Phenylpyruvate decarboxylase ARO10 mutant and application thereof
By modifying the endogenous phenylpyruvate decarboxylase ARO10 in Saccharomyces cerevisiae, the mutant improved the catalytic activity of indole-3-pyruvate in the yeast, solving the problem of insufficient astaxanthin production in Saccharomyces cerevisiae and achieving a significant increase in astaxanthin production.
Patent Information
- Application Number
- CN202410636889.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-05-21
- Publication Date
- 2025-11-21
AI Technical Summary
The existing endogenous phenylpyruvate decarboxylase ARO10 in Saccharomyces cerevisiae has insufficient catalytic activity and substrate specificity, resulting in low astaxanthin production, which is difficult to meet industrial demand.
The endogenous phenylpyruvate decarboxylase ARO10 of Saccharomyces cerevisiae was modified by site-directed mutagenesis, saturation mutagenesis and iterative saturation mutagenesis. The mutant increased the catalytic activity of indole-3-pyruvate in the yeast and enhanced the production of tryptophan.
It increases the yield of ascorbic acid alcohol in brewer's yeast and has good prospects for industrial application.
Smart Images

Figure BDA0004855165070000031 
Figure BDA0004855165070000111 
Figure BDA0004855165070000121
Abstract
Description
TECHNICAL FIELD
[0001] The present application relates to the field of biotechnology, in particular to a phenylpyruvate decarboxylase ARO10 mutant and application thereof. BACKGROUND
[0002] Tryptophol is a metabolite that can be isolated from plants, bacteria and fungi, has antifungal activity, can be used to control the growth of human pathogenic fungi, and has the effect of treating sleep diseases and other neurological diseases. In addition, the structural modification of the hydroxyethyl moiety of tryptophol makes tryptophol derivatives can be used as key intermediates for the synthesis of a series of indole molecules with significant pharmacological activity. In yeast, indole-3-pyruvic acid is used as a substrate, and phenylpyruvate decarboxylase ARO10 decarboxylates to form indole-3-acetaldehyde, which is then reduced by ethanol dehydrogenase in the body to generate tryptophol. However, ARO10 is a pyridoxal phosphate-dependent phenylpyruvate decarboxylase with broad substrate specificity, which can catalyze multiple reactions of the same type in Saccharomyces cerevisiae. Therefore, it is of important practical significance to use enzyme engineering methods to modify the endogenous phenylpyruvate decarboxylase ARO10 of Saccharomyces cerevisiae to obtain mutants with high catalytic activity and substrate specificity for indole-3-pyruvic acid. SUMMARY
[0003] The present application aims at the shortcomings of phenylpyruvate decarboxylase ARO10, and provides ARO10 mutants, engineering bacteria and applications in tryptophol production. The phenylpyruvate decarboxylase is modified by site-directed mutation, saturation mutation and iterative saturation mutation to improve the reaction activity of the enzyme for indole-3-pyruvic acid, and the mutant strain obtained can effectively improve the yield of tryptophol in Saccharomyces cerevisiae.
[0004] In order to achieve the above-mentioned application purposes, the present application provides the following technical solutions:
[0005] In a first aspect, the present application provides a phenylpyruvate decarboxylase ARO10 mutant, which comprises any one or more of the following mutations: I335, H339, and A628, wherein the I335, H339, and A628 are the 335th, 339th, and 628th amino acid residues in the amino acid sequence of the phenylpyruvate decarboxylase ARO10 shown in SEQ ID NO. 1, and the mutations are obtained by mutating the I335, H339, and A628 to other amino acid residues.
[0006] In some embodiments of the present application, the phenylpyruvate decarboxylase ARO10 has the following characteristics:
[0007] (I) the amino acid sequence shown in SEQ ID NO. 1; or
[0008] (II) a sequence in which one or more amino acids are substituted, deleted, added and / or replaced based on the amino acid sequence shown in (I); or
[0009] (III) a sequence having more than 90% homology with the amino acid sequence shown in (I) or (II).
[0010] In some embodiments of the present application, the phenylpyruvate decarboxylase ARO10-encoding nucleic acid has:
[0011] (I) the nucleotide sequence shown in SEQ ID NO. 2; or
[0012] (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I), but different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0013] (III) a nucleotide sequence obtained by substituting, deleting or adding one or more nucleotides from the nucleotide sequence shown in (I) or (II), and a nucleotide sequence having the same or similar function as the nucleotide sequence shown in (I) or (II); or
[0014] (IV) a nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequence shown in (I), (II) or (III).
[0015] In some embodiments of the present application, the mutation of I335 includes, but is not limited to, mutation to V or T; and / or
[0016] The mutation of H339 includes, but is not limited to, mutation to G, T, C or R; and / or
[0017] The mutation of A628 includes, but is not limited to, mutation to Y, Q or K.
[0018] In some embodiments of the present application, the mutant includes any of the following:
[0019] (I) H339G; or
[0020] (II) H339T; or
[0021] (III) H339C; or
[0022] (IV) H339R; or
[0023] (V) H339C, I335V; or
[0024] (VI) H339C, I335T; or
[0025] (VII), H339C, I335T, A628Y; or
[0026] (VIII), H339C, I335T, A628Q; or
[0027] (IX), H339C, I335T, A628K.
[0028] In a second aspect, the present application provides a nucleic acid molecule encoding the mutant phenylpyruvate decarboxylase ARO10.
[0029] In some embodiments of the present application, the nucleic acid molecule has:
[0030] (I) a nucleotide sequence as shown in any one of SEQ ID NO. 3-11; or
[0031] (II) a nucleotide sequence encoding the same protein as the nucleotide sequence shown in (I), but different from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or
[0032] (III) a nucleotide sequence obtained by substitution, deletion or addition of one or more nucleotides to the nucleotide sequence shown in (I) or (II), and a nucleotide sequence functionally identical or similar to the nucleotide sequence shown in (I) or (II); or
[0033] (IV) a nucleotide sequence having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology to the nucleotide sequence shown in (I), (II) or (III).
[0034] In a third aspect, the present application provides a recombinant expression vector, expression cassette or construct comprising the nucleic acid molecule.
[0035] In a fourth aspect, the present application provides a host transfected or transformed with the recombinant expression vector, expression cassette or construct.
[0036] In some embodiments of the present application, the host includes a transgenic cell line and / or a recombinant strain.
[0037] Preferably, the recombinant strain includes an engineered Saccharomyces cerevisiae strain.
[0038] In a fifth aspect, the present application provides the use of any one of the following in the preparation of resveratrol:
[0039] (I) the mutant phenylpyruvate decarboxylase ARO10;
[0040] (II) the nucleic acid molecule;
[0041] (III) the recombinant expression vector, expression cassette or construct;
[0042] (IV) the host.
[0043] In a sixth aspect, the present application further provides a method for preparing the mutant phenylpyruvate decarboxylase ARO10, fermenting the host to obtain a fermentation broth containing the mutant phenylpyruvate decarboxylase ARO10.
[0044] In a seventh aspect, the present application further provides a method for preparing tryptophol, using indole-3-pyruvic acid as a substrate, expressing the mutant phenylpyruvate decarboxylase ARO10 in Saccharomyces cerevisiae, using YPD medium with pH 5-9 as a reaction medium, fermenting at 30-37℃ and 0-600rpm, collecting the fermentation broth and separating and purifying to obtain tryptophol.
[0045] Experiments of the present application demonstrate that the mutant phenylpyruvate decarboxylase ARO10 expressed in Saccharomyces cerevisiae can effectively improve the yield of tryptophol in Saccharomyces cerevisiae compared with wild-type phenylpyruvate decarboxylase ARO10, and has good industrial application prospect. BRIEF DESCRIPTION OF DRAWINGS
[0046] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced as follows.
[0047] Figure 1 Figure 1 is a chart showing the yield of tryptophol in Saccharomyces cerevisiae recombinant strain CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R expressing the mutant phenylpyruvate decarboxylase ARO10;
[0048] Figure 2 Figure 2 is a chart showing the yield of tryptophol in Saccharomyces cerevisiae recombinant strain CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R expressing the mutant phenylpyruvate decarboxylase ARO10;
[0049] Figure 3 Figure 3 is a chart showing the yield of tryptophol in Saccharomyces cerevisiae recombinant strain CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R expressing the mutant phenylpyruvate decarboxylase ARO10. DETAILED DESCRIPTION
[0050] The present application discloses phenylpyruvate decarboxylase ARO10 mutant and its application, and those skilled in the art can improve the process parameters according to the content of the present application. It is particularly pointed out that all similar substitutions and changes are obvious to those skilled in the art, and they are considered to be included in the present application. The method and application of the present application have been described by the preferred embodiments, and the related personnel can obviously modify or appropriately change and combine the method and application described herein without departing from the content, spirit and scope of the present application, to realize and apply the present application technology.
[0051] The amino acid sequence (SEQ ID NO. 1) of phenylpyruvate decarboxylase ARO10 in the present application is:
[0052] MAPVTIEKFVNQEERHLVSNRSATIPFGEYIFKRLLSIDTKSVFGVPGDFNLSLLEYLYSPSVESAGLRWVGTCNELNAAYAADGYSRYSNKIGCLITTYGVGELSALNGIAGSFAENVKVLHIVGVAKSIDSRSSNFSDRNLHHLVPQLHDSNFKGPNHKVYHDMVKDRVACSVAYLEDIETACDQVDNVIRDIYKYSKPGYIFVPADFADMSVTCDNLVNVPRISQQDCIVYPSENQLSDIINKITSWIYSSKTPAILGDVLTDRYGVSNFLNKLICKTGIWNFSTVMGKSVIDESNPTYMGQYNGKEGLKQVYEHFELCDLVLHFGVDINEINNGHYTFTYKPNAKIIQFHPNYIRLVDTRQGNEQMFKGINFAPILKELYKRIDVSKLSLQYDSNVTQYTNETMRLEDPTNGQSSIITQVHLQKTMPKFLNPGDVVVCETGSFQFSVRDFAFPSQLKYISQGFFLSIGMALPAALGVGIAMQDHSNAHINGGNVKEDYKPRLILFEGDGAAQMTIQELSTILKCNIPLEVIIWNNNGYTIERAIMGPTRSYNDVMSWKWTKLFEAFGDFDGKYTNSTLIQCPSKLALKLEELKNSNKRSGIELLEVKLGELDFPEQLKCMVEAAALKRNKK
[0053] One of the technical solutions of the present application provides a phenylpyruvate decarboxylase mutant, the phenylpyruvate decarboxylase mutant is a new amino acid sequence obtained by mutating any one or more of the 335th isoleucine (I335), the 339th histidine (H339), and the 628th alanine (A628) amino acid residues in the ARO10 amino acid sequence shown in SEQ ID NO. 1 into other amino acid residues, and the mutant has obvious improvement on the yield of ophthalmic alcohol in Saccharomyces cerevisiae compared with the ARO10 composed of the amino acid sequence shown in SEQ ID NO. 1.
[0054] Specifically, preferably, the ARO10 mutant is mutated to one of the following: the mutation of I335 includes but is not limited to mutation into V or T, the mutation of H339 includes but is not limited to mutation into G, T, C or R, and the mutation of A628 includes but is not limited to mutation into Y, Q or K. (1) the 339th histidine is mutated into glycine; (2) the 339th histidine is mutated into threonine; (3) the 339th histidine is mutated into cysteine; (4) the 339th histidine is mutated into arginine; (5) the 339th histidine is mutated into cysteine, and the 335th isoleucine is mutated into valine; (6) the 339th histidine is mutated into cysteine, and the 335th isoleucine is mutated into threonine; (7) the 339th histidine is mutated into cysteine, the 335th isoleucine is mutated into threonine, and the 628th alanine is mutated into tyrosine; (8) the 339th histidine is mutated into cysteine, the 335th isoleucine is mutated into threonine, and the 628th alanine is mutated into glutamine; (9) the 339th histidine is mutated into cysteine, the 335th isoleucine is mutated into threonine, and the 628th alanine is mutated into lysine.
[0055] The gene encoding the protein is also within the protection scope of the present application, and the gene sequence is shown in the sequence listing.
[0056] Table 1 Amino acid / nucleotide sequence of ARO10 and its mutant
[0057]
[0058]
[0059] SEQ ID NO. 3 (ARO10-H339G nucleotide sequence)
[0060]
[0061] SEQ ID NO. 4 (ARO10-H339T nucleotide sequence)
[0062]
[0063] SEQ ID NO. 5 (ARO10-H339C nucleotide sequence)
[0064]
[0065] SEQ ID NO. 6 (ARO10-H339R nucleotide sequence)
[0066]
[0067] SEQ ID NO. 7 (ARO10-H339C / I335V nucleotide sequence)
[0068]
[0069] SEQ ID NO. 8 (ARO10-H339C / I335T nucleotide sequence)
[0070]
[0071] SEQ ID NO. 9 (ARO10-H339C / I335T / A628Y nucleotide sequence)
[0072]
[0073] SEQ ID NO. 10 (ARO10-H339C / I335T / A628Q nucleotide sequence)
[0074]
[0075] SEQ ID NO. 11 (ARO10-H339C / I335T / A628K nucleotide sequence)
[0076]
[0077] The mutant of the application can be used in vivo in Saccharomyces cerevisiae. The in vivo use includes mutating the amino acid sequence of phenylpyruvate decarboxylase in the genome of Saccharomyces cerevisiae to ferment metabolites.
[0078] Specifically, the method comprises the following steps:
[0079] 1) Mutating any one or more of the 335th isoleucine (I335), the 339th histidine (H339), and the 628th alanine (A628) amino acid residues in the ARO10 gene encoding phenylpyruvate decarboxylase in the genome of the Saccharomyces cerevisiae strain to form a mutant strain.
[0080] 2) Culturing the Saccharomyces cerevisiae engineering strain obtained above to express the phenylpyruvate decarboxylase ARO10 mutant protein to obtain a Saccharomyces cerevisiae seed liquid.
[0081] 3) Inoculating the Saccharomyces cerevisiae seed liquid into a YPD fermentation medium to ferment to obtain a fermentation liquid.
[0082] 4) Detecting the yield of resveratrol by high performance liquid chromatography.
[0083] The method for comparing the mutant and the wild type is mutating different ARO10 amino acid sites in the genome of Saccharomyces cerevisiae, and comparing the difference in the yield of resveratrol generated by the different mutant strains and the wild type strain. In the experiment, the high performance liquid chromatography is used to detect the yield of resveratrol to determine the level of conversion, and the specific experimental method and data are in the method of the application. The yield of resveratrol of the Saccharomyces cerevisiae expressing the phenylpyruvate decarboxylase ARO10 mutant is significantly higher than that of the wild type, and has a good application prospect.
[0084] The phenylpyruvate decarboxylase ARO10 mutant and the raw materials and reagents used in the application thereof can be purchased from the market.
[0085] The application will be further described below in combination with examples:
[0086] Example 1: Saccharomyces cerevisiae expressing ARO10 single mutant to improve the yield of resveratrol
[0087] 1) Inserting the gene (SEQ ID NO. 2) encoding phenylpyruvate decarboxylase ARO10 into the vector PUC19-ARO10-HR with the homologous arms of 1000 bp upstream and downstream of the genome ARO10 to form an expression cassette.
[0088] SEQ ID NO. 2 (ARO10 nucleotide sequence)
[0089]
[0090] 2) Point mutation to obtain ARO10 mutant, the following Table 2 primer PCR amplification.
[0091] Table 2 ARO10 single mutant construction primer
[0092]
[0093] PCR amplification conditions are as follows:
[0094] First 95℃ pre-denaturation 10min, then 98℃ 30s, 58℃ 30s, 72℃ 5min, a total of 26 cycles; finally 72℃ extension 5min. The product is treated with DpnI for 2 hours, and the above PCR product is recovered. Transform into E. coli DH5α, and use the plasmid after quality improvement and sequencing verification.
[0095] 3) In CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R Strain genome, using CRISPR / Cas9 mediated genome knock-in technology; the method of gene knock-in, the plasmid carries the gene of Cas9 protein and a sequence for transcription of sgRNA, the transcribed sgRNA combines with Cas9 protein, only need to introduce a spacer and a homologous recombination fragment matched with the target gene on the plasmid, introduce the reconstructed plasmid into the cell, because the designed homologous recombination fragment is with phenylpyruvate decarboxylase ARO10 mutant expression cassette, the purpose gene cut in vivo of eukaryotic cell, with homologous recombination way, with the homologous arm on the plasmid as template repair, so as to complete the purpose of gene knock-in.
[0096] Construction method of gene knock-in vector:
[0097] This study adopts two-step method of GoldenGate assembly and Gibson Assembly assembly to complete the construction of vector:
[0098] 1. GoldenGate assembly
[0099] GoldenGate assembly is generally used to assemble Cas9 pCas-lacZ plasmid and target spacer fragment, wherein the front of gRNA of pCas-lacZ has two BsaI enzyme cutting sites, so the spacer fragment also needs to add BsaI enzyme cutting site, leaving complementary sticky ends with the vector. Therefore, the following describes the method of GoldenGate assembly of spacer and pCas-lacZ.
[0100] (1) Obtaining of spacer double-stranded DNA: a pair of primers (forward primer: SEQ ID NO. 20: 5'-CTTTGGTCTCACTTT-GCGTAATCTGGAACATCGTA-GTTTAGAGACCTTTC-3', reverse primer: SEQ ID NO. 21: 5'-GAAAGGTCTCTAAAC-TACGATGTTCCAGATTACGC-AAAGTGAGACCAAAG-3') with Bsal enzyme cutting site and sticky end complementary to the vector were synthesized. The reaction was prepared according to the following system, 1 μL of forward primer (100 μM), 1 μL of reverse primer (100 μM), 1 μL of T4 DNA ligase buffer (NEB), and ddH2O was added to make up to 10 μL. Finally, the prepared reaction system was placed in a PCR instrument, and after the reaction according to the following program was completed, the double-stranded DNA fragment was obtained. 95 °C for 5 min, and the PCR instrument was slowly cooled (1 °C / min) to 25 °C.
[0101] (2) GoldenGate assembly: The double-stranded DNA obtained in the previous step was first diluted 10 times with ddH2O, and then the reaction was prepared according to the system in Table 3, and the reaction (about 4 hours) was carried out according to the program in Table 4.
[0102] Table 3 GoldenGate reaction system
[0103]
[0104] Table 4 Reaction program of GoldenGate
[0105]
[0106] 2. Gibson Assembly assembly
[0107] (1) Obtaining of linearized vector: linearized vector was obtained by restriction enzyme or PCR. The enzyme cutting system was prepared according to the instructions of the corresponding enzyme of NEB, generally 5 μL of 10x reaction buffer, 1 μL of restriction enzyme (double enzyme cutting, each adding 1 μL of corresponding enzyme), 1 μg of vector DNA, and ddH2O was added to make up to 50 μL. The prepared enzyme cutting system was controlled at 37 °C for 1-3 hours by using a thermal cycler (PCR instrument). Single enzyme cutting can be added with 1 μL of CIP after enzyme cutting, and then recovered after 37 °C treatment for 1 hour.
[0108] (2) Obtaining of DNA to be assembled: the target gene was amplified by PCR, and at least 15 nt of the same sequence (homologous arm) was added to the two ends of the other DNA to be assembled on the primer, and the DNA with homologous arm was recovered.
[0109] (3) Assembly: Assemble each DNA fragment (including linearized vector) with homology arm using commercialized Gibson Assembly kit (HiFi DNA Assembly Cloning Kit). Prepare according to the system of the instruction (5 μL GAMix, 50-100 ng of each DNA fragment, add ddH2O to 10 μL), and react at 50°C for 1 hour.
[0110] sgRNA: GCGTAATCTGGAACATCGTA (as shown in SEQ ID NO. 22)
[0111] Homology arm:
[0112] Left homology arm: (as shown in SEQ ID NO. 23)
[0113] TAAACATAGGATAGATTAAATAAGAAATCATATGAAAAAAGAATAAAGTAAGAAAATAGTTCAATGTATATTCGTCAGTTCAGGGTGTGAAAAGGTGGCAATTTTTTTGTTTCCGACCCGTAACAAGTGTTCAATGGTGGTGAAGTCTTTTCTTGGCAAATTTCTATACTTCCCAAATTCTTCATGAATATAATTCACAAAATTAACTTGGTTTTCCTTTGGTTTTGTATGAGCCGTTCGTATGGAAGCCCTATACAGGTGTAAGACTTCTTTTTGTAACCCACTTAATCTCTTAGGCATGCTCTTGGTATTGCGTCTCCTCTTCTTCTTGTGTGTTTAAGCTACATTATCTTTGTTAAGAATAATTTGGCGAACCCCTTTTTTTCTTCGGCTTTGCAAGGTTAATTAATTAACATCTACCAGTTTTACTACATTTTAGATTGGTTCGTCCACCGAAATTTAAAAAAGCAGGATTGAAAGCGTACAACAACGTCTTAGCGAAAAAGATAATCCAAAATTCGATGCTTGTACACCTCATGTAGCTTCCTTATTAACATTTGGTAGTAGGCTTAGGCTATTTTTTGAAAAAGCCGTCATATATTACTTTGAGCCTTTGCGAATCCTCTCCAAAGTGTCGGTTACCTACCGGGAGGGATAACCGCGGATAGCCGTCATTTACCGAAAATTGCCGAGGTCATGCTGAGCATTTGTCGTACTTTTGTGCGGCGGAGCTTTGATACCTTCGGTAAGTGTCGGTATGTAATAGGTTAGTGGCATCTTATTTATTGTGTTGAGTAAAGTTTAAGATATAAACTGGGCTAGTTTGCATCGTCACTACAGCGGCAGCTCACTTTCATTTTTTTTCTGCGTTTATTAATACTACATAAAATCTGATATAAAACATATTTAACTGATCAACCCTCTCAACTTGATACTCAAAACAAGTTGACGCGACTTCTGTAAAGTTTATTTACAAGATAACAAAGAAACTCCCTTAAGC.
[0114] Right homology arm: (as set forth in SEQ ID NO. 24)
[0115] AAACTTGTGGGCGCAATTATAAAACACTGCTACCAATTGTTCGTTTTCTGTTCATTAACACATAAAAAACCCTTATGTAACTATATTTACAAAGTAAATACGTATATTAAAGCTATTTTACCACTACCACAGAGTTCTTTGTCCAGTTGCTAGTATTTTTTTTTTCGCGACGAGGCAGGGGCGGGGAGACGTGTTGTTTTTCCACGGCTTTCGGCTCACCACTTGAAGAACTATAAAAGGCCGCCAAATTTATCCTTTTTCACTTCTTCCGTTCGCTTTTTTCTGTCATTCCTATCGTGTGTTTAGTAGTAGGTTTTTTTGTTAGAAGAAGTTTTATCCGAAAACTATCGAAGACAAATAGATAAAAAAATCTCCCTCGTTCTATTTGAAACTTTAAGAAATCCATATTAAGAAAATACCTACATCTGCTAAATGTCTGCTAACTTAGATAAATCCTTAGACGAAATCATTGGCTCTAACAAAGCAGGAAGTAATAGAGCCCGTGTCGGTGGTACTCGTGGTAACGGTCCAAGAAGAGTTGGTAAGCAAGTTGGTAGCCAACGTAGGAGCCTTCCAAACAGAAGAGGCCCTATCAGAAAAAATACTAGGGCACCTCCAAACGCAGTCGCTAGAGTTGCCAAGCTCTTGGACACCACTAGAGAGGTCAAGGTCAACGTCGAAGGTTTGCCAAGGGACATTAAGCAGGATGCTGTAAGAGTATGTTAATACGTGAAATGAGAGCTATTTGTTTAGTTACTCGCATCGTCTCGTGTGGATACGAGAAATATTCTTTGTAAGGAAGGATATGGCACACGCTTTTGATCAAGAATTCTCTTTTTAGAGATGAAGAAAGAGTCCGAAATACTTCGCTAGAGAAAATACAAAAAGAGTATCGTTTTCATAAGCCAACCATACCAATTTTTTTCAATACTTCAAATCATGGCCTATAAGGTTGGAATTACCAGCTACCACTGAGAATGGGTTTGTTCTTATTGGCTGG.
[0116] Thus, the Saccharomyces cerevisiae engineering strain expressing the above-mentioned mutant of phenylpyruvate decarboxylase ARO10 on the genome of Saccharomyces cerevisiae is obtained.
[0117] 4) Strain construction (transformation-verification)
[0118] 1, inoculate the target strain (CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R ) in 4 mL YPD, 30°C overnight shaking;
[0119] 2, take 2 mL of bacterial solution in 50 mL YPD, 30°C shaking for 6h, OD600 = 0.8-1.0;
[0120] 3, centrifuge, 3000 rpm, 2 min, discard the supernatant;
[0121] 4, boil the ssDNA sample for 10 min, quickly insert into ice;
[0122] 5, resuspend the bacterial cells with 50 ml sterile water, centrifuge;
[0123] 6, resuspend with 1 ml of 100 mM LiAc, 12000 rpm, 15 s to absorb the supernatant;
[0124] 7, suspend the cells to a final volume of 500 μL, about 100 mM LiAc 400 μL, divide into 50 μL / tube, centrifuge, discard the supernatant;
[0125] 8, add "transformation mixture" in order:
[0126] 240 μL PEG3350 (50%)
[0127] 36 μL 1 mol / L LiAc
[0128] 10 μL ssDNA (10 mg / mL) (manufacturer: Solarbio Cat.NO. H1060)
[0129] 50 μL with spacer and Cas9 plasmid containing ARO10 mutation and upstream and downstream homologous arms
[0130] 9, vortex each reaction tube until the cells are completely mixed;
[0131] 10, 30°C for 30 min;
[0132] 11, 42°C heat shock for 25 min;
[0133] 12, YPD medium incubation for 4 hours, 30℃, 220rpm;
[0134] 13, coating YPD-G418 resistance plate.
[0135] 14, the plate to be transformed grows clones, pick single colony PCR to obtain the desired fragment, sanger sequencing to verify whether the correct knock-in mutant with phenylpyruvate decarboxylase ARO10 in Saccharomyces cerevisiae.
[0136] 15, pick the verified successful clones, culture in YPD for 24 hours, 30℃, 220rpm, and store bacteria.
[0137] 5) fermentation method
[0138] 1, culture Saccharomyces cerevisiae strain on YPD plate, activate Saccharomyces cerevisiae strain;
[0139] 2, pick single colony in 4mL YPD liquid, culture for 18 hours to OD 600 =1-10;
[0140] 3, transfer 4mL YPD culture to 50mL YPD medium according to 1.5:50, culture at 30℃, 220rpm for 96 hours;
[0141] 4, collect the supernatant of fermentation broth, and obtain the fermentation broth containing color alcohol.
[0142] 6) detection method
[0143] The detection method of the method of the application is to detect the content of color alcohol by high performance liquid chromatography.
[0144] General liquid phase condition: the sample amount of fermentation broth / reaction liquid is 10μL. The mobile phase is A and D two phases, wherein the A phase is 0.1% formic acid water, and the D phase is acetonitrile. The high performance liquid chromatograph is Agilent 1260, and the EC-C18 column of Agilent (Agilent, 4μm, 4.6mm*150mm). The two mobile phases A and D, solution A is 0.1% (v / v) formic acid aqueous solution, and solution D is chromatographic grade acetonitrile. 0-8 minutes, 75% A solution and 25% D solution; 8-12 minutes, 75% A solution linear gradient decreases to 5%, 25% D solution linear gradient increases to 95%; 12-15 minutes, 5% A solution and 95% D solution; 15-20 minutes, 75% A solution and 25% D solution. The detection wavelength is 224nm, the column oven temperature is 35℃, and the flow rate is 1ml / min. The peak time of color alcohol is 6.543min.
[0145] The colorol production of different phenylpyruvate decarboxylase ARO10 single mutant expressed in Saccharomyces cerevisiae is shown in Table 5. The difference between the mutant and the wild type was analyzed by t-test, and the graph is shown in Figure 1
[0146] Table 5 Colorol production of different phenylpyruvate decarboxylase ARO10 single mutant expressed in Saccharomyces cerevisiae
[0147] ARO10 Trans-ferulic acid production (mg / L) P value Significance difference analysis Wild type 21.1±0.46 1 No significant difference H339C 25.4±0.23 0.0003 P<0.01, extremely significant difference H339R 23.7±0.01 0.0001 P<0.05, extremely significant difference H339T 22.8±0.01 0.005 P<0.01, extremely significant difference H339G 22.4±1.19 0.0126 P < 0.05, significant difference
[0148] 7) Among the above mutants, the colorol production of H339C, H339R, H339T, and H339G mutants was increased compared with the wild type strain, which was 25.4 mg / L, 23.7 mg / L, 22.8 mg / L, and 22.4 mg / L, respectively, and the results were significantly different from the wild type.
[0149] Example 2 Saccharomyces cerevisiae expressing ARO10 double mutant fermentation to improve colorol production
[0150] 1) Based on Example 1, the H339C mutant with the highest colorol production was selected to continue iterative saturation mutation of the following 335th amino acid, and the primers are as shown in Table 6:
[0151] Table 6 Primers for constructing ARO10 double mutants
[0152]
[0153] The PCR amplification conditions are as follows:
[0154] Pre-denaturation at 95°C for 10 min, then 98°C for 30 s, 58°C for 30 s, 72°C for 5 min, for a total of 26 cycles; finally, 72°C for 5 min. The product is treated with DpnI for 2 hours, and the above PCR product is recovered. Transform into E. coli DH5α, and use the plasmid after sequencing verification.
[0155] 2) In the CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R Strain genome, referring to the gene knock-in vector construction method, strain construction method, fermentation method and detection method described in 3), 4), 5), 6) of Example 1, Saccharomyces cerevisiae fermentation test of phenylpyruvate decarboxylase ARO10 double mutant was carried out.
[0156] The colorol production of different phenylpyruvate decarboxylase ARO10 double mutant expressed in Saccharomyces cerevisiae is shown in Table 7. The difference between the mutant and the wild type was analyzed by t-test, and the graph is shown in Figure 2
[0157] Table 7: Yield of resveratrol in Saccharomyces cerevisiae expressing different double mutants of phenylpyruvate decarboxylase ARO10
[0158] ARO10 Trans-ferulic acid production (mg / L) P value Significance difference analysis H339C 25.4±0.12 1 No significant difference H339C / I335T 27.9±0.27 0.0003 P<0.01, extremely significant difference H339C / I335V 26.9±0.37 0.0053 P<0.01, extremely significant difference
[0159] 3) Among the above mutants, the two double mutants H339C / I335T and H339C / I335V have higher resveratrol yield than the single mutant H339C, which are 27.9 mg / L and 26.9 mg / L, respectively, and the results are significantly different from the single mutant H339C.
[0160] Example 3: Saccharomyces cerevisiae expressing ARO10 triple mutants for fermentation to improve resveratrol yield
[0161] 1) Based on Example 2, the H339C / I335T double mutant with the highest resveratrol yield was selected to continue iterative saturation mutation of the following 628th amino acid, and the primers are as shown in Table 8 below:
[0162] Table 8: Primers for constructing ARO10 double mutants
[0163]
[0164]
[0165] The PCR amplification conditions are as follows:
[0166] Pre-denaturation at 95°C for 10 min, then 98°C for 30 s, 58°C for 30 s, 72°C for 5 min, for a total of 26 cycles; finally, extension at 72°C for 5 min. The product was treated with DpnI for 2 hours, and the above PCR product was recovered. Transform into E. coli DH5α, and use the plasmid after sequencing verification.
[0167] 2) In CEN.PK2-1C-ARO3 D154N -ARO4 K229L -720a::TRP2 S65L / S76R Strains, the gene knock-in vector construction method, strain construction method, fermentation method, and detection method described in 3), 4), 5), and 6) of Example 1 were used to test Saccharomyces cerevisiae fermentation of phenylpyruvate decarboxylase ARO10 triple mutants.
[0168] The resveratrol yield of different phenylpyruvate decarboxylase ARO10 triple mutants is shown in Table 9 below, and t-test was used to analyze the difference between the mutants and the wild type, and the graph is shown in Figure 3 :
[0169] Table 9: Yield of resveratrol in Saccharomyces cerevisiae expressing different triple mutants of phenylpyruvate decarboxylase ARO10
[0170] ARO10 Trans-ferulic acid production (mg / L) P value Significance difference analysis H339C / I335T 30.7±0.27 1 No significant difference H339C / I335T / A628Q 37.6±2.29 0.0134 P < 0.05, significant difference H339C / I335T / A628K 33.8±1.04 0.0159 P < 0.05, significant difference H339C / I335T / A628Y 32.7±1.44 0.0276 P < 0.05, significant difference
[0171] 3) Among the above mutants, the three triple mutants H339C / I335T / A628Q, H339C / I335T / A628K, H339C / I335T / A628Y have higher production of the colorol than the double mutant H339C / I335T, which are 37.6 mg / L, 33.8 mg / L, 32.7 mg / L respectively, and the results are significantly different from the double mutant H339C / I335T.
[0172] The above merely describes the preferred embodiments of the present application, and it should be noted that those of ordinary skill in the art can make several improvements and refinements without departing from the principles of the present application, and these improvements and refinements should also be considered within the protection scope of the present application.
Claims
1. A phenylpyruvate decarboxylase ARO10 mutant, characterized in that, The phenylpyruvate decarboxylase ARO10 mutant is obtained by mutating one or more of the following amino acid residues in the amino acid sequence of phenylpyruvate decarboxylase ARO10 shown in SEQ ID NO.1 to other amino acid residues.
2. The phenylpyruvate decarboxylase ARO10 mutant as described in claim 1, characterized in that, The mutations of I335 include, but are not limited to, mutations to V or T; and / or H339 mutations include, but are not limited to, mutations to G, T, C, or R; and / or Mutations in A628 include, but are not limited to, mutations to Y, Q, or K.
3. The mutant as described in claim 1 or 2, characterized in that, Includes any of the following: (I), H339G; or (II) H339T; or (III) H339C; or (IV), H339R; or (V), H339C, I335V; or (VI), H339C, I335T; or (VII), H339C, I335T, A628Y; or (VIII), H339C, I335T, A628Q; or (IX), H339C, I335T, A628K.
4. A nucleic acid molecule encoding the phenylpyruvate decarboxylase ARO10 mutant as described in any one of claims 1 to 3.
5. The nucleic acid molecule as described in claim 4, characterized in that, It has the following characteristics: (I) A nucleotide sequence as shown in any one of SEQ ID NO. 3 to 11; or (II) A nucleotide sequence that encodes the same protein as the nucleotide sequence shown in (I), but differs from the nucleotide sequence shown in (I) due to the degeneracy of the genetic code; or (III) A nucleotide sequence obtained by substituting, deleting, or adding one or more nucleotide sequences to the nucleotide sequence shown in (I) or (II), and which has the same or similar function to the nucleotide sequence shown in (I) or (II); or (IV) and nucleotide sequences having at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98% or 99% sequence homology with the nucleotide sequences described in (I), (II) or (III).
6. A recombinant expression vector, expression cassette, or construct, characterized in that, It contains the nucleic acid molecule as described in claim 4 or 5.
7. The host, characterized in that, The transfection or transformation includes the recombinant expression vector, expression cassette, or construct as described in claim 6; the host includes transgenic cell lines and / or recombinant strains; preferably, the recombinant strain includes engineered Saccharomyces cerevisiae strains.
8. Any of the following applications in the preparation of chromools; (i) The phenylpyruvate decarboxylase ARO10 mutant as described in any one of claims 1 to 3; (ii) The nucleic acid molecule as described in claim 4 or 5; (iii) The recombinant expression vector, expression cassette, or construct as described in claim 6; (iv) The host as described in claim 7.
9. The method for preparing the phenylpyruvate decarboxylase ARO10 mutant according to any one of claims 1 to 3, characterized in that, Fermentation is carried out on the host as described in claim 7 to obtain a fermentation broth containing the phenylpyruvate decarboxylase ARO10 mutant as described in any one of claims 1 to 3.
10. A method for preparing chromool, characterized in that, Using indole-3-pyruvate as a substrate, the phenylpyruvate decarboxylase ARO10 mutant as described in any one of claims 1 to 3 was expressed in Saccharomyces cerevisiae. YPD medium with pH 5 to 9 was used as the reaction medium, and fermentation was carried out at 30 to 37°C and 0 to 600 rpm. The fermentation broth was collected, separated, and purified to obtain chromol.