Method and composition for activating zeta-globin gene expression

Abstract

The invention discloses a method and a composition for activating zeta-globin gene expression. The method comprises the step of artificially forming an enhancer element containing an NTG-N (7-8)-WGATAR sequence or an NAA-N (7-8)-WGATAR sequence in a DNA (deoxyribonucleic acid) sense strand or an antisense strand in a promoter region of a zeta-globin gene through homologous recombination repair by using a CRISPR-Cas9 system. The invention also discloses gRNA, ssODN, a composition and a cell, and application of the gRNA, the ssODN, the composition and the cell in preparation of a medicine for treating alpha-thalassemia. According to the method, overexpression of exogenous globin genes is not needed, and the safety risk of gene therapy is reduced. Moreover, expression of the zeta-globin gene is activated, so that the method can be suitable for various types of alpha-thalassemia patients and alpha-gene deletion or mutation patients, and is not limited to alpha-thalassemia caused by a certain mutation site.

Description

Technical Field

[0001] This invention belongs to the field of biotechnology, specifically relating to a method and composition for activating ζ-globin gene expression. Background Technology

[0002] Thalassemia is a hereditary hemolytic anemia. Clinically, it is mainly classified into alpha thalassemia and beta thalassemia based on genotyping. Alpha thalassemia is caused by the deletion or mutation of the alpha gene located on chromosome 16. This deletion or mutation reduces the synthesis of alpha-globin chains, leading to impaired hemoglobin (Hb) synthesis. When only one alpha gene is deleted or mutated, these patients usually have no obvious symptoms; when two alpha genes are deleted or mutated, patients may have mild microcytic hypochromic anemia. When three alpha genes are deleted or mutated, it is the intermediate type of alpha thalassemia, also known as HbH disease. Patients with this type may have mild to moderate anemia. Non-deletion alpha thalassemia, such as Hb-CS, is the most severe, with low hemoglobin and a low survival rate. When all four alpha genes are completely deleted, it leads to severe alpha thalassemia, also known as HbBart's hydrops fetalis syndrome, in which the fetus often dies in utero or shortly after birth.

[0003] Currently, treatment strategies for moderate to severe alpha-thalassemia mainly include regular blood transfusions and iron chelation therapy, splenectomy, drug therapy, and hematopoietic stem cell transplantation. Regular blood transfusions and iron chelation therapy, by infusing normal red blood cells or plasma, provide normal hemoglobin and improve anemia, effectively alleviating symptoms, but not curing the disease. Splenectomy reduces damage to red blood cells by removing the spleen, prolonging their lifespan and improving anemia, but similarly, it cannot cure the disease. Drug therapy, such as rotezipeptide, also cannot cure the disease, requires continuous use, and has limited effectiveness; even if effective, it only reduces the frequency of transfusions. Hematopoietic stem cell transplantation is currently the only effective and only way to cure severe thalassemia, but its use is limited by the lack of HLA-matched healthy donors, immune complications, and viral vector safety issues.

[0004] With the continuous advancement of gene technology, gene therapy has made some important progress, and there are also some gene therapy methods for alpha thalassemia, such as overexpression of alpha globin, zeta globin and other genes. However, such methods have significant safety issues. For example, overexpressed globin gene copies may randomly integrate into thousands of different sites in the genome, leading to the possibility of insertional mutations and malignant tumors. Summary of the Invention

[0005] To address the technical problem of the lack of an effective and safe gene therapy for treating α-thalassemia in the prior art, the present invention provides a method and composition for activating ζ-globin gene expression.

[0006] To solve the above-mentioned technical problems, one of the technical solutions provided by the present invention is: a method for activating the expression of the ζ-globin gene for non-diagnostic / therapeutic purposes, characterized in that the method includes: using the CRISPR-Cas9 system to repair the DNA sense strand or antisense strand in the promoter region of the ζ-globin gene through homologous recombination to artificially form an enhancer element containing the NTG-N(7-8)–WGATAR sequence or the NAG-N(7-8)–WGATAR sequence;

[0007] N is A, G, C or T, W is T or A, and R is A or G;

[0008] The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

[0009] In a specific embodiment of the present invention, the sequence shown in SEQ ID NO:6 in the positive strand of the promoter region of the ζ-globin gene is edited to any of the sequences shown in SEQ ID NO:7 to 10.

[0010] In a specific embodiment of the present invention, the sequence shown in SEQ ID NO:73 in the positive strand of the promoter region of the ζ-globin gene is edited to the sequence shown in SEQ ID NO:74.

[0011] To solve the above-mentioned technical problems, the second technical solution provided by the present invention is: a gRNA, wherein the gRNA comprises a recognition site sequence and a backbone sequence, wherein the recognition site sequence is partially or completely complementary to the sense or antisense strand of the DNA in the promoter region of the ζ-globin gene, and the gRNA is used to artificially form an enhancer element comprising an NTG-N(7-8)–WGATAR sequence or a NAG-N(7-8)–WGATAR sequence in the sense or antisense strand of the promoter region of the ζ-globin gene;

[0012] N is A, G, C or T, W is T or A, and R is A or G;

[0013] The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

[0014] In a specific embodiment of the present invention, the backbone sequence is as shown in SEQ ID NO:47; and / or, the DNA sequence corresponding to the recognition site sequence is partially or completely identical to the sequence shown in SEQ ID NO:30 or SEQ ID NO:82.

[0015] In a specific embodiment of the present invention, the nucleotide sequence of the gRNA is shown in SEQ ID NO:49 or SEQ ID NO:87.

[0016] In a specific embodiment of the present invention, the gRNA includes chemical modification, which is selected from one or more of 3'-thiophosphate, 2'-O-methyl ester, 2'-O-methyl, 2'-F modification, 2'-ribose 3'-thiophosphate, deoxygenated and 5'-phosphate modification; more preferably, the three ribonucleotides at the 5' and 3' ends of the gRNA are modified with 2'-O-methyl, and the four ribonucleotides at the 5' and 3' ends are modified with thiophosphate bonds.

[0017] To solve the above-mentioned technical problems, the third technical solution provided by the present invention is: an ssODN for gene editing of the promoter region of the ζ-globin gene, wherein the ssODN contains an NTG-N(7-8)–WGATAR sequence, a NAG-N(7-8)–WGATAR sequence, a YTATCW–N(7-8)-CAN sequence or a YTATCW–N(7-8)-CTN sequence;

[0018] N is A, G, C or T, W is T or A, R is A or G, and Y is T or C;

[0019] The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

[0020] In a specific embodiment of the present invention, the ssODN includes a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm.

[0021] In a specific embodiment of the present invention, the ssODN satisfies one or more of the following conditions:

[0022] (1) The NTG-N(7-8)–WGATAR sequence, NAG-N(7-8)–WGATAR sequence, YTATCW–N(7-8)-CAN sequence or YTATCW–N(7-8)-CTN sequence in the ssODN are located at any position on the ssODN, including the substitution sequence, 5′ homologous arm, 3′ homologous arm, the junction of the 5′ homologous arm and the substitution sequence or the junction of the 3′ homologous arm and the substitution sequence;

[0023] (2) The 5′ homologous arm and the 3′ homologous arm are either symmetrical or asymmetrical;

[0024] (3) The 5′ homologous arm and / or the 3′ homologous arm are selected from the sense or antisense strand of the promoter region of the ζ-globin gene;

[0025] (4) The 3′ end of the 5′ homologous arm in the ssODN is 0-20 bases away from the 5′ end of the 3′ homologous arm;

[0026] (5) The length of the 5′ homologous arm and / or the 3′ homologous arm is 20–300 nt; and,

[0027] (6) The number of bases in the substitution sequence is 0-6.

[0028] In a specific embodiment of the present invention, the ssODN is selected from the sequence shown in SEQ ID NO:39 or SEQ ID NO:92.

[0029] In a specific embodiment of the present invention, the ssODN is chemically modified; the chemical modification is preferably performed on the 5′ end and the 3′ end of the ssODN; more preferably, it is performed on the phosphate thioester modification between the first four nucleotides at the 5′ end and the last four nucleotides at the 3′ end of the ssODN.

[0030] To solve the above-mentioned technical problems, the fourth technical solution provided by the present invention is: a composition for gene editing of the promoter region of the ζ-globin gene, wherein the composition is used to artificially form an enhancer element containing an NTG-N(7-8)–WGATAR sequence or NAG-N(7-8)–WGATAR in the sense or antisense strand of the promoter region of the ζ-globin gene, and the composition comprises:

[0031] (a) ssODN containing reinforcing sub-elements;

[0032] (b) a gRNA targeting the promoter region of the ζ-globin gene; and,

[0033] (c) CRISPR / Cas9 nuclease, mRNA encoding the CRISPR / Cas9 nuclease and / or plasmid expressing the CRISPR / Cas9 nuclease;

[0034] N is A, G, C or T, W is T or A, and R is A or G;

[0035] The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

[0036] To solve the above-mentioned technical problems, the fifth technical solution provided by the present invention is: a cell, which is obtained by transferring the composition as described in the fourth technical solution of the present invention into target cells.

[0037] In a specific embodiment of the present invention, the target cell is an erythroid progenitor cell; and / or, the target cell is a mammalian cell, such as a human cell.

[0038] In a specific embodiment of the present invention, the erythroid progenitor cells are umbilical cord blood stem cells, induced pluripotent stem cells, hematopoietic stem / progenitor cells, myeloid progenitor cells, bursting unit-erythroid cells / red blood cells, spleen colony-forming cells, embryonic cell colony-forming cells, and / or megakaryocyte-erythroid progenitor cells.

[0039] To solve the above-mentioned technical problems, the sixth technical solution provided by the present invention is: the use of gRNA as described in the second technical solution of the present invention, ssODN as described in the third technical solution of the present invention, the composition as described in the fourth technical solution of the present invention, and / or the cells as described in the fifth technical solution of the present invention in the preparation of a drug for treating α-thalassemia.

[0040] In a specific embodiment of the present invention, the α-thalassemia is moderate or severe α-thalassemia; and / or, the drug is a cell.

[0041] Based on common knowledge in the field, the above-mentioned preferred conditions can be combined arbitrarily to obtain various preferred embodiments of the present invention.

[0042] The reagents and raw materials used in this invention are all commercially available.

[0043] The positive and progressive effects of this invention are as follows:

[0044] This invention utilizes the CRISPR-Cas9 system to artificially form NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR sequences in the sense or antisense strand of the ζ-globin gene promoter region through homologous recombination repair. This results in the formation of an enhancer element containing the NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR sequence in the ζ-globin gene promoter region, thereby activating ζ-globin gene expression and forming ζ-globin. This increases the expression of α-globin-like proteins, thus alleviating the α-thalassemia phenotype caused by HBA1 / HBA2 gene deletion or mutation, and providing treatment for α-thalassemia. This invention eliminates the need for overexpression of exogenous globin genes, reducing the safety risks of gene therapy. Furthermore, the activation of ζ-globin gene expression is applicable to patients with various types of α-thalassemia, including those with α-gene deletion or mutation, and is not limited to α-thalassemia caused by a specific mutation site. Attached Figure Description

[0045] Figure 1 This is a schematic diagram showing the distribution of the nine regions in the HBZ gene in Example 1.

[0046] Figures 2A-2I This is a map showing the location of the gRNA target sequences used for gene editing in each region in Example 1.

[0047] Figure 3 This is a graph showing the editing efficiency results of gene editing in various regions of K562 cells in Example 1.

[0048] Figure 4 Example 2 on CD34 + Gene editing was performed on various regions in HSPC, and the Sanger sequencing results before and after gene editing are shown in the figure.

[0049] Figure 5A Example 2 on CD34 + A graph showing the editing efficiency of gene editing in different regions during HSPC; Figure 5B Example 1 on CD34 + Figure showing the gene expression results of ζ-globin after gene editing of each region in HSPC (n=3).

[0050] Figure 6 Example 2 on CD34 + The protein expression results of ζ-globin after gene editing of each region in HSPC are shown in the figure.

[0051] Figure 7 Example 3 on CD34 + The editing efficiency results of gene editing in different regions in HSPC (left image) and in CD34 + The protein expression results of ζ-globin after gene editing of each region in HSPC are shown in the right figure.

[0052] Figure 8 Example 3 on CD34 + Flow cytometry results of ζ-globin after gene editing of each region in HSPC. Detailed Implementation

[0053] In this invention, unless otherwise stated, the scientific and technical terms used herein have the meanings commonly understood by those skilled in the art. Furthermore, the operational steps used herein, such as molecular genetics, nucleic acid chemistry, chemistry, molecular biology, biochemistry, cell culture, microbiology, cell biology, genomics, and recombinant DNA, are all conventional steps widely used in their respective fields. To better understand this invention, the following definitions of key terms are provided:

[0054] The term “and / or” as used herein includes any and all combinations of one or more of the related listed items.

[0055] A locus (or loci) is a specific location on a chromosome corresponding to a particular segment of DNA sequence. Those skilled in the art can locate and determine the corresponding specific sequence based on a given locus. In this invention, the complete sequence of human chromosome 16 corresponds to Homosapiens chromosome 16,GRCh38.p14 Primary Assembly (NC_000016.10) in NCBI (https: / / www.ncbi.nlm.nih.gov / ). Therefore, the sequences defined by the locus location number range on Chr16 used in this invention refer to sequences within the corresponding location range on NC_000016.10.

[0056] In this invention, the antisense complementary sequence corresponding to the NTG-N(7-8)–WGATAR sequence or the NAG-N(7-8)–WGATAR sequence is the YTATCW–N(7-8)-CAN sequence or the YTATCW–N(7-8)-CTN sequence. Wherein, W is T or A, R is A or G, Y is T or C, and N is A, G, C, or T.

[0057] In this invention, the application scenarios of the term "non-diagnostic / therapeutic purpose" include, but are not limited to: for scientific research purposes, using the method described in one of the technical solutions of this invention to activate the expression of the ζ-globin gene in target cells in vitro, such as the application scenarios exemplified in the embodiments of this invention or similar application scenarios.

[0058] This invention provides a method for efficient gene editing of CD34+ hematopoietic stem cells and other stem cells and progenitor cells with erythrocyte differentiation capacity using gene editing technology. A mutation is created in the promoter region of the HBZ gene (located on human chromosome 16) that encodes human ζ-globin. An NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR sequence structure is artificially created on the sense or antisense strand of the promoter region. This sequence acts as an enhancer and can recruit transcription activators such as GATA1 to promote ζ-globin expression after the target cells differentiate into erythrocytes.

[0059] In this invention, "homlogous-directed repair (HDR)" refers to the process of repairing DNA damage using homologous nucleic acids (e.g., endogenous homologous sequences (e.g., sister chromatids)) or exogenous nucleic acids (e.g., donor templates)). "Homologous recombination repair editing" refers to the editing method in which a donor template (e.g., ssODN) is used in cells to guide repair and produce specific sequence changes in the genome, including targeted additions to the entire gene. If the donor template is provided with a site-specific nuclease, such as with a CRISPR / Cas9-based system or a CRISPR / Cpf1-based system, the cell will repair breaks via homologous recombination, an improvement several orders of magnitude in the presence of DNA damage such as double-strand breaks.

[0060] ssODN (single-stranded oligonucleotides) structurally contain a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm. Homologous arms are sequences homologous to the DNA regions flanking the target site, used to locate the target site on the chromosome. The corresponding sequences of the 5′ and 3′ homologous arms on the chromosome are usually not contiguous, with a gap of 1-20 nucleotides in between. These gap sequences are the targets of gene editing (the intended edit sequence), i.e., the sequence that is to be replaced by gene editing. The substitution sequence between the 3′ end of the 5′ homologous arm and the 5′ end of the 3′ homologous arm on the ssODN is the desired result of gene editing. Adding ssODN during gene editing can induce homologous recombination repair during gene editing, resulting in the intended edit sequence in the cell genome being replaced by a substitution sequence. The length of the substitution sequence in the ssODN can be shorter than the intended edit sequence; in this case, the result of gene editing is the deletion and / or replacement of the intended edit sequence in the original genome. In ssODN, the replacement sequence can be 0 bases long, in which case the intended edited sequence is deleted from the genome. The replacement sequence in ssODN can also be longer than the intended edited sequence, in which case the gene editing result is the replacement of the intended edited sequence or / and the insertion of a new sequence.

[0061] The present invention is further illustrated below by way of embodiments, but the invention is not limited to the scope of the embodiments described herein. Experimental methods in the following embodiments that do not specify specific conditions were performed according to conventional methods and conditions, or as selected according to the product instructions.

[0062] Example 1: Introducing enhancer elements into the ζ-globin gene in K562 cells

[0063] By analyzing the sequence within approximately 2 kb upstream of the HBZ transcription start site (TSS), introns, and within 1 kb downstream of the 3′UTR tail, the inventors discovered that many sequences could form NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR sequence structures by altering a few bases through substitution, deletion, or insertion. By analyzing whether the target mutant bases in these regions contained NGG (spCas9-recognized PAM) sequences and whether the cleavage site precisely aligned with the target sequence, nine candidate target regions most likely to achieve efficient gene editing were ultimately identified (see the distribution diagram). Figure 1 The location map of the gRNA target sequences used for gene editing in each region is shown below. Figures 2A to 2I The locations where the reinforcing sub-elements in each region will be formed are as follows:

[0064] Region 1 (TSS1700), upstream of the TSS (promoter) of the HBZ gene, between -1954 and -1939, original sequence ctgtggtaaaggatag (SEQ ID NO: 96), located at locus Chr16:150901-150916 ( Figure 2A );

[0065] Region 2 (TSS7), between -235 and -219 of the HBZ gene promoter, original sequence ctatctctcctagactc (SEQ ID NO: 97), located at locus Chr16:152620-152636 ( Figure 2B );

[0066] Region 3 (U96), between -175 and -159 of the HBZ gene promoter, original sequence aggaacaggagtgatag (SEQ ID NO: 98), located at locus Chr16:152680-152696 ( Figure 2C );

[0067] Region 4 (U39), between -118 and -102 of the HBZ gene promoter, original sequence gtcactggatctgataa (SEQ ID NO: 99), located at locus Chr16:152737-152753 ( Figure 2D );

[0068] Region 5 (N200), the first intron of HBZ, located between +365 and +380 downstream of the TSS, with the original sequence cgtgaggacagatag (SEQ ID NO: 100), located at locus Chr16:153219-153234. Figure 2E );

[0069] Region 6 (N360), the first intron of HBZ, located between +524 and +539 Å downstream of TSS, with the original sequence cttacagggcagccag (SEQ ID NO: 101), located at locus Chr16: 153378-153393. Figure 2F );

[0070] Region 7 (W310), 3′ tail of the HBZ gene, between +1969 and +1984 downstream of the TSS, original sequence ctgatcgttctgaaat (SEQ ID NO: 102), located at locus Chr16:154823-154838 ( Figure 2G );

[0071] Region 8 (W560), 3′ tail of the HBZ gene, between +2210 and +2226 downstream of the TSS, original sequence ctgagcctcactcataa (SEQ ID NO:103), located at locus Chr16:155064-155080 ( Figure 2H );

[0072] Region 9 (W630), 3′ tail of the HBZ gene, between +2279 and +2295 downstream of the TSS, original sequence tctcacctccctgatag (SEQ ID NO: 104), located at locus Chr16: 155133-155149 ( Figure 2I ).

[0073] Based on the sequence characteristics of the nine candidate regions and the cut site locations predicted by the CRISPR-Cas9 gene editing system, the most suitable mutation target types for each region were analyzed, as shown in Table 1. Underlined bases indicate the bases that need to be replaced, representing the desired result after gene editing. In this invention, the replacement base length is 0-6 bases, achieving deletion, substitution, insertion, or a combination of these actions.

[0074] Nine regions of the ζ-globin gene were altered by substitution, deletion, or insertion of a few bases to form NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR sequence structures.

[0075] Table 1. Wild-type sequences and edited sequences from 9 regions of HBZ

[0076]

[0077]

[0078] To achieve the goal of cutting the DNA double strand near the editing site in the region selected in Table 1 to form a DSB, this invention selects the spCas9 CRISPR-Cas system (derived from Streptococcus pyogenes), which has a high cutting efficiency, to analyze target sites with potentially high cutting efficiency. Sites 1 to 9 were selected as candidate target sites, and the DNA sequences (SEQ ID NO:29 to SEQ ID NO:37) and PAM sequences (NGG) of the identified target sites are shown in Table 2.

[0079] Table 2. Target sites recognized by sgRNAs in the 9 regions of HBZ

[0080]

[0081] Based on the expected mutation types shown in Table 1 and the DNA strands (sense or antisense strands) recognized by sgRNA in Table 2, corresponding guide gene editing repair ssODNs were designed (Table 3, SEQ ID NO:38 to SEQ ID NO:46). In this invention, the ssODN structure includes a 5′ homologous arm, a substitution sequence, and a 3′ homologous arm. It should be noted that the NTG-N(7-8)–WGATAR sequence, NAG-N(7-8)–WGATAR sequence, or the corresponding antisense complementary sequence in the ssODN structure can be located at any position on the ssODN, including the substitution sequence, the 5′ homologous arm, the 3′ homologous arm, and the junctions between the 5′ homologous arm and the substitution sequence, and between the 3′ homologous arm and the substitution sequence. The homologous arms on both sides of the ssODN can be symmetrical or asymmetrical (different lengths on both sides). For ease of systematic comparison, this invention uniformly uses ssODNs with symmetrical homologous arms for experiments. The length of the homologous arms flanking the ssODN can be 20-300 nt. For ease of system comparison, this embodiment uses an ssODN with a length of approximately 60 nt flanking homologous arms as an example. The ssODN can be the sense or antisense strand of the edited region DNA (the homologous arm sequence is the same as the corresponding sense strand or the antisense strand). In this invention, the DNA strand with the same recognition site as the sgRNA is uniformly selected as the ssODN master sequence. In addition to the flanking homologous arm sequences, the substituted bases in the ssODN sequence can be 0, 1, 2, 3, 4, 5, or 6 bases, achieving the effects of deletion, substitution, insertion, or a combination of deletion, substitution, and insertion. The achieved effect can be a change of more than one base on the genome, such as the deletion or substitution of 1-20 bases. As shown in Table 3, the underlined bases are the flanking homologous arms, approximately 60 nt in length, and the bases between the flanking homologous arms that are not underlined are substituted bases. The first four nucleotides at the 5′ end and the last four nucleotides at the 3′ end of ssODN are modified with phosphate thioesters to enhance the stability of ssODN and improve its activity in gene editing.

[0082] Table 3. ssODN sequences and their applicable regions

[0083]

[0084] Using the sgRNA corresponding to the target sites in Table 4, the first 20 bp is the sgRNA recognition site sequence, and the following 80 nt is the universal sgRNA backbone sequence SEQ ID NO:47, (GUUUUAGAGCUAGAAAUAGCAAGUUA AAAUAAGGCUAGUCCGUUAUCAACUUGAAAAAGUGGCACCGAGUCGGUGCUUU U).

[0085] Table 4. sgRNA sequences and their applicable regions

[0086]

[0087] Using commercially available spCas9 protein and chemically synthesized sgRNA (sequences shown in Table 4, with chemically modified ends, 2'-O-methyl modification of the three ribonucleotides at the 5' and 3' ends, and phosphate thioester bond modification between the four ribonucleotides at the 5' and 3' ends), a ribonucleoprotein (RNP) complex was formed in vitro. Corresponding ssODNs for each region were added as homology repair template strands. The RNP complex and ssODN were then delivered into K562 cells via electroporation. After culturing K562 cells for 48 hours, genomic DNA was extracted, and the corresponding gene fragments were amplified by PCR and sequenced. PCR primers for the corresponding sites are shown in Table 5. Sequencing results were analyzed using TIDE software; the editing efficiency results are shown in the figure below. Figure 3 It can be seen that the editing efficiency of the nine selected sites all reached more than 25%.

[0088] Table 5. PCR primer names and sequences for different sites

[0089] SEQ ID Primer name Sequence (5′-3′) Applicable Areas SEQ ID NO:57 HBZ-TSS1700-F GGAGGCTGAGGTATGAGAATTG TSS1700 SEQ ID NO:58 HBZ-TSS1700-R GTGAAGGGCAGGTCCAGAT TSS1700 SEQ ID NO:59 HBZ-TSS-UTR-F TGCCTCCTCCTGCTTGTCA TSS7,U96,U39 SEQ ID NO:60 HBZ-TSS-UTR-R TGGCCTTGGTAGTGCTCAG TSS7,U96,U39 SEQ ID NO:61 HBZ-N200-F GAGGAGGGAACCGTGGAGAG N200, N360 SEQ ID NO:62 HBZ-N200-R CAGTGCCCTGATCCCAGATG N200, N360 SEQ ID NO:63 HBZ-W310-F CAATGAACGAAGCAGCGTCC W310 SEQ ID NO:64 HBZ-W310-R TTTAGCAAATGAGATGCCCCG W310 SEQ ID NO:65 HBZ-W-F1 CAGAACGATCAGGACGAAGAGG W560, W630 SEQ ID NO:66 HBZ-W-R1 CATGGTGCGGATACCCTTGG W560, W630

[0090] Example 2 on CD34 + Introducing enhancer elements into the ζ-globin gene in HSPC cells

[0091] After reviving peripheral blood-derived human CD34-positive hematopoietic stem cells (HSPCs), they were placed in X-VIVO solution rich in human cytokines (SCF, TPO, Flt3L, 100 ng / ml each). TM After two days of culture in serum-free hematopoietic cell medium (-15%), the corresponding ssODN and spCas9 / sgRNA RNPs (as in Example 1) of each region were delivered to HSPCs using the EO-100 program on the Lonza-4D electroporator. Following electroporation, the cells were cultured in X-VIVO2 enriched with human cytokines (SCF / TPO / Flt3L, 100 ng / ml each). TM After one day of recovery culture, the cells were then cultured in IMDM medium containing EPO, SCF, human AB serum, insulin, transferrin, heparin, IL-3, and hydrocortisone for differentiation. Forty-eight hours after electroporation, 2 × 10⁵ cells were harvested to extract genomic DNA, which was then amplified by PCR and sent for Sanger sequencing (sequencing primers for the corresponding sites were the same as those for K562 cells, as shown in Table 5). Sanger sequencing results before and after gene editing are shown in [Table 5]. Figure 4Editing efficiency results can be found in [link / reference]. Figure 5A This demonstrates that high editing efficiency can also be achieved in HSPC.

[0092] After HSPC-induced differentiation into D14 cells, RNA was extracted from 1×10^6 cells and reverse transcribed into cDNA. GAPDH was used as an internal control for qPCR. The qPCR primers for the HBZ gene were: forward primer 5′CCGGTCAACTTCAAGCTCCT3′ (SEQ ID NO:67), reverse primer 5′CTCAGCGGTACTTCTCGGTC3′ (SEQ ID NO:68); and for GAPDH, forward primer 5′CCATGGGGAAGGTGAAGGTC3′ (SEQ ID NO:69), reverse primer 5′GAAGGGGTCATTGATGGCAAC3′ (SEQ ID NO:70). The results showed that the formation of an enhancer element in the TSS7 region significantly increased HBZ expression at the RNA level, achieving an increase of more than 16-fold compared to the control group (see...). Figure 5B A slight improvement is visible in the remaining areas.

[0093] On day 21 of HSPC-induced differentiation, 1×10^6 cells were harvested, lysed with 200 μL of RIPA lysis buffer, and incubated on ice for 30 min. The centrifuge was pre-chilled simultaneously. After lysis, the cells were centrifuged at 4°C, 13000g, for 10 min. The lysate was collected, and 5× Loading Buffer was added. The cells were then boiled in a water bath for 10 min to denature the total protein. The denatured protein was used as a backup sample for Western blot experiments, using β-actin as an internal control. The results showed that the formation of an enhancer element in the TSS7 region significantly increased HBZ protein expression (see...). Figure 6 ).

[0094] Example 3: Introducing enhancer elements into the ζ-globin gene in CD34+HSPC cells

[0095] In this embodiment, NTG-N(7-8)–WGATAR was formed in other regions of the HBZ gene, and the expression level of HBZ was detected.

[0096] The locations where the reinforcing sub-elements in each region will be formed are as follows:

[0097] T0, upstream of the TSS (promoter) of the HBZ gene, between -219 and -204, the original sequence ctgtggtcagactctg (SEQ ID NO:105), is located at the locus Chr16:152636-152651;

[0098] T50, between -278 and -263 upstream of the TSS of the HBZ gene, the original sequence tggactacaaatgcag (SEQ ID NO:106) is located at the locus Chr16:152577-152592;

[0099] T70, between -282 and -298 upstream of the TSS of the HBZ gene, the original sequence gaataaggacggtgcag (SEQ ID NO: 107) is located at locus Chr16:152557-152573;

[0100] T200, between -447 and -431 upstream of the TSS of the HBZ gene, the original sequence caggaatccagagacaa (SEQ ID NO: 108) is located at the locus Chr16:152408-152424;

[0101] T300, between -525 and -508 upstream of the TSS of the HBZ gene, the original sequence ctgcttgtcaggggacag (SEQ ID NO: 109) is located at locus Chr16:152330-152347.

[0102] Table 6 shows the wild-type sequences and edited sequences of other upstream edited regions of the HBZ gene TSS; Table 7 shows the target sites recognized by the sgRNAs used in other upstream edited regions of the HBZ gene TSS; and Table 8 shows the sgRNA sequences used in other upstream edited regions of the HBZ gene TSS. CD34 was used. + HSPC cells were used in experiments, following the same cell differentiation protocol and editing method as in Example 2. The Cas9 protein was combined with the corresponding sgRNA (see Table 8) to form an RNP complex, and an ssODN sequence (see Table 9) was added as a template strand to target CD34. + HSPC was used for electroporation, and DNA was extracted 48 hours later for sequencing analysis. The editing efficiency obtained from the sequencing results is shown in [link to sequencing results]. Figure 7 Left image.

[0103] On day 21 of HSPC-induced differentiation, protein samples were obtained and subjected to Western blot experiments using the same method as in Example 2, with β-actin as the internal control protein. Results are shown below. Figure 7 The right figure shows that the expression of HBZ, a reinforcing element formed in the T50 region, is significantly upregulated.

[0104] On day 21 of HSPC-induced differentiation, cells from each group were collected for flow cytometry analysis. The specific experimental steps were as follows: 1.5 × 10^6 cells from each group were washed with 1 ml PBS, centrifuged, the supernatant was discarded, and the cells were resuspended in 180 μl PBS. 20 μl of 10 × glutaraldehyde fixative was added to each group, mixed (votex 15 s), and fixed at room temperature in the dark for 10 min. The cells were then centrifuged at 300 g for 10 min, and the supernatant was discarded. The cells were resuspended in 180 μl PBS, and 20 μl of 10 × Triton X-100 / PBS was added. The cells were incubated at room temperature for 5 min, centrifuged at 300 g for 10 min, and the supernatant was discarded. Resuspend in 100 μl PBS, add HBZ antibody (Proteintech, catalog number 17284-1-AP), incubate in the dark for 30 min, then incubate with anti-rabbit AF647 antibody (catalog number #4414S, Cell Signaling) as the conjugate secondary antibody for 30 min. Wash twice with PBS, resuspend, and analyze. Results are shown in the figure. Figure 8 Flow cytometry results showed that the formation of enhancer elements in other regions of the HBZ promoter region could activate the HBZ gene and increase HBZ protein expression, with the T50 region showing the most significant effect.

[0105] Table 6. Wild-type sequences and edited sequences from other upstream edited regions of the HBZ gene TSS.

[0106]

[0107] Table 7. Target sites recognized by sgRNAs used in other upstream editing regions of the HBZ gene TSS

[0108] SEQ ID area site sgRNA recognition sites (5′-3′) DNA strand SEQ ID NO:81 T0 site_10 TAGACTCTGTGGTCAGACTC Chain of Justice SEQ ID NO:82 T50 site_11 CAGAACTGGACTACAAATGC Chain of Justice SEQ ID NO:83 T70 site_12 TCGTGATTCTGAAATGAATA Chain of Justice SEQ ID NO:84 T200 site_13 CCACTTTGTCTCTGGATTCC antisense chain SEQ ID NO:85 T300 site_14 TGCCTCCTCCTGCTTGTCAG Chain of Justice

[0109] Table 8. sgRNA sequences used in other upstream editing regions of the HBZ gene TSS.

[0110]

[0111]

[0112] Table 9. ssODN sequences used in other upstream editing regions of the HBZ gene TSS.

[0113]

[0114] The results of the above embodiments demonstrate that the present invention provides a gene editing method for enhancing ζ-globin gene expression, which differs from existing technologies. The present invention forms NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR in different regions of the ζ-globin gene. These NTG-N(7-8)–WGATAR or NAG-N(7-8)–WGATAR elements act as enhancer elements, exerting a positive regulatory effect after gene-edited cells (e.g., hematopoietic stem cells) differentiate into erythrocytes, thereby activating or significantly enhancing the expression of the ζ-globin gene and protein. Therefore, the present invention has potential application value in gene therapy for α-hemoglobinopathies.

[0115] The technical features of the above embodiments can be combined in any way. For the sake of brevity, not all possible combinations of the technical features in the above embodiments are described. However, as long as there is no contradiction in the combination of these technical features, they should be considered to be within the scope of this specification.

Claims

1. A method for activating ζ-globin gene expression for non-diagnostic / therapeutic purposes, characterized in that, The method includes: using the CRISPR-Cas9 system to repair the DNA sense strand or antisense strand in the promoter region of the ζ-globin gene through homologous recombination to artificially form an enhancer element containing the NTG-N(7-8)–WGATAR sequence or the NAG-N(7-8)–WGATAR sequence; N is A, G, C or T, W is T or A, and R is A or G; The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

2. The method as described in claim 1, characterized in that, The sequence shown in SEQ ID NO:6 in the positive strand of the promoter region of the ζ-globin gene is edited to any of the sequences shown in SEQ ID NO:7 to 10; The sequence shown in SEQ ID NO:73 in the positive strand of the promoter region of the ζ-globin gene was edited to the sequence shown in SEQ ID NO:

74.

3. A gRNA, characterized in that, The gRNA contains a recognition site sequence and a backbone sequence. The recognition site sequence is partially or completely complementary to the sense or antisense strand of the DNA in the promoter region of the ζ-globin gene. The gRNA is used to artificially form an enhancer element containing the NTG-N(7-8)–WGATAR sequence or the NAG-N(7-8)–WGATAR sequence in the sense or antisense strand of the promoter region of the ζ-globin gene. N is A, G, C or T, W is T or A, and R is A or G; The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

4. The gRNA as described in claim 3, characterized in that, The backbone sequence is as shown in SEQ ID NO:47; and / or, the DNA sequence corresponding to the recognition site sequence is partially or completely identical to the sequence shown in SEQ ID NO:30 or SEQ ID NO:82; Preferably, the nucleotide sequence of the gRNA is as shown in SEQ ID NO:49 or SEQ ID NO:

87.

5. The gRNA as described in claim 4, characterized in that, The gRNA contains chemical modifications selected from one or more of 3'-thiophosphate, 2'-O-methyl ester, 2'-O-methyl, 2'-F modification, 2'-ribose 3'-thiophosphate, deoxy, and 5' phosphate modification; More preferably, the three ribonucleotides at the 5′ and 3′ ends of the gRNA are modified with 2′-O-methyl groups, and the four ribonucleotides at the 5′ and 3′ ends are modified with phosphate thioester bonds.

6. An ssODN for gene editing of the promoter region of the ζ-globin gene, characterized in that, The ssODN contains NTG-N(7-8)–WGATAR sequence, NAG-N(7-8)–WGATAR sequence, YTATCW–N(7-8)-CAN sequence or YTATCW–N(7-8)-CTN sequence; N is A, G, C or T, W is T or A, R is A or G, and Y is T or C; The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

7. The ssODN as described in claim 6, characterized in that, The ssODN is selected from the sequence shown in SEQ ID NO:39 or SEQ ID NO:92; Preferably, the ssODN is chemically modified; the chemical modification is preferably performed on the 5′ end and 3′ end of the ssODN; more preferably, it is performed on the phosphate thioester modification between the first four nucleotides at the 5′ end and the last four nucleotides at the 3′ end of the ssODN.

8. A composition for gene editing of the promoter region of the ζ-globin gene, characterized in that, The composition is used to artificially form an enhancer element comprising an NTG-N(7-8)–WGATAR sequence or a NAG-N(7-8)–WGATAR sequence in the sense or antisense strand of the DNA in the promoter region of the ζ-globin gene, wherein the composition comprises: (a) ssODN containing reinforcing sub-elements; (b) gRNA targeting the promoter region of the ζ-globin gene; as well as, (c) CRISPR / Cas9 nuclease, mRNA encoding the CRISPR / Cas9 nuclease and / or plasmid expressing the CRISPR / Cas9 nuclease; N is A, G, C or T, W is T or A, and R is A or G; The promoter region of the ζ-globin gene is selected from the sequence located at the locus: Chr16:152620-152636 or Chr16:152577-152592.

9. A cell, characterized in that, The cells are obtained by transfecting the composition of claim 8 into target cells; Preferably, the target cell is an erythroid progenitor cell; and / or, the target cell is a mammalian cell, such as a human cell; More preferably, the erythroid progenitor cells are umbilical cord blood stem cells, induced pluripotent stem cells, hematopoietic stem / progenitor cells, myeloid progenitor cells, bursting unit-erythroid cells / red blood cells, spleen colony-forming cells, embryonic cell colony-forming cells, and / or megakaryocyte-erythroid progenitor cells.

10. The use of the gRNA as described in any one of claims 3 to 5, the ssODN as described in claim 6 or 7, the composition as described in claim 8, and / or the cells as described in claim 9 in the preparation of a medicament for treating α-thalassemia; Preferably, the alpha-thalassemia is moderate or severe; and / or, the drug is cellular.

Images