP-TF74978, 75003, and 75027), while some ZFP-TFs (e.g., ZFP-TF75109, 75114, and 75115) selectively suppress sense and antisense disease transcripts while maintaining total C9 transcripts (selective suppression).

[0272] Example 5: Regulation of human C9orf72 in neurons of BACC9orf72 gene transgenic mice

[0273] All inhibitors targeting BAC mouse C9orf72 were cloned into the rAAV6 vector using a CMV promoter that drives expression. Recombinant AAV was generated in HEK293T cells, purified using a CsCl density-gradient, and titrated by real-time qPCR according to methods known in the art. Cultured primary mouse cortical neurons were infected with the purified virus at 3E5, 1E5, 3E4, and 1E4 Vg / cell. After 7 days, total RNA was extracted, and the expression of C9orf72 sense and antisense transcripts, as well as two reference genes (e.g., Atp5b and Eif4a2), was monitored using RT-qPCR.

[0274] All ZFP-TF-encoded AAV vectors effectively inhibited their target in mouse cells over a wide range of infectious doses, with some ZFPs reducing the target by more than 95% at multiple doses. In contrast, no gene inhibition was observed with CMV-GFPrAAV6 virus tested at equivalent doses, or with pseudo-treated neurons.

[0275] Example 6: In vivo gene repression driven by ZFP-TF delivered by AAV

[0276] The C9orf72 BAC gene transgenic mice used for the target conjugation study contained 98kb of human transgenic gene, which contained the full-length C9orf72 gene allele with approximately 500 G4C2 repeat sequences and substantial side-joint sequences (Liu et al., Neuron (2016) 90(3):521-34). Two ZFP-TFs, ZFP-TF75027 or ZFP-TF75114, were selected for this study, and their potency differed (ZFP-TF75027 was more efficient). Figure 2D The expression cassettes of both fusion proteins were cloned into an rAAV vector containing a synaptic promoter driving expression and the coding sequence of a self-cleaving peptide (e.g., a 2A peptide, such as T2A or P2A), followed by a Venus tag for measuring biodistribution. Figure 9A rAAV was produced in HEK293T cells and titrated on the ITR using primers via ddPCR.

[0277] To evaluate the effect of ZFP-TF expression on the inhibition of amplified sense and antisense transcripts in vivo, ZFP-TFrAAV was delivered to P0C9-BAC or WT mice via intraventricular (ICV) injection. In short, PBS or ZFP-TF75027 rAAV or ZFP-TF 75114 rAAV (total dose 2E10Vg / ventricle) were administered bilaterally (2 µl / ventricle) to neonatal C9-BAC mice (for repeat sequence length matching) or WT mice. Figure 9C Four weeks after injection, animals were sacrificed, and one hemisphere was embedded for RNA aggregation site analysis. The other hemisphere was microscopically dissected into the cortex, hippocampus, and cerebellum for further analysis. Figure 9B Quantitative analysis of the viral genome, Venus mRNA, and proteins showed a wide biological distribution, and the transduction and expression of ZFP-TF 75027 and ZFP-TF 75114 were equivalent.

[0278] Total RNA was extracted from cortical and hippocampal tissues, and cDNA was prepared using the iScript cDNA Synthesis Kit (BioRad). ddPCR was performed to measure the expression of transcripts containing sense and antisense amplifications, and the total C9 mRNA level normalized relative to mouse TBP. Primers used for this analysis were:

[0279] Total C9 mRNA:

[0280] Positive: 5'TGTGACAGTTGGAATGCAGTGA3' (SEQ ID NO:72)

[0281] Reverse: 5'GCCACTTAAAGCAATCTCTGTCTTG3' (SEQ ID NO:73)

[0282] Probe: 5'TCGACTCTTTGCCCACCGCCA3' (SEQ ID NO:74).

[0283] Positive amplification of precursor mRNA:

[0284] Positive: 5' ACTACTTGCTCTCACAGTACTCG 3' (SEQ ID NO:69)

[0285] Reverse: 5' TAGCGCGCGACTCCTGAGTTCC 3' (SEQ ID NO:70)

[0286] Probe: 5' AGGGAAACAACCGCAGCCTGTAGCAAGCTC 3' (SEQ ID NO:71).

[0287] Antisense amplification of precursor mRNA:

[0288] Positive: 5'AGTCGCTAGAGGCGAAAGC3' (SEQ ID NO:81)

[0289] Reverse: 5'CGAGTGGGTGAGTGAGGAG3' (SEQ ID NO:82)

[0290] Probe: 5'AAGAGGCGCGGGTAGAAGCGGGGC3' (SEQ ID NO:83).

[0291] Data showed that, compared to the control group injected with PBS, ZFP-TF75027 inhibited the amount of total C9 mRNA and the amount of positive and negative amplified transcripts in the hippocampus and cortex of C9-BAC animals. Figure 9D(Selective inhibition could not be observed in this animal model because the transgenic mice do not contain the WT human C9orf72 allele and the mouse C9orf72 gene does not contain the G4C2 repeat sequence). No inhibition was observed in the ZFP-TF 75114 case.

[0292] In addition, fluorescence in situ hybridization was used to measure the amount of positive and negative RNA aggregates (aggregates) observed in the hippocampus after ZFP-TF injection. Figure 9E In short, 10 μm sections were hybridized with fluorescently labeled probes: 5'GGCCCCGGCCCCGGCCCC-Cy3 (SEQ ID NO:84) was used to measure positive RNA aggregation points and 5'GGGGCCGGGGCCGGGGCC-Cy3 (SEQ ID NO:85) was used to measure negative RNA aggregation points. Stacked images were obtained at 40x magnification using a confocal microscope (LSM880). The number of positive and negative RNA aggregation points, normalized relative to the total number of cells, was quantified from the Amundsen angle (CA) region of the hippocampus. A lower percentage of negative RNA aggregation points was observed in animals injected with ZFP-TF75027.

[0293] These results show that ZFP-TF targeting C9orf72 can effectively inhibit the expression of pathogenic C9orf72 alleles in vivo, and differences in ZFP-TF efficacy can be observed.

Claims

1. Use of a fusion protein in the preparation of a medicament for inhibiting transcription of a mutant allele of the C9orf72 gene in human cells, the fusion protein comprising a zinc finger protein (ZFP) domain and a transcription repressor domain, wherein the ZFP domain binds to a target region in an intron region between exon 1a and exon 1b of a mutant allele of the human C9orf72 gene, wherein the target region comprises more than 30 tandem repeat sequences of G4C2 (SEQ ID NO: 1), wherein the ZFP domain comprises six recognition helical regions comprising SEQ ID NO: 46, 41, 46, 41, 46, and 41, respectively, and wherein the ZFP domain comprises an arginine-to-glutamine substitution at the -5 position of the first, second, third, and fifth recognition helices.

2. The use as claimed in claim 1, wherein the fusion protein inhibits the transcription of mRNA containing repetitive sequences from the mutant allele, and does not inhibit the transcription of wild-type mRNA from the gene.

3. The use as described in claim 1 or 2, wherein the fusion protein inhibits positive transcription from the mutant C9orf72 allele in human cells.

4. The use as described in claim 3, wherein the fusion protein inhibits positive transcription from the C9orf72 1a promoter and does not inhibit positive transcription from the C9orf72 1b promoter.

5. The use as claimed in claim 1 or 2, wherein the ZFP domain binds to an antisense sequence in the target region, wherein the antisense sequence comprises one to three tandem repeats of a hexanucleotide GCCCCG (SEQ ID NO: 8).

6. The use as claimed in claim 5, wherein the ZFP field is incorporated into SEQ ID NO:

25.

7. The use as claimed in claim 1 or claim 2, wherein the fusion protein inhibits antisense transcription from the mutant C9orf72 allele in human cells.

8. The use as described in claim 1 or claim 2, wherein the fusion protein inhibits both sense and antisense transcription from the mutant C9orf72 allele in human cells.

9. The use as claimed in claim 1 or claim 2, wherein the fusion protein represses at least about 30%, 40%, 75%, 90%, or 95% of the positive and / or negative transcription from the mutant C9orf72 allele.

10. The use as claimed in claim 9, wherein the fusion protein does not inhibit positive transcription from the C9orf72 1b promoter.

11. The use as claimed in claim 1 or claim 2, wherein the transcriptional repressor domain comprises a KRAB domain amino acid sequence from human KOX1.

12. The use as claimed in claim 1 or claim 2, wherein the ZFP domain is linked to the transcriptional repressor domain via a peptide linker.

13. The use as described in claim 1 or claim 2, wherein the human cell is a neuron, glial cell, ependymal cell, or neuroepithelial cell.

14. The use as claimed in claim 13, wherein the human cells are in the brain or spinal cord of a patient suffering from C9orf72-related disease.

15. The use as claimed in claim 14, wherein the C9orf72-related condition is selected from amyotrophic lateral sclerosis (ALS) and C9 familial frontotemporal dementia (C9FTD).

16. The use as claimed in claim 15, wherein the fusion protein is introduced via a recombinant adeno-associated virus (rAAV) expressing the fusion protein.

17. The use as claimed in claim 16, wherein the rAAV has serotype 9 or pseudotype AAV2 / 9 or AAV2 / 6 / 9.

18. The use as claimed in claim 17, wherein the rAAV is in a form suitable for administration to the patient via intraventricular, intrathecal, intracranial, retroorbital (RO), intravenous, intranasal, and / or intracisional routes.

Images