Escherichia coli self-regulation anti-acid module and application thereof
By using the self-regulating acid-resistant module of E. coli to dynamically regulate gene expression and energy supply, the problem of growth and production efficiency of E. coli under acid stress was solved, and efficient fermentation under acidic conditions was achieved.
Patent Information
- Application Number
- CN202511175764.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-21
- Publication Date
- 2025-11-21
AI Technical Summary
Escherichia coli faces acid stress during industrial fermentation of organic acids, leading to cell damage and reduced production efficiency. Traditional methods are costly and have non-target effects.
A self-regulating acid-resistance module for Escherichia coli was developed, comprising an acid-responsive promoter PyfdX, acid-resistance units (gadB and gadC), and ATP-promoting units (pykA and gatB), which dynamically regulates gene expression and enhances acid resistance and energy supply.
It significantly improves the tolerance and growth capacity of Escherichia coli under acidic conditions, increases the production efficiency of organic acids, and reduces the cost of alkali addition.
Smart Images

Figure CN120989116A_ABST
Abstract
Description
TECHNICAL FIELD
[0001] The application belongs to the field of bioengineering, relates to the field of biological fermentation, and particularly relates to an Escherichia coli self-regulated acid resistance module and application thereof. BACKGROUND
[0002] In the field of biological manufacturing and synthetic biology, Escherichia coli has become a core industrial strain for producing high-value chemicals and biological drugs due to its clear genetic background, diverse metabolic pathways and simple culture conditions. However, in the industrial fermentation process of organic acids, Escherichia coli needs to maintain high-speed growth and metabolism at neutral pH (pH 6.8-7.2) to achieve efficient synthesis of target products. However, in actual fermentation, sugar metabolism (especially the rapid decomposition of glucose) will continuously accumulate organic acid byproducts (such as acetic acid and lactic acid) or the product itself, resulting in a rapid drop in the pH of the fermentation broth from the initial value to the acidic range (pH < 5.5) within 12-24 hours, or even as low as pH 4.0. This extremely acidic environment can cause multiple cell injuries: the imbalance of proton gradient leads to a 30%-50% decrease in ATP synthesis efficiency, the change in cell membrane fluidity reduces the material transport rate across the membrane by more than 60%, and protein misfolding and DNA damage directly inhibit bacterial growth. In response to acid stress, Escherichia coli has evolved an acid resistance system, and the AR2 system is one of the key defense mechanisms: it converts glutamate to gamma-aminobutyric acid (GABA) through glutamate decarboxylase (GadA / B) using glutamate as a substrate, and one proton is discharged for each molecule of glutamate consumed. This system realizes the transmembrane exchange of glutamate / GABA through the reverse transporter GadC, and has high efficiency.
[0003] Using a constitutive promoter to express acid resistance system genes may cause excessive synthesis of unnecessary proteins, thereby affecting the growth rate, and the modification of global regulatory factors may cause non-target effects (such as decreased motility and enhanced biofilm formation). The traditional process maintains neutral pH by continuously adding alkali, which can alleviate acid stress, but this method is costly, increases the burden of downstream separation, and may cause process fluctuations. Therefore, it is necessary to develop an acid-resistant genetic element for constructing an acid-resistant engineering strain to achieve high-efficiency fermentation at low pH. SUMMARY
[0004] In order to solve the problem of acid stress of Escherichia coli in the industrial fermentation process of organic acids, the application provides an Escherichia coli self-regulated acid resistance module and application thereof, which can be used to improve the acid resistance and fermentation production performance of Escherichia coli under industrial conditions.
[0005] The technical scheme adopted by the application is: an Escherichia coli self-regulated acid resistance module, comprising an acid-responsive promoter P yfdX, an anti-acid unit, an ATP synthesis promoting unit, a terminator T rrnB ; the anti-acid unit comprises glutamate decarboxylase B encoding gene gadB and glutamate / gamma-aminobutyric acid antiporter encoding gene gadC; the ATP synthesis promoting unit comprises pyruvate kinase II encoding gene pykA and PTS system galactitol-specific EIIB component encoding gene gatB.
[0006] The pH-responsive promoter is a kind of DNA regulatory element that can dynamically regulate the expression of downstream genes in response to environmental pH changes. It converts environmental pH signals into programmable gene expression output, and the engineering bacteria can maintain intracellular homeostasis in acidic fermentation broth by dynamically expressing acid-resistant genes through the promoter, thereby reducing the cost of alkaline liquid feeding. In order to make the engineering strain dynamically respond to environmental changes and avoid unnecessary resource waste, the acid-responsive promoter P yfdX As a pH-responsive promoter, the glutamate decarboxylase B encoding gene gadB and the glutamate / gamma-aminobutyric acid antiporter encoding gene gadC, which are key components of the E. coli anti-acid system AR2, are used as an anti-acid unit in the E. coli self-regulating anti-acid module, helping E. coli to cope with acidic environments with lower energy consumption and higher proton consumption efficiency. In addition, the pyruvate kinase II encoding gene pykA and the PTS system galactitol-specific EIIB component encoding gene gatB are used to form the ATP synthesis promoting unit, wherein pykA can directly promote ATP synthesis, and gatB can indirectly promote ATP synthesis, both of which synergistically enhance the energy support for anti-acid; thereby developing an E. coli self-regulating anti-acid module that can accurately perceive the intensity of acid stress, dynamically coordinate multi-level anti-acid mechanisms, and adapt to real industrial scenarios.
[0007] The genes encoding glutamate decarboxylase B, glutamate / gamma-aminobutyric acid antiporter, pyruvate kinase II, and PTS system galactitol-specific EIIB component are generally represented as gadB, gadC, pykA, and gatB, respectively. The gene sequences can be obtained from the public database the National Center for Biotechnology Information (NCBI). For example, the GenBank ID. No. of gadB is 1742450, the GenBank ID. No. of gadC is 85674990, the GenBank ID. No. of pykA is 1736497, and the GenBank ID. No. of gatB is 1736810.
[0008] As a preferred, the promoter P yfdXthe nucleotide sequence of which is shown as SEQ ID NO. 1; the terminator T rrnB the nucleotide sequence of which is shown as SEQ ID NO. 2.
[0009] The present application also provides a gene encoding the self-regulated acid-resistant module of E. coli.
[0010] The present application also provides a recombinant vector containing the gene encoding the self-regulated acid-resistant module of E. coli. The recombinant vector refers to a polynucleotide operably linked to a control sequence for expression in a host cell, preferably the backbone of the recombinant vector is pACYC plasmid. The recombinant vector is preferably pACYC-P yfdX -gadB-gadC-pykA-gatB-T rrnB plasmid.
[0011] The present application also provides a genetically engineered bacterium containing the gene encoding the self-regulated acid-resistant module of E. coli.
[0012] The present application also provides the use of the self-regulated acid-resistant module of E. coli in improving the acid resistance of industrial microorganisms, which comprises: introducing the self-regulated acid-resistant module of E. coli into E. coli producing organic acids. Experiments show that after the introduction of the self-regulated acid-resistant module of E. coli into E. coli, the tolerance of E. coli to acidic conditions can be significantly improved, and the growth ability of the strain containing the self-regulated acid-resistant module under acidic conditions is greatly improved.
[0013] As a preferred, the organic acid includes amino acid, succinic acid.
[0014] As a preferred, the amino acid includes methionine, O-acetyl-L-homoserine.
[0015] A method for constructing a high-yield O-acetyl-L-homoserine genetically engineered bacterium, characterized by comprising: introducing the recombinant vector containing the self-regulated acid-resistant module of E. coli according to any one of claims 1 or 2 into E. coli producing O-acetyl-L-homoserine to construct a high-yield O-acetyl-L-homoserine genetically engineered bacterium.
[0016] As a preferred, the E. coli producing O-acetyl-L-homoserine is E. coli OAHY3. The specific construction process of the E. coli OAHY3 has been disclosed in patent CN119193448A, and the strain is provided by the Microbial Culture Collection of Zhejiang University of Technology.
[0017] The beneficial effects of the present application: the self-regulating acid-resistant module of the present application can significantly improve the tolerance of E. coli under acidic conditions after being introduced into E. coli. The growth ability of the strain containing the self-regulating acid-resistant module under acidic conditions is improved by 72.4% compared with the control group. Further, after introducing the self-regulating acid-resistant module into the O-acetyl-L-homoserine-producing E. coli, the O-acetyl-L-homoserine production capacity of the E. coli is improved from 1.56 g / L to 4.32 g / L, which is improved by 176.9%, proving the effectiveness of the self-regulating acid-resistant module in organic acid production. BRIEF DESCRIPTION OF DRAWINGS
[0018] Figure 1 Example 1 of the present application is a strain containing a self-regulating acid-resistant module under low pH for growth test.
[0019] Figure 2 Example 2 of the present application is the influence of the self-regulating acid-resistant module on O-acetyl-L-homoserine production. DETAILED DESCRIPTION
[0020] The present application can be implemented or applied by other different specific embodiments, and the details in the specification can be modified or changed based on different views and applications without departing from the spirit of the present application. It should be noted that the following examples and features in the examples can be combined with each other without conflict. The methods used in the examples of the present application are conventional methods, and the reagents used can be obtained from commercial sources.
[0021] The composition of LB liquid medium: 10 g / L of proteose peptone, 5 g / L of yeast powder, 10 g / L of sodium chloride, the solvent is deionized water, and the pH value is natural.
[0022] The LB plate is added with 2 g / L of agar with a final concentration in the LB liquid medium.
[0023] The composition of M9 liquid medium: Na2HPO4 6.78 g / L, KH2PO4 3.0 g / L, NaCl 0.5 g / L, NH4Cl 1.0 g / L, MgSO4 0.241 g / L, CaCl2 0.011 g / L, glucose 20 g / L, solvent is deionized water.
[0024] Example 1: E. coli self-regulating acid-resistant module
[0025] 1. Acid-responsive element P yfdX Identification
[0026] The pACYC as a vector (plasmid from Addgene) was diluted as a template, and primers 1 and 2 were used to construct a linearized plasmid backbone by PCR. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min, for 30 cycles; 72 ℃ for 5 min. The PCR product was purified using a purification kit. Then, according to the Escherichia coli genome sequence published on NCBI, primers 3 and 4 were used to amplify the promoter P yfdX The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min, for 30 cycles; 72 ℃ for 5 min. The PCR product was purified using a purification kit. Primers 5 and 6 were used to amplify the fluorescent protein mCherry gene fragment, and the PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min, for 30 cycles; 72 ℃ for 5 min. The PCR product was purified using a purification kit. The linearized plasmid backbone, promoter fragment and fluorescent protein fragment were connected using a one-step cloning kit, and the ligation product was transformed into E. coli DH5α competent cells, and the correct sequence was obtained by selecting a chloramphenicol (Cm) resistant plate. pACYC-P yfdX -mCherry-T rrnB vector.
[0027] The plasmid pACYC-P yfdX -mCherry-T rrnB was transformed into Escherichia coli W3110 chemically competent cells. The preparation process of the competent cells by chemical transformation was as follows: a single colony of Escherichia coli W3110 was inoculated into a test tube containing 5 mL of LB medium, and incubated at 37 ℃, 200 rpm in a constant temperature shaker overnight. 1 mL of the overnight culture was transferred to a 250 mL conical flask containing 40 mL of LB medium, and incubated at 37 ℃, 200 rpm in a constant temperature shaker for 1-2 hours, until the OD 6000.4-0.6. The cultured bacteria solution was cooled on ice for about 10 minutes, poured into a 50 mL centrifuge tube, centrifuged at 4 ℃ and 5500 rpm for 5 min, and the supernatant was removed to retain the bacteria. About 40 mL of sterilized pre-cooled 0.1 M CaCl2 solution was added, resuspended in an ice water bath, and then ice-bathed for 30 min. After centrifugation at 6000 rpm for 5 min, 1 mL of pre-cooled solution containing 0.1 M CaCl2 and 15 % glycerol was added, resuspended in an ice water bath, and then divided into 1.5 mL sterile centrifuge tubes (100 μL per tube). One tube was reserved for use, and the rest were stored at -80 ℃. The chemical transformation process was as follows: one chemically competent cell was taken and placed on ice. In the clean bench, 1 μL of plasmid was added to the competent cell, mixed, and then ice-bathed for 30 min. The EP tube containing the competent cell was placed in a 42 ℃ constant temperature water bath for heat shock for 90 s, and then quickly inserted into ice for cooling for 5 min. In the clean bench, 700 μL of pre-cooled LB medium was added to the EP tube, and incubated in a 37 ℃, 200 rpm constant temperature incubator for 1-2 h. 200 μL of bacterial solution was taken and spread on the corresponding resistant LB solid plate, and then inverted in a 37 ℃ constant temperature incubator for overnight culture to obtain the pACYC-P yfdX -mCherry-T rrnB vector Escherichia coli W3110 strain.
[0028] The pACYC-P yfdX -mCherry-T rrnB vector was used as the template after dilution, and primers 7 and 8 were used to introduce the promoter P trc by PCR. The PCR reaction conditions were as follows: 95 ℃ for 5 min; 95 ℃ for 30 s, 55 ℃ for 30 s, 72 ℃ for 1 min, for 30 cycles; 72 ℃ for 5 min. The PCR product was purified using a purification kit.
[0029] The plasmid pACYC-P trc -mCherry-T rrnB was transformed into Escherichia coli W3110 chemically competent cells. The process of preparing the chemically competent cells by chemical transformation was as follows: a single colony of Escherichia coli W3110 was inoculated into a test tube containing 5 mL of LB medium, and incubated in a 37 ℃, 200 rpm constant temperature incubator overnight. 1 mL of the overnight cultured bacterial solution was transferred to a 40 mL LB medium containing 250 mL conical flask, and incubated in a 37 ℃, 200 rpm constant temperature incubator for 1-2 h, until the OD 6000.4-0.6. The cultured bacteria solution was cooled on ice for about 10 minutes, poured into a 50 mL centrifuge tube, centrifuged at 4 °C and 5500 rpm for 5 min, and the supernatant was removed to retain the bacteria in an ultra-clean bench. About 40 mL of sterilized pre-cooled 0.1 M CaCl2 solution was added, resuspended in an ice water bath, and then ice-bathed for 30 min. After centrifugation at 6000 rpm for 5 min, 1 mL of pre-cooled solution containing 0.1 M CaCl2 and 15 % glycerol was added, resuspended in an ice water bath, and then divided into 1.5 mL sterile centrifuge tubes (100 μL per tube), and one tube was reserved for use, and the rest was stored at -80 °C. The chemical transformation process was as follows: one chemically transformed competent cell was placed on ice, and 1 μL of plasmid was added to the competent cell in an ultra-clean bench, mixed, and then ice-bathed for 30 min. The EP tube containing the competent cell was placed in a 42 °C constant temperature water bath for heat shock for 90 s, quickly inserted into ice for cooling for 5 min. 700 μL of pre-cooled LB medium was added to the EP tube in an ultra-clean bench, and incubated in a 37 °C constant temperature shaker at 200 rpm for 1-2 h. 200 μL of bacterial solution was taken and spread on the corresponding resistant LB solid plate, and then inverted and incubated in a 37 °C constant temperature incubator overnight to obtain the pACYC-P trc -mCherry-T rrnB vector in Escherichia coli W3110 strain.
[0030] Acid-responsive promoter P yfdX and non-acid-responsive promoter P trc The performance in an acidic environment was characterized by the ratio of the fluorescence values of the corresponding plasmid at pH 5.5 and pH 7.0, and the results are shown in Table 1, which proves that the acid-responsive promoter P yfdX can be adjusted according to the pH value of the corresponding environment.
[0031] Table 1 pH 5.5 / pH 7.0 ratio of acid-responsive promoter P yfdX and non-acid-responsive promoter P trc Promoter P yfdX ]]> P trc ]]> pH 5.5 fluorescence value / pH 7.0 fluorescence value 5.67 1.38 .
[0032] 2. Construction of Escherichia coli self-regulated anti-acid module
[0033] pACYC-P yfdX -mCherry-T rrnB The linearized plasmid backbone was constructed by PCR using primers 9 and 10 with the template of the vector diluted after dilution. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, cycle 30 times; 72 ℃ 5 min. The PCR product was purified using a purification kit. Then, according to the Escherichia coli genome sequence published on NCBI, the gene gadB and gadC fragments were amplified using primers 11 and 12, and the PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, cycle 30 times; 72 ℃ 5 min. The PCR product was purified using a purification kit. The linearized plasmid backbone and the gene gadB and gadC fragments were ligated using a one-step cloning kit, and the ligation product was transformed into E. coli DH5α competence, and the correct sequencing pACYC-P yfdX -gadB-gadC-T rrnB vector.
[0034] The pACYC-P yfdX -mCherry-T rrnB The linearized plasmid backbone was constructed by PCR using primers 9 and 10 with the template of the vector diluted after dilution. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, cycle 30 times; 72 ℃ 5 min. The PCR product was purified using a purification kit. Then, according to the Escherichia coli genome sequence published on NCBI, the gene gadB and gadC fragments were amplified using primers 11 and 12, and the PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, cycle 30 times; 72 ℃ 5 min. The PCR product was purified using a purification kit. The linearized plasmid backbone and the gene gadB and gadC fragments were ligated using a one-step cloning kit, and the ligation product was transformed into E. coli DH5α competence, and the correct sequencing pACYC-P yfdX -pykA-T rrnB vector.
[0035] The pACYC-P yfdX -mCherry-T rrnBThe linearized plasmid backbone was constructed by PCR using primers 9 and 10 with the diluted vector as template. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, for 30 cycles; 72 ℃ 5 min. The PCR product was purified using a purification kit. Subsequently, according to the Escherichia coli genome sequence published on NCBI, the gatB gene fragment was amplified using primers 15 and 16, and the PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, for 30 cycles; 72 ℃ 5 min. The PCR product was purified using a purification kit. The linearized plasmid backbone and the gatB gene fragment were ligated using a one-step cloning kit, and the ligation product was transformed into E. coli DH5α competent cells, and the correct sequencing plasmid pACYC-P yfdX -gatB-T rrnB vector.
[0036] The pACYC-P yfdX -mCherry-T rrnB The linearized plasmid backbone was constructed by PCR using primers 9 and 10 with the diluted vector as template. The PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, for 30 cycles; 72 ℃ 5 min. The PCR product was purified using a purification kit. Subsequently, according to the Escherichia coli genome sequence published on NCBI, the gatB gene fragment was amplified using primers 15 and 16, and the PCR reaction conditions were as follows: 95 ℃ 5 min; 95 ℃ 30 s, 55 ℃ 30 s, 72 ℃ 1 min, for 30 cycles; 72 ℃ 5 min. The PCR product was purified using a purification kit. The linearized plasmid backbone and the gatB gene fragment were ligated using a one-step cloning kit, and the ligation product was transformed into E. coli DH5α competent cells, and the correct sequencing plasmid pACYC-P yfdX -gadB-gadC-pykA-gatB-T rrnB vector.
[0037] The plasmid pACYC-P yfdX-gadB-gadC-T rrnB , pACYC-P yfdX -pykA-T rrnB , pACYC-P yfdX -gatB-T rrnB , pACYC-P yfdX -gadB-gadC-pykA-gatB-T rrnB , respectively, into Escherichia coli W3110 chemically competent cells. The preparation of competent cells by chemical transformation was as follows: a single colony of Escherichia coli W3110 was inoculated into a test tube containing 5 mL of LB medium, and incubated at 37 °C, 200 rpm overnight. 1 mL of the overnight culture was transferred into a 40 mL of LB medium in a 250 mL conical flask, and incubated at 37 °C, 200 rpm for 1-2 h until the OD 600 was 0.4-0.6. The culture was cooled on ice for about 10 min, and then poured into a 50 mL centrifuge tube, which was centrifuged at 4 °C, 5500 rpm for 5 min. The supernatant was removed, and about 40 mL of sterilized 0.1 M CaCl2 solution was added. After resuspension in an ice water bath, the mixture was incubated in an ice bath for 30 min. After centrifugation at 6000 rpm for 5 min, 1 mL of pre-cooled 0.1 M CaCl2 and 15 % glycerol solution was added, and the mixture was resuspended in an ice water bath. Then, the mixture was aliquoted into 1.5 mL sterile centrifuge tubes (100 μL per tube), and one tube was reserved for use, and the rest was stored at -80 °C. The chemical transformation was as follows: one chemically competent cell was placed on ice, and 1 μL of plasmid was added to the competent cell in a clean bench. After mixing, the mixture was incubated in an ice bath for 30 min. Then, the EP tube containing the competent cell was placed in a 42 °C water bath for 90 s, and then quickly inserted into ice for 5 min. Then, 700 μL of pre-cooled LB medium was added to the EP tube, which was incubated at 37 °C, 200 rpm for 1-2 h. 200 μL of the bacterial solution was spread on the corresponding LB solid plate, and incubated at 37 °C overnight. The Escherichia coli W3110 strains containing pACYC-P yfdX -gadB-gadC-T rrnB , pACYC-P yfdX -pykA-T rrnB , pACYC-P yfdX -gatB-T rrnB , pACYC-P yfdX -gadB-gadC-pykA-gatB-T rrnB were obtained, respectively.
[0038] 3. The effect of Escherichia coli's self-regulating acid-fast module on the growth of Escherichia coli under acidic conditions
[0039] Separately, those containing pACYC-P yfdX -gadB-gadC-T rrnB pACYC-P yfdX -pykA-T rrnB pACYC-P yfdX -gatB-T rrnB pACYC-P yfdX -gadB-gadC-pykA-gatB-T rrnB The plasmid-infected *Escherichia coli* W3110 strain and the control strain containing the empty pACYC vector were activated by streaking on LB agar containing chloramphenicol (25 mg / L). Single colonies were picked and inoculated into 10 mL LB agar tubes containing chloramphenicol, and incubated at 37°C for 12 h at 200 rpm. 10 μL of the culture medium was then inoculated into 3 mL M9 medium containing pH 5.5. The cultures were incubated at 30°C for 24 h at 200 rpm, with three replicates. The OD values were then measured. 600 value.
[0040] The results are as follows Figure 1 As shown, a self-regulating acid-resistant module containing pACYC-P is introduced. yfdX -gadB-gadC-pykA-gatB-T rrnB The growth ability of the strain with the plasmid increased from 0.359 to 0.721 compared to the control strain, an increase of 72.4%. This demonstrates the effectiveness of the self-regulating acid-resistant module.
[0041] Table 2 Primer Table Primer 1 GGAATTCCCTCTAGAGTCGACC Primer 2 ATTTCCTAATGCAGGAGTCG Primer 3 CGACTCCTGCATTAGGAAATGCATATTCCTACAATTGTAA Primer 4 GGTCTGTTTCCTGTGTGAAACAGTTTTAGAAAACGCCGCC Primer 5 TTTCACACAGGAAACAGACCATGGTGAGCAAGGGCGAGGA Primer 6 TCGACTCTAGAGGGAATTCCCTACTTGTACAGCTCGTCCA Primer 7 GGCTCGTATAATGTGTGGAATTTCACACAGGAAACAGACC Primer 8 GAAATTCCACACATTATACGAGCCGGATGATTAATTGTCAAATTTCCTAATGCAGGAGT Primer 9 GGAATTCCCTCTAGAGTCGA Primer 10 GGTCTGTTTCCTGTGTGAAA Primer 11 TTTCACACAGGAAACAGACCATGGATAAGAAGCAAGTAAC Primer 12 TCGACTCTAGAGGGAATTCCTTAGTGTTTCTTGTCATTCA Primer 13 TTTCACACAGGAAACAGACCATGTCCAGAAGGCTTCGCAG Primer 14 TCGACTCTAGAGGGAATTCCTTACTCTACCGTTAAAATAC Primer 15 TTTCACACAGGAAACAGACCATGAAACGCAAGATTATTGT Primer 16 TCGACTCTAGAGGGAATTCCTCACCCCTGTAAGATAGTCA Primer 17 TTCTGGACATGGTCTGTTTCCTGTGTGAAAATGGATAAGAAGCAAGTAAC Primer 18 TCTTATCCATTTTCACACAGGAAACAGACCATGTCCAGAAGGCTTCGCAG Primer 19 TGCGTTTCATGGTCTGTTTCCTGTGTGAAATTACTCTACCGTTAAAATAC Primer 20 GGTAGAGTAATTTCACACAGGAAACAGACCATGAAACGCAAGATTATTGT .
[0042] Example 2: Enhancement of O-acetyl-L-homoserine fermentation by a self-regulating acid-resistant module
[0043] plasmid pACYC-P was transformed using a chemical transformation method. yfdX -gadB-gadC-pykA-gatB-T rrnB The plasmid was transformed into a modified Escherichia coli strain W3110 (i.e., Escherichia coli OAHY3, disclosed in patent CN119193448A, provided by the Microbial Culture Collection Room of Zhejiang University of Technology). Correct transformants were screened by plating on LB agar containing chloramphenicol (25 mg / L).
[0044] Single colony was picked and inoculated into 10 mL LB medium containing chloramphenicol in a test tube, 200 rpm, 37°C for 12 h. 1 mL seed liquid was taken and inoculated into 50 mL pH 5.5 M9 medium in a 500 mL flask. After 24 h fermentation, the content of O-acetyl-L-homoserine in the fermentation broth was determined.
[0045] The results are shown in Table 1. Figure 2 As shown in Table 1, the strain containing pACYC-P yfdX -gadB-gadC-pykA-gatB-T rrnB The production capacity of the strain containing the plasmid was increased from 1.56 g / L to 4.32 g / L, an increase of 176.9% compared with the control strain. This proved the effectiveness of the self-regulating acid-resistant module in organic acid production.
[0046] The above-described embodiments are merely preferred embodiments of the present application and are not intended to limit the scope of the present application. Various modifications and improvements to the technical solutions of the present application made by those of ordinary skill in the art without departing from the design spirit of the present application shall fall within the scope of the present application.
Claims
1. An auto-regulated acid resistant module of E. coli, characterized in that, comprising an acid-responsive promoter P yfdX , an anti-acid unit, an ATP synthesis promoting unit, a terminator T rrnB ; the anti-acid unit comprises glutamate decarboxylase B encoding gene gadB, glutamate / gamma-aminobutyric acid antiporter encoding gene gadC; the ATP synthesis promoting unit pyruvate kinase II encoding gene pykA, PTS system galactitol-specific EIIB component encoding gene gatB.
2. The auto-regulated acid resistant module of E. coli of claim 1, wherein, The nucleotide sequence of the promoter P yfdX rrnB The nucleotide sequence of the terminator T rrnB 3. A gene encoding the self-regulated acid-resistant module of Escherichia coli according to any one of claims 1 or 2.
4. A recombinant vector comprising the gene encoding the self-regulated acid-resistant module of Escherichia coli according to claim 3.
5. A genetically engineered bacterium comprising the gene encoding the self-regulated acid-resistant module of Escherichia coli according to claim 3.
6. Use of the self-regulated acid-resistant module of E. coli according to any one of claims 1 or 2 for improving the acid resistance of industrial microorganisms, characterized in that, The method comprises: introducing the self-regulated acid-resistant module of Escherichia coli into an Escherichia coli producing an organic acid.
7. The use according to claim 3, wherein the compound is ###00003### 3 The organic acid comprises an amino acid, succinic acid.
8. The use according to claim 3, wherein the compound is ###0003### The amino acid comprises methionine, O-acetyl-L-homoserine.
9. A method for constructing a genetically engineered bacterium with high O-acetyl-L-homoserine production, characterized by, The method comprises: introducing the recombinant vector comprising the self-regulated acid-resistant module of Escherichia coli according to any one of claims 1 or 2 into an Escherichia coli producing O-acetyl-L-homoserine, thereby constructing a genetically engineered bacterium producing O-acetyl-L-homoserine.
10. The method of claim 9, wherein, The Escherichia coli producing O-acetyl-L-homoserine is Escherichia coli OAHY3.
Citation Information
Patent Citations
Recombinant escherichia coli producing strain for efficiently producing O-acetyl-L-homoserine as well as construction method and application of recombinant escherichia coli producing strain
CN119193448A