Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation and application thereof

By using Leuconostoc mesenteroides subsp. JMCC0041 as a cheese starter, the problems of insufficient strain activity and unstable flavor in cheese fermentation were solved, achieving high production of diacetone and fermentation stability, thus improving the flavor and quality of cheese.

CN120988939BActive Publication Date: 2026-05-12SIPING JUNLEBAO DAIRY CO LTD +1
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202511453170.X
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-10-13
Publication Date
2026-05-12
Estimated Expiration
2045-10-13

AI Technical Summary

Technical Problem

Existing cheese fermentation strains have insufficient activity in low-temperature and low-salt environments, resulting in poor consistency in fermentation flavor and texture, and unstable dimethylglyoxal production, which affects cheese production and quality.

Method used

The *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 strain was used for cheese fermentation. It has a high capacity for producing dimethylglyoxal and is adaptable to a wide range of temperature and salinity environments. It forms a compound starter culture and ferments dairy products under specific conditions.

Benefits of technology

It increases the diacetone content in cheese, enhances the creamy aroma, ensures fermentation stability and product quality, and reduces production energy consumption and equipment adaptation difficulty.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure SMS_1
    Figure SMS_1
  • Figure SMS_2
    Figure SMS_2
  • Figure SMS_3
    Figure SMS_3
Patent Text Reader

Abstract

The application discloses Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation and application thereof, and belongs to the technical field of microbial engineering. Leuconostoc mesenteroides subsp. mesenteroides The application provides the Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, which has a high and suitable diacetyl yield, a prominent butter flavor of a fermented cheese product, and a fermentation stability in a high-salt environment, and has a wide working temperature range, thereby expanding the application range of the Leuconostoc mesenteroides subsp. mesenteroides and enriching the germplasm resources of the Leuconostoc mesenteroides subsp. mesenteroides in China. The application is suitable for preparing a fermenting agent and a fermented cheese.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of microbial engineering technology and relates to a new strain of Leuconostoc mesenteroides, specifically Leuconostoc mesenteroides JMCC0041 for cheese fermentation and its applications. Background Technology

[0002] Among various dairy products, cheese has high nutritional value, but imported cheese products are subject to transportation and storage costs, resulting in high retail prices. Meanwhile, domestic brands still face some unresolved issues in the fermentation, curdling, and maturation processes of their original cheese products.

[0003] The first issue is the lack of stress-resistant bacterial strains for fermentation. Cheese production involves various environments, including low-temperature conditions like raw milk refrigeration, high-temperature conditions like residual heat after pasteurization, and high-salt conditions like salting. These conditions can lead to insufficient activity of some sensitive bacterial strains. Currently, most commercially available starter cultures have weak stress resistance, especially in low-salt, low-temperature fermentation processes such as soft cheese production. These conditions can easily result in reduced strain activity or even fermentation stagnation, affecting the normal production of soft cheese.

[0004] Secondly, some strains also exhibit poor consistency in fermentation flavor and texture. Metabolites from starter cultures, such as lactic acid, dimethylglyoxal, and acetaldehyde, are the core sources of cheese flavor. However, the production of these metabolites is greatly affected by various factors, including strain activity, fermentation time, and environmental temperature fluctuations. For example, a temperature fluctuation of 1-2°C can alter the activity of ester-producing strains, resulting in cheeses from the same batch exhibiting either excessive acidity or a bland flavor. Simultaneously, the starter culture's ability to produce extracellular polysaccharides is unstable, leading to cheeses that are too soft (insufficient polysaccharide production) or too hard (excessive polysaccharide production), thus affecting subsequent processing properties such as slicing and melting.

[0005] Especially among the various metabolites of starter cultures, dimethylglyoxal (DMO) is a key flavor compound that imparts a creamy aroma to cheese, and its content directly affects the flavor quality of cheese products. Therefore, the amount of DMO produced by cheese fermentation bacteria has a significant impact on the sensory experience of the final product. Existing research shows that DMO has a significant threshold range for exerting the ideal creamy flavor in cheese, and this range varies depending on the type of cheese. The maximum DMO content in any type of cheese should not exceed 10 mg / kg. If this threshold is exceeded, the cheese will produce a noticeable putrid odor, chemical off-flavor, and metallic taste, severely damaging the product flavor and leading to a decline in product quality or even inedibility. However, current starter cultures used for cheese fermentation suffer from problems of insufficient or excessive DMO production during actual fermentation processes. Summary of the Invention

[0006] The purpose of this invention is to provide a strain of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation. This is achieved by isolating lactic acid bacteria from traditional fermented dairy products and screening out strains that produce a high amount of flavor compounds, are stable in high-salt environments, and can adapt to a wide temperature range, thereby enriching the germplasm resources of cheese fermentation strains in China.

[0007] Another object of the present invention is to provide the application of the above-mentioned Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation, using this strain as a cheese starter strain for the fermentation production of cheese products, so that the cheese has a suitable and high diacetyl content and a prominent creamy aroma.

[0008] To achieve the above objectives, the technical solution adopted by the present invention is as follows:

[0009] A *Leuconostoc mesenteroides* subspecies *JMCC0041* for cheese fermentation, with its 16S rDNA sequence shown in SEQ ID NO. 1, is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing. The deposit date is April 27, 2025, and the accession number is CGMCC NO. 34266. Its Latin name is... Leuconostoc mesenteroides subsp. mesenteroides .

[0010] SEQ ID NO.1 is as follows:

[0011]

[0012] Its Phes gene sequence is shown in SEQ ID NO.2, and is as follows:

[0013] AATAAGTAAGCAATCGTTGTAATTAAATATAGAATAGCGCCCCATCGAACAATCTTTTTCCGTCCGATTAGTTCTAACTCTTTTCCAACTATTAGCCGAGCTATTAACGTTCCTATGATATAAATCCCAGAGGCCAATCCCGCTTGCCCAAACGAAGCATGTAGTTGATTGTGTGCAACAACTGC AATTATAACCATCATCAGATAATACACTAAGTACACGATAAAGTTAATAATAGTAATTGTTAAAAAGCCTTTATTAAATAATTTTTCTTCCATTTTCCCAATCTCAAATTCTATTTAGCAACTCTAACAATAGCAAAGTAGCTATGTAGGTGCAAACTTGAAATCAGATTTTAAAACATGCATGT.

[0014] As a limitation of the present invention, the cheese produced by fermentation of Leuconostoc mesenteroides subsp. JMCC0041 contains not less than 7.33 mg / kg of dimethylglyoxal;

[0015] The fermentation temperature for Leuconostoc mesenteroides subsp. JMCC0041 is 19℃~37℃.

[0016] The present invention also provides an application of the above-mentioned Leuconostoc mesenteroides subsp. mesenteroides JMCC0041, specifically for the preparation of a fermentation agent.

[0017] As a limitation of the present invention, the fermenting agent is a compound fermenting agent containing lactic acid bacteria;

[0018] Furthermore, in the compound fermentation agent, the ratio of viable bacteria of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 to other bacteria is 0.1%~10%:1. Other bacteria include Lactococcus lactis subsp. milk fat, Lactococcus lactis subsp. lactic acid, and Streptococcus salivarius subsp. thermophilus.

[0019] As a further limitation of the present invention, the fermenting agent is used for fermentation to prepare dairy products.

[0020] The amount of the starter culture added to the fermentation substrate is 0.025~0.1g / kg; the fermentation temperature is 29~35℃; and the fermentation endpoint is pH = 4.7.

[0021] As a further definition of the invention, the dairy products include cheese.

[0022] The present invention also provides the application of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 in the preparation of high-salt cheese, wherein the fermentation broth of the high-salt cheese contains 0.5% to 4% NaCl by mass.

[0023] By adopting the above technical solution, the technical progress achieved by this invention compared with the prior art is as follows:

[0024] This invention, through the isolation and screening of strains from traditional fermented dairy products, obtained *Leuconostoc mesenteroides* subspecies *JMCC0041*, which possesses specific functions. The discovery and application of this strain can effectively supplement the domestic germplasm resource bank for cheese fermentation strains. Compared to the current dependence on imported strains in the domestic cheese fermentation field, this native strain possesses unique biological characteristics and fermentation functions, providing fundamental germplasm materials for subsequent molecular improvement, targeted breeding, and industrial transformation of strains. This can alleviate the problems of limited germplasm resources and high dependence on foreign sources.

[0025] The *Leuconostoc mesenteroides* subspecies *JMCC0041* of this invention exhibits strong adaptability to key environments in cheese fermentation. Firstly, in the high-salt environment required for cheese production, this strain demonstrates good fermentation stability, fermenting stably at NaCl concentrations ranging from 0.5% to 4%, thereby reducing the impact of environmental fluctuations on product quality stability and ensuring product quality in continuous industrial cheese production. Secondly, this strain has a wide tolerance range for temperature conditions, exhibiting stable fermentation capabilities within the 19-35°C temperature range, eliminating the need for strict single-temperature control. This not only reduces energy consumption costs associated with temperature control during production but also allows for compatibility with equipment configurations and process parameters of production enterprises of different scales, enhancing the strain's applicability in actual production scenarios.

[0026] The *Leuconostoc mesenteroides* subspecies JMCC0041 of this invention, used as a cheese starter strain in cheese fermentation, can significantly improve the flavor quality and sensory characteristics of the product. This strain exhibits high yields of flavor-active substances during fermentation metabolism, particularly maintaining the synthesis of diacetone in cheese within a suitable flavor threshold range and at a high content level, resulting in a prominent creamy aroma in the product.

[0027] The Leuconostoc mesenteroides subsp. JMCC0041 of the present invention is used to prepare fermentation agents for the industrial production of fermented dairy products, especially cheese products. Detailed Implementation

[0028] The present invention will be further described in detail below through specific embodiments. It should be understood that the described embodiments are only for explaining the present invention and do not limit the present invention.

[0029] Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the materials and reagents used in the following examples are commercially available.

[0030] In the following embodiments:

[0031] Leuconostoc mesenteroides subsp. *enteroides* JM-0008, JM-0733, JM-0942, and JM-0962; Streptococcus salivarius subsp. *thermophilus* JMCC16 (accession number CGMCC NO. 11672 at the China General Microbiological Culture Collection Center); Lactobacillus plantarum N3117 (accession number CGMCC NO. 10133 at the China General Microbiological Culture Collection Center); Lactobacillus rhamnosus X253 (accession number CGMCC NO. 18404 at the China General Microbiological Culture Collection Center); and Bifidobacterium animalis subsp. *lactospirae* i797 (accession number CGMCC at the China General Microbiological Culture Collection Center). NO.18403 is held in the applicant's laboratory and can be obtained through purchase or other means.

[0032] Example 1

[0033] This embodiment provides a strain of *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 for cheese fermentation. This strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, on April 27, 2025, with accession number CGMCC NO.34266. Its Latin name is... Leuconostoc mesenteroides subsp. mesenteroides .

[0034] The 16S rDNA sequence of Leuconostoc mesenteroides subsp. JMCC0041 used for cheese fermentation is shown in SEQ ID NO.1, and its Phes gene sequence is shown in SEQ ID NO.2.

[0035] Experiments have verified that the glycan content in cheese produced by fermentation of Leuconostoc mesenteroides subsp. JMCC0041 is not less than 7.33 mg / kg. Leuconostoc mesenteroides subsp. JMCC0041 can be used as a starter culture for the fermentation of raw milk or reconstituted milk at temperatures of 19℃, 20℃, 22℃, 25℃, 28℃, 31℃, 35℃ or 37℃. It can be used for cheese fermentation production under conditions of NaCl mass fraction of 0.5%, 1%, 1.5%, 2.5% or 4%.

[0036] Example 2

[0037] This embodiment provides a method for isolating and purifying Leuconostoc mesenteroides subsp. JMCC0041 for cheese fermentation, and identifies the strain.

[0038] (I) Isolation and purification of Leuconostoc mesenteroides subsp. JMCC0041

[0039] This includes the following steps performed sequentially:

[0040] S1. Sample Collection

[0041] Take 25 mL of traditional fermented dairy products from pastoral areas of Inner Mongolia, add them to 200 mL of physiological saline, mix, and obtain the collected sample;

[0042] S2. Sample enrichment

[0043] Take 2 mL of the collected sample and add it to 100 mL of MRS liquid culture medium. Incubate at 37℃ for 72 h to obtain culture medium B.

[0044] S3. Strain Isolation

[0045] Take 1 mL of culture medium B, dilute it 10 times with sterile physiological saline, and continue to dilute it with sterile physiological saline for 10 cycles. -1 10 -2 10 -3 10 -4 10 -5 The bacterial suspensions were obtained by serial dilution of 100 times.

[0046] Take MRS solid culture medium, sterilize and melt it, pour it into a sterile petri dish to make a sterile plate, and after it cools and solidifies completely, take 0.1 mL of bacterial suspension of different concentrations and spread it onto the sterile plate.

[0047] Incubate at 37℃ in an anaerobic environment for 68 hours; after typical colonies appear on the plates, select single colonies.

[0048] S4. Strain purification

[0049] A single colony was picked and streaked onto another sterile MRS solid medium plate. It was incubated at 37°C in an aerobic environment for 72 hours. Then, a single colony Q was picked from the sterile plate and streaked onto yet another new sterile MRS solid medium plate. This process was repeated three times until the colony morphology in the medium was consistent. After microscopic observation showed that the cell morphology of the strain was uniform, the strain to be verified was obtained. The strain to be verified was then inoculated into liquid MRS medium and incubated at 37°C for 24 hours to obtain the final pure culture solution, which was labeled as JMCC0041.

[0050] S5. Strain preservation

[0051] Take 800 μL of pure bacterial culture and mix it with sterile 50% glycerol (a mixture of glycerol and an equal volume of distilled water) at a 1:1 ratio. Place the mixture in a bacterial culture preservation tube, mix well, and store at -70℃. At the same time, take a single bacterial culture and inoculate it onto a slant of sterile modified MRS solid medium for temporary preservation.

[0052] (ii) Identification of strain JMCC0041

[0053] 1) Identification of strain characteristics

[0054] Methods for identifying strain characteristics: The JMCC0041 strain was inoculated onto MRS solid medium plates, streaked, inverted, and cultured at 37°C for 72 h. Cell morphology was observed and Gram staining, oxidase detection, catalase detection, and carbohydrate acid production (API 50CH) characteristic detection experiments were performed.

[0055] Results of strain characterization: Observation showed that JMCC0041 cells were spherical; Gram staining was positive; and catalase detection showed no catalase.

[0056] The results of the carbohydrate acid production (API 50CH) characteristics test are shown in Table 1:

[0057] Table 1. Results of Carbohydrate Acid Production Characteristics Detection of Strain JMCC0041

[0058]

[0059] Note: "+" indicates fermentation utilization, and "-" indicates non-fermentation utilization.

[0060] 2) Molecular identification of strains

[0061] Molecular identification of JMCC0041: Using JMCC0041 genomic DNA as a template, its 16S rDNA sequence was amplified using universal bacterial 16S rDNA primers, as shown in SEQ ID NO.1. Its Phes gene sequence was also amplified, as shown in SEQ ID NO.2. Through analysis and comparison, JMCC0041 was identified as *Leuconostoc mesenteroides* subspecies *Enteromorpha*.

[0062] Tests have shown that *Leuconostoc mesenteroides* subspecies JMCC0041 possesses characteristics that significantly distinguish it from other strains of the same species and genus, making it suitable for the preparation of dairy products such as cheese. Specifically: First, it produces a high amount of flavor compounds, with a particularly outstanding ability to produce dimethylglyoxal (DMG) from fermented milk or reconstituted milk. The DMG yield is high and below the undesirable flavor threshold, resulting in cheese with a distinct creamy flavor. Second, it exhibits strong resistance to stress, adapts to a wide range of fermentation temperatures, and performs well under high salt stress conditions.

[0063] Effect Experiment Example 1

[0064] This example is a verification experiment on the performance of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 in producing dimethylglyoxal (DME). Referring to the method in Li Yan's 2008 paper "Discussion on the Detection Method of Dimethylglyoxal and Acetaldehyde Content in Fermented Milk," the samples were treated with trichloroacetic acid, and then the DME content in each sample was detected using the o-phenylenediamine colorimetric method.

[0065] The samples to be tested were cheeses obtained by fermenting Leuconostoc mesenteroides subsp. JMCC0041, Leuconostoc mesenteroides subsp. JM-0008, Leuconostoc mesenteroides subsp. JM-0733, Leuconostoc mesenteroides subsp. JM-0942, Leuconostoc mesenteroides subsp. JM-0962 under the same conditions and for the same time, along with Streptococcus salivarius subsp. JMCC16, Lactobacillus plantarum N3117, Lactobacillus rhamnosus X253, and Bifidobacterium animalis subsp. i797.

[0066] The specific methods for producing cheese by fermentation of each strain are as follows:

[0067] S11. Pre-sterilized milk: Qualified raw milk is filtered and purified, then sterilized at 75℃ for 20 seconds, cooled to 4℃, and stored in the cooked milk warehouse for 10 hours.

[0068] S12. Preparation and hydration: Add pre-pasteurized milk according to the formula milk amount, heat the platen exchanger to 65℃, turn on the stirring, add the raw materials, hydrate for 90 minutes, make up the volume, and test at 20-25℃. When the pH value is ≥6.40, turn off the stirring.

[0069] S13. Homogenization: Homogenization pressure is 10 MPa (secondary pressure 3 MPa, primary pressure 10 MPa); homogenization temperature is 65-75℃.

[0070] S14. Sterilization: Sterilization temperature 95℃, sterilization time 305 seconds.

[0071] S15. Inoculation and Fermentation: Turn on the stirrer. After the milk has been added, add the starter culture (the bacteria used for fermentation). Stir for 10 minutes, then turn off the stirrer. Incubate at 30℃ without stirring. Check the fermentation temperature every 3 hours to ensure that the temperature change does not exceed 5℃.

[0072] S16. Whey removal and post-ripening: Heat to 30℃ and remove whey using centrifugation until the curd volume is reduced to about 1 / 3 of its original size; then ripen in a cold storage at 4℃ for 6 hours to obtain the cheese product.

[0073] The test results are shown in Table 2:

[0074] Table 2. Results of Butanedione Content Detection

[0075]

[0076] The above test results show that the dimethylglyoxal (DME) content in cheeses fermented by different strains varies significantly. Even among strains of the same genus and species, cheese fermented with *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 has the highest DME content, but it does not exceed the threshold of 10 mg / kg, which easily leads to putrid, chemical, or metallic odors. The DME content in cheese fermented with *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 is not less than 7.33 mg / kg.

[0077] Effect Experiment Example 2

[0078] This example is an experimental verification of the fermentation stability of Leuconostoc mesenteroides subsp. JMCC0041 at different temperatures. Following the cheese preparation method in Experiment 1, fermentation temperatures were set at 19℃, 22℃, 25℃, 28℃, 31℃, and 35℃. Leuconostoc mesenteroides subsp. JM-0008, JM-0733, JM-0942, JM-0962, and JMCC0041 were used as fermentation strains. After 24 hours of fermentation, the pH of the cheese was analyzed to assess fermentation stability.

[0079] The fermentation capacity fluctuation is calculated and expressed as a percentage of pH fluctuation (pHb).

[0080] Where pHb = (highest pH - lowest pH) / lowest pH × 100%. The experimental results are shown in Table 3:

[0081] Table 3. Results of fermentation stability tests at different temperatures

[0082]

[0083] Note: Different letters indicate significant differences (p < 0.05).

[0084] The above results indicate that Leuconostoc mesenteroides subsp. JMCC0041 exhibits good fermentation performance stability at temperatures of 19℃, 20℃, 22℃, 25℃, 28℃, 31℃, or 35℃, and is applicable to a wide range of fermentation temperatures. This reduces the energy consumption cost of temperature control during the production process and allows it to be adapted to the equipment configurations and process parameters of production enterprises of different scales.

[0085] Effect Experiment Example 3

[0086] This example is a verification experiment on the fermentation stability of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 under different concentrations of edible salt. Following the cheese preparation method of Example 1, edible salt with a mass fraction of 0.5%, 1%, 1.5%, 2.5%, or 4% was added to the fermentation broth (milk to be fermented) before inoculation. Leuconostoc mesenteroides subsp. mesenteroides JM-0008, JM-0733, JM-0942, JM-0962, and JMCC0041 were used as fermentation strains. After 24 hours of fermentation, the pH of the cheese was analyzed to assess fermentation stability.

[0087] The fermentation capacity fluctuation was calculated and expressed as a percentage of pH fluctuation (pHb). The results are shown in Table 4.

[0088] Table 4. Results of Fermentation Stability Tests under Different Edible Salt Conditions

[0089]

[0090] Note: Different letters indicate significant differences (p < 0.05).

[0091] The above results indicate that Leuconostoc mesenteroides subsp. JMCC0041 exhibits good fermentation stability and significant stress resistance under conditions of adding edible salt at mass fractions of 0.5%, 1%, 1.5%, 2.5%, or 4%, making it suitable for fermentation production of high-salt cheese.

[0092] Example 3

[0093] This embodiment provides the application of Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation in the preparation of a starter culture. Specifically, Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 was used alone as a fermentation strain to prepare cheese according to the method in Effect Experiment Example 1.

[0094] In other embodiments, *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 is combined with lactic acid bacteria such as *Lactococcus lactis* subsp. *lactococcus*, *Lactococcus lactis* subsp. *fatty acid*, or *Streptococcus salivarius* subsp. *thermophilus* to prepare a starter culture. Verification showed that the cheese fermented with this combined starter culture exhibited rapid fermentation, a rich creamy aroma, and minimal off-odors, resulting in a significant improvement in overall sensory evaluation satisfaction.

Claims

1. A Leuconostoc mesenteroides subsp. mesenteroides JMCC0041 for cheese fermentation, characterized in that, The 16S rDNA sequence is shown in SEQ ID NO.

1. The *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 strain is deposited at the China General Microbiological Culture Collection Center (CGMCC), located at No. 3, Courtyard 1, Beichen West Road, Chaoyang District, Beijing, with accession number CGMCC NO.34266 and Latin name [not provided]. Leuconostoc mesenteroides subsp. mesenteroides .

2. The application of Leuconostoc mesenteroides subsp. JMCC0041 as described in claim 1 in the preparation of a starter culture.

3. The application of *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 according to claim 2, characterized in that, The starter culture is a compound starter culture containing lactic acid bacteria.

4. The application of *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 according to claim 3, characterized in that, The starter culture is used for fermentation to prepare dairy products.

5. The use of Leuconostoc mesenteroides subsp. JMCC0041 as described in claim 1 in the preparation of cheese.

6. The application of *Leuconostoc mesenteroides* subsp. *enteroides* JMCC0041 as described in claim 1 in the preparation of high-salt cheese, characterized in that... The fermentation broth of the high-salt cheese contains 0.5% to 4% NaCl by mass.