Genetic markers and uses thereof

By analyzing the genetic variations and linkage disequilibrium markers of the PRLR gene in animals, the problem of difficulty in identifying heat resistance, tick resistance, and fur texture in animals under existing technologies has been solved, thus achieving precision in breeding and herd management.

CN121065345APending Publication Date: 2025-12-05LIVESTOCK IMPROVEMENT CORPORATION
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202511091155.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Priority Date
2014-09-12
Filing Date
2014-10-24
Publication Date
2025-12-05

AI Technical Summary

Technical Problem

Existing technologies make it difficult to effectively identify and select animals with improved heat tolerance, resistance to ticks, and/or desired fur texture, which affects animal breeding and farming efficiency.

Method used

By analyzing genetic variations and linkage disequilibrium markers in the PRLR gene of animals, we can determine whether animals have enhanced heat tolerance, resistance to ticks, and/or desired fur texture. Nucleic acid analysis is performed using techniques such as PCR and gel electrophoresis.

Benefits of technology

It enables accurate identification of animal heat tolerance, tick resistance, and fur texture, improving the accuracy of breeding selection and the efficiency of herd management.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005533962640000341
    Figure BDA0005533962640000341
  • Figure BDA0005533962640000491
    Figure BDA0005533962640000491
  • Figure BDA0005533962640000501
    Figure BDA0005533962640000501
Patent Text Reader

Abstract

In particular, the present invention relates to a method for determining whether an animal and / or a progeny thereof is likely to have an increased heat resistance, an increased resistance to a wall lice, and / or a desired fur texture. It also provides methods for selecting or excluding an animal, one or more cells or embryos; estimating the value of the animal; producing an animal having a desired genotype / phenotype; cloning and breeding animals; and a method of forming a population.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] This application is a divisional application of PCT application PCT / NZ2014 / 000224, filed on October 24, 2014, entitled "Genetic Markers and Their Uses". The date of entry into the Chinese national phase of the PCT application was May 30, 2016, and the application number was 201480065326.0. Technical Field

[0002] The present invention relates in particular to methods for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, and particularly, but not only, to methods for selecting or excluding animals, one or more cells or embryos; estimating the value of an animal; breeding animals; and herd formation. Background Technology

[0003] The ability to maintain a normal body temperature under heat stress is an important trait in cattle and other animals. This is particularly important for animals in subtropical and tropical regions. In cattle, for example, heat stress has been associated with reduced milk production, lower estrus detection rates, lower fertility and pregnancy rates, and increased embryonic mortality. These factors can have significant impacts on the husbandry of production animals.

[0004] Some animals are naturally able to regulate their body temperature more effectively than others in subtropical and tropical climates. An example of such an animal is the Senepol breed of cattle. Senepol cattle have very short, smooth coats.

[0005] It would be useful to identify animals that are likely to maintain a normal body temperature or regulate it more effectively under heat stress. These animals could then be selected for inclusion in herds or for breeding purposes. This may be particularly useful in cases where the intention is to raise animals in environments that would expose them to relatively high temperatures.

[0006] Details of the bibliographic information for the publications mentioned in this article are concentrated at the end of the instruction manual.

[0007] Purpose

[0008] The object of the present invention is to provide one or more of the following: a method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; a method for selecting or excluding animals; a method for selecting or excluding one or more cells; a method for estimating the value of an animal; a method for breeding animals; a method for cloning animals; a method for producing animals; a method for forming a herd; a method for identifying one or more markers that infer enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; a method for identifying whether an animal (and / or its offspring), or one or more cells or embryos, are likely to have markers associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; a nucleic acid; a peptide; a kit; and / or at least provide a useful option for the public. Summary of the Invention

[0009] The inventors of this application have identified sequence alterations or variations in the prolactin receptor (PRLR) gene associated with animals exhibiting enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. These alterations or variations can be used as genetic markers to determine whether an animal is likely to possess enhanced heat tolerance. Such information can be used, for example, in methods of selecting and screening animals, breeding animals, farm management, and estimating the value of animals to a particular industry.

[0010] In a first aspect, the present invention provides a method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the steps of: analyzing nucleic acids from the animal to determine whether it includes one or more genetic variations in the PRLR gene and / or includes one or more genetic markers in linkage disequilibrium with it, wherein if the nucleic acid includes the genetic variation and / or one or more genetic markers in linkage disequilibrium with it, the animal and / or its offspring are determined to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0011] In one embodiment, one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0012] In one embodiment, the method includes analyzing nucleic acids from the animal to determine whether it includes one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium located within the region defined by nucleotides at positions 39136469 and 39136649 of chromosome 20 corresponding to Bos Taurus. In another embodiment, the method includes analyzing nucleic acids from the animal to determine whether it includes one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium located in the last exon of the PRLR gene.

[0013] In one embodiment, the method includes analyzing nucleic acids from the animal to determine the nucleotide sequence of one or more genetic markers located at position 39136559 on chromosome 20 of a common cow and / or in linkage disequilibrium with it.

[0014] In one implementation, the deletion of C at position 39136559 and / or the presence of one or more genetic markers in linkage disequilibrium with it infers that the animal and / or its offspring are likely to have enhanced heat tolerance.

[0015] In a second aspect, the present invention provides a method for selecting or excluding animals, the method comprising at least the steps of: analyzing nucleic acids from the animal to determine whether it includes one or more genetic variants in the PRLR gene and / or includes one or more genetic markers in linkage disequilibrium with it, wherein the presence of one or more genetic variants and / or one or more genetic markers in linkage disequilibrium with it infers that the animal is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0016] In one implementation, an animal is selected if it includes one or more genetic variants in the PRLR gene and / or one or more genetic markers that are in linkage disequilibrium with it, and is excluded if it does not include one or more genetic variants in the PRLR gene and / or one or more genetic markers that are in linkage disequilibrium with it.

[0017] In one embodiment, one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0018] In one implementation, the animal is selected if it is presumed to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In another implementation, the animal is excluded if it is presumed not to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0019] In one embodiment, the method includes analyzing nucleic acids from the animal to determine whether it includes one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium located within a region defined by nucleotides at positions 39136469 and 39136649 of chromosome 20 of a common cow. In another embodiment, the method includes analyzing nucleic acids from the animal to determine whether it includes one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium located in the last exon of the PRLR gene.

[0020] In one embodiment, the method includes at least the following steps: analyzing nucleic acids from the animal to determine the nucleotide sequence of one or more genetic markers located at position 39136559 on chromosome 20 of a common cow and / or in linkage disequilibrium with it.

[0021] In one implementation, the method includes at least the following steps:

[0022] a) Analyze nucleic acids from the animal to determine the nucleotide sequence of the nucleotides present at position 39136559 and / or one or more genetic markers in linkage disequilibrium with it; and

[0023] b) Select or exclude animals based on the nucleotide sequence of the nucleotide present at the position corresponding to position 39136559 and / or one or more genetic markers that are in linkage disequilibrium with it.

[0024] In one implementation, the animal is selected if there is a deletion of C at position 39136559 and / or one or more genetic markers that are in linkage disequilibrium with it.

[0025] In one embodiment, the method is performed to select or exclude animals based on milk production. In one embodiment, the method is performed to select or exclude animals based on meat production. In one embodiment, the method is performed to select or exclude animals based on egg production. In one embodiment, the method is performed to select or exclude animals based on fur, hair, wool, pelt, or feather production. In one embodiment, the method is performed to select or exclude animals based on desired fur texture. In another embodiment, the method is performed to select or exclude animals for breeding purposes. In one embodiment, the method is performed to select or exclude animals for inclusion in a herd. In one embodiment, where the method is used for selecting or excluding animals for breeding purposes and / or for inclusion in a herd, the method includes determining whether the animal is homozygous or heterozygous with respect to the one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium. In one specific implementation, if the animal is homozygous for the one or more genetic alterations and / or the one or more genetic markers in which it is in linkage disequilibrium, it is inferred that the animal is likely to have increased heat tolerance, increased resistance to ticks, and / or the desired fur texture, and therefore the animal is selected.

[0026] In a third aspect, the present invention provides a method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: analyzing nucleic acids from the animal to determine whether it includes one or more genetic variations in the PRLR gene and / or one or more genetic markers in linkage disequilibrium therewith, wherein the presence of the one or more genetic variations and / or one or more genetic markers in linkage disequilibrium therewith infers that the animal and / or its offspring will likely have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0027] In one embodiment, one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0028] In one embodiment, the method includes analyzing nucleic acids from the animal to determine whether it includes one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium located within a region defined by nucleotides at positions 39136469 and 39136649 of chromosome 20 of a common cow. In another embodiment, the method includes analyzing nucleic acids from the animal to determine whether it includes one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium located in the last exon of the PRLR gene.

[0029] In one embodiment, the method includes analyzing nucleic acids from the animal to determine the nucleotide sequence of one or more genetic markers located at position 39136559 on chromosome 20 of a common cow and / or in linkage disequilibrium with it.

[0030] In one implementation, if the deletion of C at position 39136559 is present and / or one or more genetic markers that are in linkage disequilibrium with it are present, it is inferred that the animal and / or its offspring will likely have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0031] In a fourth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting at least a first animal having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it; and mating the first animal with a second animal.

[0032] In one embodiment, the method further includes selecting the second animal based on the following criteria: it includes one or more genetic variations in the PRLR gene and / or has one or more genetic markers in linkage disequilibrium with it. In one embodiment, one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0033] In one implementation, the first animal and / or the second animal are selected if they are inferred to be likely to have improved heat resistance, improved resistance to ticks, and / or the desired fur texture.

[0034] In one embodiment, one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0035] In one embodiment, the one or more genetic alterations are located within a region defined by nucleotides at positions 39136469 and 39136649 on chromosome 20 of a normal cow. In another embodiment, the one or more genetic alterations are located in the last exon of the PRLR gene.

[0036] In one embodiment, the method includes selecting the first animal and / or the second animal if the first animal and / or the second animal have a genetic variation at position 39136559 on chromosome 20 of a common cow and / or have one or more genetic markers in linkage disequilibrium with it. In another embodiment, the method includes selecting the first animal and / or the second animal if a deletion of C at position 39136559 is present and / or one or more genetic markers in linkage disequilibrium with it are present.

[0037] In one embodiment, the method includes selecting the animal if the first animal and / or the second animal is determined to be homozygous for one or more specific genetic alterations and / or for one or more genetic markers that are in linkage disequilibrium.

[0038] In a fifth aspect, the present invention provides a method for selecting or excluding one or more cells or embryos, the method comprising at least the steps of: analyzing nucleic acids from said one or more cells or embryos or the animal that produced said one or more cells or embryos to determine whether it includes one or more genetic variations in the PRLR gene and / or includes one or more genetic markers in linkage disequilibrium with it. In one embodiment, the presence of such one or more genetic variations and / or one or more genetic markers in linkage disequilibrium with it suggests that said one or more cells or embryos are suitable for use in methods of breeding or cloning animals that are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0039] In one embodiment, the one or more cells or embryos are selected if they include one or more genetic variants in the PRLR gene and / or include one or more genetic markers in linkage disequilibrium with it. In another embodiment, the one or more cells or embryos are excluded if they do not include one or more genetic variants in the PRLR gene and / or one or more genetic markers in linkage disequilibrium with it.

[0040] In one embodiment, one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0041] In one embodiment, the one or more genetic alterations are located within a region defined by nucleotides at positions 39136469 and 39136649 on chromosome 20 of a normal cow. In another embodiment, the one or more genetic alterations are located in the last exon of the PRLR gene.

[0042] In one embodiment, the method includes at least the following steps: analyzing nucleic acids from the one or more cells or embryos or the animal that produced the one or more cells or embryos to determine the nucleotide sequence at position 39136559 of chromosome 20 of a common cow and / or the nucleotide sequence of one or more genetic markers that are in linkage disequilibrium with it.

[0043] In one implementation, the method includes at least the following steps:

[0044] a) Analyze nucleic acids from the one or more cells or embryos or the animal that produced the one or more cells or embryos to determine the nucleotide sequence present at the position corresponding to position 39136559 and / or one or more genetic markers in linkage disequilibrium with it; and

[0045] b) Select or exclude one or more cells or embryos based on the nucleotide sequence present at the position corresponding to position 39136559 and / or the nucleotide sequence of one or more genetic markers that are in linkage disequilibrium with it.

[0046] In one implementation, if there is a deletion of C at position 39136559 and / or one or more genetic markers that are in linkage disequilibrium with it, then the one or more cells or embryos are selected.

[0047] In one embodiment, the method includes determining whether the one or more cells or embryos, or the animal that produced the one or more cells or embryos, are homozygous or heterozygous with respect to the one or more genetic alterations and / or the one or more genetic markers that are in linkage disequilibrium with respect to them. In a specific embodiment, the one or more cells or embryos are selected if they are homozygous with respect to the one or more genetic alterations and / or the one or more genetic markers that are in linkage disequilibrium.

[0048] In one embodiment, the method is performed to achieve the purpose of selecting or excluding one or more cells or embryos for use in cloning animals and / or breeding animals. In one embodiment, animal breeding may involve IVF.

[0049] In a sixth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting a first gamete having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it; and fusing the first gamete with a second gamete to form a zygote.

[0050] In one embodiment, the method further includes selecting the second gamete on the basis that it includes one or more genetic variations in the PRLR gene and / or has one or more genetic markers that are in linkage disequilibrium with it.

[0051] In a seventh aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting embryos having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it.

[0052] In an eighth aspect, the present invention provides a method for cloning animals, the method comprising at least the steps of: selecting one or more cells having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it.

[0053] In one embodiment of any of the sixth to eighth aspects, one or more genetic alterations in the PRLR gene result in increased PRLR activity. In one embodiment, the one or more genetic alterations are located within a region defined by nucleotides at positions 39136469 and 39136649 on chromosome 20 of a common bovine chromosome. In one embodiment, the one or more genetic alterations are located in the last exon of the PRLR gene.

[0054] In one embodiment of any of the sixth to eighth aspects, the method includes selecting the first gamete and / or the second gamete, the embryo, or one or more cells if the first gamete and / or the second gamete, the embryo, or one or more cells have a genetic variation corresponding to position 39136559 on chromosome 20 of a common bovine and / or have one or more genetic markers in linkage disequilibrium therewith. In one embodiment, the method includes selecting the first gamete and / or the second gamete, the embryo, or one or more cells if a deletion of C corresponding to position 39136559 is present and / or one or more genetic markers in linkage disequilibrium therewith are present. In one embodiment, the method includes selecting the first gamete and / or the second gamete, the embryo, or one or more cells if the first gamete and / or the second gamete, the embryo, or one or more cells are determined to be homozygous for one or more genetic alterations and / or one or more genetic markers in linkage disequilibrium therewith.

[0055] In any one or more embodiments of the first to eighth broad aspects of the invention, the method includes analyzing nucleic acids to determine whether it includes one or more genetic variations in the PRLR gene, alone or in combination with one or more genetic markers in linkage disequilibrium therewith. In one embodiment, the method involves analyzing nucleic acids to determine nucleotides present at position 39136559 on chromosome 20 of a common cow, alone or in combination with one or more genetic markers in linkage disequilibrium therewith.

[0056] Preferably, nucleic acid analysis is performed using one or more of the following methods according to any one or more of the first to eighth aspects of the invention: polymerase chain reaction (PCR); gel electrophoresis; DNA blotting; nucleic acid sequencing; restriction fragment length polymorphism (RFLP); single-strand confirmatory polymorphism (SSCP); LCR (ligase chain reaction); denaturing gradient gel electrophoresis (DGGE); allele-specific oligonucleotides (ASO); proteins that recognize nucleic acid mismatches; RNase protection; oligonucleotide array hybridization; denaturing HPLC (dHPLC); high-resolution melting (HRM); and matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS), qRT-PCR.

[0057] In a ninth aspect, the present invention provides a method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, the method comprising at least the steps of: observing in the animal the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them.

[0058] In one implementation, the method includes comparing the levels of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, relative to one or more criteria.

[0059] In one implementation, the criteria include the level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, the levels of which are associated with animals having significantly limited heat tolerance and / or desired fur texture, and if, compared to the criteria, the animal has higher levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, it is inferred that the animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0060] In one implementation, the level of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or the level encoding any one or more of its nucleic acids is its expression level.

[0061] In a tenth aspect, the present invention provides a method for selecting or excluding animals, the method comprising at least the steps of: observing the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them.

[0062] In one implementation, an animal is selected if it possesses a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding one or more of its nucleic acids, wherein the level indicates an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In another implementation, an animal is excluded if it does not possess a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding one or more of its nucleic acids, wherein the level indicates an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0063] In one implementation, the method includes comparing the levels of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, relative to one or more criteria.

[0064] In one implementation, the criteria include the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, said levels being associated with animals having significantly limited heat tolerance and / or undesirable fur texture, and if, compared to said criteria, the animal has higher levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, it is inferred that the animal is likely to have improved heat tolerance, improved resistance to ticks, and / or desired fur texture.

[0065] In one implementation, the animal is selected if it is inferred that it is highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In another implementation, the animal is excluded if it is inferred that it is not highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0066] In one implementation, the level of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or the level encoding any one or more of its nucleic acids is its expression level.

[0067] In one embodiment, the method is performed to select or exclude animals based on milk production. In one embodiment, the method is performed to select or exclude animals based on meat production. In one embodiment, the method is performed to select or exclude animals based on egg production. In one embodiment, the method is performed to select or exclude animals based on fur, hair, wool, pelt, or feather production. In one embodiment, the method is performed to select or exclude animals based on desired fur texture. In another embodiment, the method is performed to select or exclude animals for breeding purposes. In one embodiment, the method is performed to select or exclude animals for inclusion in a herd.

[0068] In an eleventh aspect, the present invention provides a method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: observing the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them.

[0069] In one implementation, the method includes comparing the levels of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, relative to one or more criteria.

[0070] In one implementation, the criteria include the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, said levels being associated with animals having significantly limited heat tolerance and / or undesirable fur texture, and if, compared to said criteria, the animal has higher levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, then it is inferred that the animal and / or its offspring will be very likely to have improved heat tolerance, improved resistance to ticks, and / or the desired fur texture.

[0071] In one implementation, the level of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or the level encoding any one or more of its nucleic acids is its expression level.

[0072] In a twelfth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting a first animal, the first animal being identified as having a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them, the level indicating an animal having or being very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and mating the first animal with a second animal.

[0073] In another embodiment, the method further includes selecting a second animal identified as having a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids, the level indicating an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0074] In one embodiment, the method includes the following steps: observing the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them from the first animal and / or the second animal to identify whether it has levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them, said levels indicating an animal that has or is very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0075] In one implementation, the method includes comparing the levels of one or more of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, relative to one or more criteria.

[0076] In one implementation, the criteria include levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, said levels being associated with animals having significantly limited heat resistance and / or undesirable fur texture, and the first animal and / or the second animal being selected if the first animal and / or the second animal are observed to have higher levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them compared to said criteria.

[0077] In one implementation, the level of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or the level encoding any one or more of its nucleic acids is its expression level.

[0078] In one implementation, the first animal and / or the second animal are selected if they are inferred to be likely to have improved heat resistance, improved resistance to ticks, and / or the desired fur texture.

[0079] In any one or more of the ninth to twelfth aspects, the method includes at least the following steps:

[0080] a) Obtaining samples from animals;

[0081] b) Detecting in the sample one or more of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more nucleic acids encoding one or more of them; and

[0082] c) Compare the levels of the PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more of the nucleic acids encoding one or more of them to a standard.

[0083] In a thirteenth aspect, the present invention provides a method for selecting or excluding one or more cells or embryos, the method comprising at least the steps of: observing the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them in the one or more cells or embryos or the animal that produced them.

[0084] In one embodiment, the one or more cells or embryos or the animal that produced them are selected if they are identified as having levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids, wherein such levels indicate an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In another embodiment, the one or more cells or embryos or the animal that produced them are excluded if they are identified as not having levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids, wherein such levels indicate an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0085] In one embodiment, the method includes comparing the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them from the one or more cells or embryos or the animal that produced them, relative to one or more criteria.

[0086] In one embodiment, the criteria include levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding any one or more of its nucleic acids, said levels being associated with animals having significantly limited heat tolerance and / or undesirable fur texture, and if, compared to said criteria, the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding any one or more of its nucleic acids are higher from said one or more cells or embryos or the animal that produced said one or more cells or embryos, then it is inferred that said one or more cells or embryos are suitable for use in methods of breeding or cloning animals that are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In one embodiment, said one or more cells or embryos are selected if said one or more cells or embryos or the animal that produced said one or more cells or embryos has higher levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or encoding any one or more of its nucleic acids.

[0087] In one implementation, the level of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or the level encoding any one or more of its nucleic acids is its expression level.

[0088] In one embodiment, the method is performed to achieve the purpose of selecting or excluding one or more cells or embryos for use in cloning animals and / or breeding animals. In one embodiment, animal breeding may involve IVF.

[0089] In a fourteenth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting a first gamete, the first gamete being identified as having a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids, the level indicating an animal having or being very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and fusing the first gamete with a second gamete to form a zygote.

[0090] In one embodiment, the method further includes selecting the second gamete if it is identified as having a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding one or more of its nucleic acids, the level indicating an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0091] In a fifteenth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting an embryo that is identified as having a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them, the level indicating that the animal has or is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0092] In a sixteenth aspect, the present invention provides a method for cloning an animal, the method comprising at least the steps of: selecting one or more cells that are identified as having a level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them, the level indicating an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0093] In one embodiment of the fourteenth to sixteenth aspects, the method includes the steps of: observing the levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them in the first gamete and / or the second gamete, the one or more cells, or the embryo to identify whether it has levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them, said levels indicating an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0094] In one embodiment, the method of the fourteenth to sixteenth aspects includes comparing the levels of one or more of the first gamete and / or the second gamete, the embryo or the one or more cells, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them with one or more criteria.

[0095] In one embodiment of any of the fourteenth to sixteenth aspects, the criterion includes the level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, said level being associated with an animal having significantly limited heat resistance and / or undesirable fur texture, and the first gamete and / or the second gamete, the embryo, or said one or more cells are selected if the first gamete and / or the second gamete, the embryo, or said one or more cells are observed to have a higher level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them compared to said criterion.

[0096] In one implementation, the level of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or the level encoding any one or more of its nucleic acids is its expression level.

[0097] In some embodiments of aspects nine through sixteen, the levels of one or more of PRLRs, one or more of their precursors, one or more of their isotypes, one or more of their fragments, and / or one or more nucleic acids encoding one or more of them are determined using immunoassays, separation based on characteristics such as molecular weight and isoelectric point, gel electrophoresis, Western blotting, or mass spectrometry. Preferably, the immunoassay is an ELISA. Preferably, the gel electrophoresis is 2D gel electrophoresis or a gel-free system based on microfluidic technology.

[0098] In a seventeenth aspect, the present invention provides a method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, the method comprising at least the steps of: observing the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof in the animal.

[0099] In one embodiment, the method includes comparing the activity levels of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof against one or more standards.

[0100] In one implementation, the criteria include the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof associated with an animal having significantly limited heat resistance and / or undesirable fur texture, and if the animal has higher activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof compared to the criteria, it is inferred that the animal and / or its offspring are likely to have enhanced heat resistance, enhanced resistance to ticks, and / or the desired fur texture.

[0101] In an eighteenth aspect, the present invention provides a method for selecting or excluding animals, the method comprising at least the steps of: observing the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0102] In one embodiment, an animal is selected if it has one or more activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, indicating an animal with or likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In another embodiment, an animal is excluded if it does not have one or more activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, indicating an animal with or likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0103] In one embodiment, the method includes comparing the activity levels of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof against one or more standards.

[0104] In one embodiment, the criteria include the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof in relation to an animal with significantly limited heat resistance and / or undesirable fur texture, and if the animal has higher activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof compared to the criteria, it is inferred that the animal is likely to have improved heat resistance, improved resistance to ticks, and / or the desired fur texture.

[0105] In one implementation, the animal is selected if it is inferred that it is highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In another implementation, the animal is excluded if it is inferred that it is not highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0106] In one embodiment, the method is performed to select or exclude animals based on milk production. In one embodiment, the method is performed to select or exclude animals based on meat production. In one embodiment, the method is performed to select or exclude animals based on egg production. In one embodiment, the method is performed to select or exclude animals based on fur, hair, wool, pelt, or feather production. In one embodiment, the method is performed to select or exclude animals based on desired fur texture. In another embodiment, the method is performed to select or exclude animals for breeding purposes. In one embodiment, the method is performed to select or exclude animals for inclusion in a herd.

[0107] In a nineteenth aspect, the present invention provides a method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: observing the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0108] In one embodiment, the method includes comparing the activity levels of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof against one or more standards.

[0109] In one embodiment, the criteria include the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof associated with an animal having significantly limited heat resistance and / or undesirable fur texture, and if the animal has higher activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof compared to the criteria, it is inferred that the animal and / or its offspring are likely to have enhanced heat resistance, enhanced resistance to ticks, and / or the desired fur texture.

[0110] In a twentieth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting a first animal, the first animal being identified as having one or more of the following activity levels: PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, the activity levels indicating an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and mating the first animal with a second animal.

[0111] In another embodiment, the method further includes selecting a second animal identified as having one or more of the following activity levels: PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, which indicate an animal having or being highly likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0112] In one embodiment, the method includes the following steps: observing the activity level of one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments from the first animal and / or the second animal to identify whether it has one or more of the following activity levels of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments, which indicate an animal having or being very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0113] In one embodiment, the method includes comparing the activity levels of one or more of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof with one or more standards.

[0114] In one embodiment, the criteria include the activity level of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof in relation to an animal with significantly limited heat resistance and / or undesirable fur texture, and the first animal and / or the second animal are selected if the first animal and / or the second animal are observed to have higher activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof compared to the criteria.

[0115] In one implementation, the first animal and / or the second animal are selected if they are inferred to be likely to have improved heat resistance, improved resistance to ticks, and / or the desired fur texture.

[0116] In any one or more of the seventeenth to twentieth aspects, the method includes at least the following steps:

[0117] a) Obtaining samples from animals;

[0118] b) Detect the activity levels of one or more of PRLR, one or more of its precursors, one or more of its isoforms, and / or one or more fragments thereof in the sample; and

[0119] c) Compare the activity levels of the PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof with a standard.

[0120] In a twentieth aspect, the present invention provides a method for selecting or excluding one or more cells or embryos, the method comprising at least the steps of: observing the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0121] In one embodiment, one or more cells or embryos are selected if they have one or more activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, such activity levels indicate an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In another embodiment, one or more cells or embryos are excluded if they do not have one or more activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, such activity levels indicate an animal having or being highly likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0122] In one embodiment, the method includes comparing the activity levels of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof against one or more standards.

[0123] In one embodiment, the criteria include the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof associated with an animal having significantly limited heat tolerance and / or undesirable fur texture. If, compared to the criteria, the activity levels of the one or more cells or embryos, or the animal that produced the one or more cells or embryos, are higher, it is inferred that the one or more cells or embryos are suitable for use in methods of breeding or cloning animals in which the animals are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0124] In one implementation, the one or more cells or embryos are selected if one or more cells or embryos or the animal that produced the one or more cells or embryos has a higher level of PRLR, one or more of its precursors, one or more of its subtypes, and / or encoding any one or more of its nucleic acids.

[0125] In one embodiment, the method is performed to achieve the purpose of selecting or excluding one or more cells or embryos for use in cloning animals and / or breeding animals. In one embodiment, animal breeding may involve IVF.

[0126] In a twenty-second aspect, the present invention provides a method for breeding animals, the method comprising at least the steps of: selecting a first gamete, the first gamete being identified as having one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, the activity level indicating an animal having or being very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and fusing the first gamete with a second gamete to form a zygote.

[0127] In one embodiment, the method further includes selecting the second gamete if it is identified as having one or more of the following activity levels: PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, the activity levels indicating an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0128] In a twentieth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting an embryo that is identified as having one or more activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments, wherein the activity levels indicate that the animal has or is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0129] In a twenty-fourth aspect, the present invention provides a method for cloning an animal, the method comprising at least the steps of: selecting one or more cells that are identified as having one or more activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, wherein the activity levels indicate an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0130] In one embodiment of the method in aspects 22 to 24, the method includes the step of: observing the activity level of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments in the first gamete and / or the second gamete, the one or more cells, or the embryo to identify whether it has one or more of the following activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments, which indicate an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0131] In one embodiment of the method in the twenty-second to twenty-fourth aspects, the method includes comparing the levels of one or more of the first and / or second gametes, the embryo, or the one or more cells, PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof, with one or more criteria.

[0132] In one embodiment of any of the twenty-second to twenty-fourth aspects, the criterion includes the activity level of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof in relation to an animal with significantly limited heat resistance and / or undesirable fur texture, and the first gamete and / or the second gamete, the embryo, or the one or more cells are selected if a higher activity level of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof is observed compared to the criterion.

[0133] In a twenty-fifth aspect, the present invention provides a method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the steps of: analyzing one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments from said animal to determine whether it includes one or more variations in the amino acid sequence, wherein if one or more of said PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments have said one or more variations, said animal and / or its offspring are determined to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0134] In a twenty-sixth aspect, the present invention provides a method for selecting or excluding animals, the method comprising at least the steps of: analyzing one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof from the animal to determine whether it includes one or more variations in the amino acid sequence, wherein the presence of the one or more variations infers that the animal is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0135] In one implementation, the animal is selected if it is presumed to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In another implementation, the animal is excluded if it is presumed not to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0136] In one implementation, an animal is selected if it includes one or more amino acid variations of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments, and is excluded if it does not include one or more amino acid variations of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments.

[0137] In one embodiment, the method is performed to select or exclude animals based on milk production. In one embodiment, the method is performed to select or exclude animals based on meat production. In one embodiment, the method is performed to select or exclude animals based on egg production. In one embodiment, the method is performed to select or exclude animals based on fur, hair, wool, pelt, or feather production. In one embodiment, the method is performed to select or exclude animals based on desired fur texture. In another embodiment, the method is performed to select or exclude animals for breeding purposes. In one embodiment, the method is performed to select or exclude animals for inclusion in a herd.

[0138] In a twenty-seventh aspect, the present invention provides a method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: analyzing one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments from the animal to determine whether it includes one or more variations in the amino acid sequence, wherein the presence of the one or more variations infers that the animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0139] In a twenty-eighth aspect, the present invention provides a method for breeding animals, the method comprising at least the following steps: selecting at least a first animal, the first animal having been identified as having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof; and mating the first animal with a second animal.

[0140] In one embodiment, the method further includes selecting the second animal on the basis that it has been identified as having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0141] In one implementation, the first animal and / or the second animal are selected if they are inferred to be likely to have improved heat resistance, improved resistance to ticks, and / or the desired fur texture.

[0142] In a twenty-ninth aspect, the present invention provides a method for selecting or excluding one or more cells or embryos, the method comprising at least the steps of: analyzing one or more of the PRLR, one or more precursors thereof, one or more subtypes thereof, and / or one or more fragments thereof from the one or more cells or embryos or from the animal that produced the one or more cells or embryos, to determine whether it includes one or more variations in the amino acid sequence. In one embodiment, the presence of one or more such variations infers that the one or more cells or embryos are suitable for use in methods of breeding or cloning animals that are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0143] In one embodiment, the one or more cells or embryos, or the animal that produced the one or more cells or embryos, are selected if they have one or more variations in the amino acid sequence of the PRLR. In another embodiment, the one or more cells or embryos, or the animal that produced the one or more cells or embryos, are excluded if they do not have one or more variations in the amino acid sequence of the PRLR.

[0144] In one embodiment, the method is performed to achieve the purpose of selecting or excluding one or more cells or embryos for use in cloning animals and / or breeding animals. In one embodiment, animal breeding may involve IVF.

[0145] In a thirtieth aspect, the present invention provides a method for breeding animals, the method comprising at least the steps of: selecting a first gamete having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof; and fusing the first gamete with a second gamete to form a zygote.

[0146] In one embodiment, the method further includes selecting the second gamete based on having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more fragments thereof.

[0147] In a thirty-first aspect, the present invention provides a method for breeding animals, the method comprising at least the steps of: selecting an embryo having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0148] In a thirty-second aspect, the present invention provides a method for cloning an animal, the method comprising at least the steps of: selecting one or more cells having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0149] In one embodiment of any of aspects 25 to 32, one or more variations in the amino acid sequence are variations that enhance PRLR activity.

[0150] In any one embodiment of aspects 25 to 32, one or more variations are substitutions of one or more amino acids, deletions of one or more amino acids, and / or additions of one or more amino acids. In one specific embodiment, one or more variations in the amino acid sequence are deletions that cause PRLR truncation.

[0151] In one embodiment of any of aspects 25 to 32, one or more amino acid variations are located in a region from position 430 of the PRLR corresponding to ordinary cattle to position 490 of the PRLR corresponding to ordinary cattle. In one embodiment, one or more variations cause the PRLR to be truncated in a region that extends approximately from position 430 of the PRLR corresponding to ordinary cattle to position 490 of the PRLR corresponding to ordinary cattle.

[0152] In one embodiment of any of aspects 25 to 32, one or more amino acid variations include the substitution of alanine with valine at position 461 of the PRLR corresponding to that of a normal bovine PRLR. In one embodiment, one or more amino acid variations cause the PRLR to be truncated to position 461 of the PRLR corresponding to that of a normal bovine PRLR. In one embodiment, one or more amino acid variations involve the substitution of alanine with valine at position 461 and the truncation of the PRLR to position 461 of the PRLR corresponding to that of a normal bovine PRLR.

[0153] In a thirty-third aspect, the present invention provides a method for producing an animal likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the step of introducing one or more genetic alterations into the PRLR gene of one or more cells used to produce said animal. In a related aspect, the present invention also provides a method for producing one or more cells that can be used to produce an animal likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the step of introducing one or more genetic alterations into the PRLR gene of one or more cells. In another aspect, the present invention provides a cell produced by said method.

[0154] In one embodiment, the method for producing the animal relates to IVF. In another embodiment, the method for producing the animal is a cloning method.

[0155] In one embodiment, one or more genetic alterations are genetic alterations that enhance the activity of PRLR. In one embodiment, one or more genetic alterations include genetic alterations located within the region defined by nucleotides corresponding to positions 39136469 and 39136649 on chromosome 20 of a normal cow. In one embodiment, one or more genetic alterations are genetic alterations located in the last exon of the PRLR gene. In one embodiment, one or more genetic alterations include a genetic alteration at position 39136559 on chromosome 20 of a normal cow. In one embodiment, one or more genetic alterations include a deletion of C at position 39136559 on chromosome 20 of a normal cow.

[0156] In one embodiment, the one or more cells are selected from gametes or zygotes. In another embodiment, the one or more cells are somatic cells or cells derived from a cell line.

[0157] In one embodiment, the cloning method of the thirty-third aspect further includes the step of selecting or excluding one or more animals, cells or embryos using any one or more of the methods of the second, fifth, tenth, thirteenth, eighteenth, twenty-first, twenty-sixth or twenty-ninth aspects of the present invention.

[0158] In one embodiment, the IVF method of the thirty-third aspect further includes the step of selecting or excluding one or more animals, cells or embryos using any one or more of the methods of the second, fifth, tenth, thirteenth, eighteenth, twenty-first, twenty-sixth or twenty-ninth aspects of the present invention.

[0159] In one related aspect, the present invention provides an animal produced by the method of the thirty-third aspect of the present invention.

[0160] In a thirty-fourth aspect, the present invention provides a method for forming a herd, the method comprising at least the following steps:

[0161] a. The first, second, third, fourth, ninth, tenth, eleventh, twelfth, seventeenth, eighteenth, nineteenth, twentieth, twenty-fifth, twenty-sixth, and second embodiments of this invention.

[0162] Any one or more of the seventeen or twenty-eighth aspects;

[0163] b. Selecting or excluding animals based on the results of step a); and

[0164] c. Form a herd of the selected animals.

[0165] In one implementation, an animal is excluded if it is inferred that it is not very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In another implementation, an animal is selected if it is inferred that it is very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture.

[0166] In one embodiment, the animal is selected if it includes one or more genetic variations in the PRLR gene and / or includes one or more genetic markers in linkage disequilibrium with it. In one embodiment, the animal is selected if it includes one or more variations in the amino acid sequence of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof. In one embodiment, the animal is selected if it has higher levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or nucleic acids encoding any one or more of them compared to a standard, wherein the standard includes the level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or nucleic acids encoding any one or more of them, levels associated with animals having significantly limited heat tolerance and / or undesirable fur texture. In one embodiment, the animal is selected if it has higher activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof compared to a standard, wherein the standard includes the activity levels of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof associated with animals having significantly limited heat tolerance and / or undesirable fur texture.

[0167] In one related aspect, the present invention provides a herd formed by the method of the thirty-fourth aspect of the present invention.

[0168] In a thirty-fifth aspect, the present invention provides a method for identifying one or more genetic variations in the PRLR gene, said genetic variations inferring increased heat tolerance, increased resistance to ticks, and / or desired fur texture in an animal. In one embodiment, the method includes identifying one or more genetic variations in the PRLR gene and determining whether it results in an increase in the level or activity of PRLR. In one embodiment, if said one or more variations result in an increase in the level or activity of PRLR, it is determined to infer increased heat tolerance, increased resistance to ticks, and / or desired fur texture in an animal.

[0169] In a thirty-sixth aspect, the present invention provides a method for identifying whether an animal (and / or its offspring), one or more cells, or an embryo has or may have one or more genetic alterations associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. The method includes observing a nucleic acid sequence to identify whether it includes one or more genetic variations in the PRLR gene and / or genetic markers in linkage disequilibrium with it. If the nucleic acid sequence is identified as having one or more genetic variations in the PRLR gene and / or genetic markers in linkage disequilibrium with it, the animal, cell, or embryo is identified as having one or more genetic alterations associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In one embodiment, the one or more genetic alterations result in an increased level or activity of PRLR.

[0170] In a thirty-seventh aspect, the present invention provides a method for identifying one or more amino acid variations in a PRLR, said amino acid variations inferring increased heat tolerance, increased resistance to ticks, and / or desired fur texture in an animal. In one embodiment, the method includes identifying one or more amino acid variations in the PRLR and determining whether it results in an increase in the level or activity of the PRLR. In one embodiment, if said one or more changes result in an increase in the level or activity of the PRLR, it is determined to infer increased heat tolerance, increased resistance to ticks, and / or desired fur texture in the animal.

[0171] In a thirty-eighth aspect, the present invention provides a method for identifying whether an animal (and / or its offspring), one or more cells, or an embryo has or may have one or more amino acid variations associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. The method includes observing an amino acid sequence to identify whether it includes one or more variations in the amino acid sequence of PRLR, one or more of its precursors, one or more of its subtypes, or one or more fragments thereof. Upon identification that the animal, cell, or embryo has one or more variations in the amino acid sequence of PRLR, one or more of its precursors, one or more of its subtypes, or one or more fragments thereof, the animal, cell, or embryo is identified as having one or more amino acid variations associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In one embodiment, the one or more amino acid variations result in an increased level or activity of PRLR, one or more of its precursors, one or more of its subtypes, or one or more fragments thereof.

[0172] In any one or more embodiments of the first to thirty-eighth aspects of the invention, the animal is a mammal. In some embodiments, the animal is from the family Bovidae, Phasianidae, or Suidae. In some embodiments, the animal has a genus, species, or breed as described herein. In one specific embodiment, the animal is a bovine. In one specific embodiment, the bovine is a common cattle or a zebu cattle. In one specific embodiment, the animal is selected from the group consisting of Jersey cattle, Holstein cattle, Friesian cattle, or crossbred dairy cattle. In other embodiments, the animal is selected from the group consisting of Creole cattle, including Romani cattle, Criollo cattle, Carora cattle, Senap cattle, or crossbred cattle.

[0173] In one embodiment, the method of any one or more of the first to thirty-eighth aspects of the present invention further includes analyzing one or more additional biomarkers. In one embodiment, the one or more biomarkers are one or more genetic markers.

[0174] In one embodiment, the method of the present invention may include two or more of the following steps: analyzing nucleic acids to determine whether they include one or more genetic variations in the PRLR gene and / or include one or more genetic markers in linkage disequilibrium with it; observing the levels of one or more of PRLR, one or more of its precursors, one or more of its isotypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them; observing the activity levels of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more of its fragments in the animal; and analyzing one or more of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more of its fragments from the animal to determine whether it includes one or more variations in the amino acid sequence. Such analysis and observation may be performed using one or more methods of the aspects of the invention described above herein.

[0175] In another aspect, the present invention provides an isolated nucleic acid containing a del(C) alteration at position 39136559 of chromosome 20 of a common cow. In one embodiment, the present invention provides an isolated nucleic acid wherein C is present at position 39136559 of chromosome 20 of a common cow. In another embodiment, the nucleic acid comprises a nucleotide sequence wherein C at position 39136559 of chromosome 20 of a common cow has been deleted. In one embodiment, the present invention provides an isolated nucleic acid comprising or consisting of the following sequence or a functionally equivalent variant thereof: GACCAAACAGACCAACATGTTTAAAAGCCTCAAAAACCA (SEQ ID No. 3). In another embodiment, the present invention provides an isolated nucleic acid comprising or consisting of the sequence of SEQ ID No. 6 or a functionally equivalent variant thereof.

[0176] In one aspect, the present invention provides a cDNA comprising one or more genetic markers described herein.

[0177] In another aspect, the present invention provides one or more additional nucleic acids as further described below.

[0178] In another aspect, the present invention provides an isolated peptide as described herein. In one embodiment, the present invention provides an isolated peptide comprising or consisting of the sequence of SEQ ID No. 7 or a functionally equivalent variant thereof.

[0179] In other respects, the present invention provides:

[0180] - Animals selected by any one or more of the second, tenth, eighteenth, and twenty-sixth aspects;

[0181] - One or more cells or embryos selected by any one or more of the fifth, thirteenth, twenty-first, and twenty-ninth aspects;

[0182] - Offspring or animals produced by any one or more of the fourth, sixth, seventh, eighth, twelfth, fourteenth, fifteenth, sixteenth, twentieth, twenty-second, twenty-third, twenty-fourth, twenty-eighth, thirtieth, thirty-first, and thirty-second aspects.

[0183] In other respects, the present invention relates to the following specific embodiments:

[0184] 1. A method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the steps of: analyzing nucleic acids from the animal to determine whether it includes one or more genetic variations in the PRLR gene and / or includes one or more genetic markers in linkage disequilibrium with it, wherein if the nucleic acid includes the one or more genetic variations and / or one or more genetic markers in linkage disequilibrium with it, the animal and / or its offspring are determined to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0185] 2. A method for selecting or excluding an animal, one or more cells, or an embryo, the method comprising at least the steps of: analyzing nucleic acids from an animal, one or more cells, or an embryo to determine whether it includes one or more genetic variations in the PRLR gene and / or includes one or more genetic markers in linkage disequilibrium with it.

[0186] 3. A method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: analyzing nucleic acids from the animal to determine whether it includes one or more genetic variations in the PRLR gene and / or one or more genetic markers in linkage disequilibrium therewith, wherein the presence of the one or more genetic variations and / or one or more genetic markers in linkage disequilibrium therewith infers that the animal and / or its offspring will be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0187] 4. A method for breeding animals, the method comprising at least the steps of: selecting a first animal having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it; and mating the first animal with a second animal, the method optionally further comprising the step of: selecting the second animal if the second animal has one or more genetic variations in the PRLR gene and / or has one or more genetic markers in linkage disequilibrium with it.

[0188] 5. A method for breeding animals, the method comprising at least the steps of: selecting a first gamete having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it; and fusing the first gamete with a second gamete to form a zygote, the method optionally further comprising the step of: selecting the second gamete if the second gamete has one or more genetic variations in the PRLR gene and / or has one or more genetic markers in linkage disequilibrium with it.

[0189] 6. A method for breeding animals, the method comprising at least the following steps: selecting an embryo having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it.

[0190] 7. A method for cloning an animal, the method comprising at least the steps of: selecting one or more cells having one or more genetic variations in the PRLR gene and / or having one or more genetic markers in linkage disequilibrium with it.

[0191] 8. The method of any one of embodiments 1 to 7, wherein one or more genetic alterations in the PRLR gene result in increased PRLR activity.

[0192] 9. The method of any one of embodiments 1 to 8, wherein the method comprises analyzing nucleic acids from the animal to determine:

[0193] Does it include one or more genetic alterations located within the region defined by nucleotides at positions 39136469 and 39136649 of chromosome 20 corresponding to ordinary cattle?

[0194] Does it include one or more genetic alterations located in the last exon of the PRLR gene?

[0195] The nucleotide corresponding to position 39136559 on chromosome 20 of a common cow;

[0196] Does it include a genetic alteration corresponding to the deletion of chromosome 20 at position 39136559, which corresponds to the chromosome 20 of a common cow; and / or

[0197] Does it include one or more genetic markers that are in linkage disequilibrium with one or more of the foregoing items?

[0198] 10. A method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, the method comprising at least the steps of: observing in the animal the levels and / or activity levels of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them.

[0199] 11. A method for selecting or excluding an animal, one or more cells, or an embryo, the method comprising at least the steps of: observing the level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them in the animal, one or more cells, or an embryo.

[0200] 12. A method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: observing the level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of the nucleic acids encoding any one or more of them.

[0201] 13. A method for breeding animals, the method comprising at least the steps of: selecting a first animal having a level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them, the level and / or activity level indicating an animal or multiple animals having or likely having enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and mating the first animal with a second animal, the method optionally further comprising the step of: selecting a second animal if the second animal has a level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them, the level and / or activity level indicating an animal or multiple animals having or likely having enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0202] 14. A method for breeding animals, the method comprising at least the steps of: selecting a first gamete having a level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding one or more of its nucleic acids, said level and / or activity level indicating an animal or animals having or likely having enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture; and fusing the first gamete with a second gamete to form a zygote, said method optionally further comprising the step of: selecting the second gamete having a level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or encoding one or more of its nucleic acids, said level and / or activity level indicating an animal or animals having or likely having enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0203] 15. A method for breeding animals, the method comprising at least the steps of: selecting embryos having a level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them, the level and / or activity level indicating an animal or animals having or being very likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0204] 16. A method for cloning an animal, the method comprising at least the steps of: selecting one or more cells having a level and / or activity level of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more of its nucleic acids encoding any one or more of them, the level and / or activity level indicating an animal having or being very likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture.

[0205] 17. A method for determining whether an animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the steps of: analyzing one or more of a PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments from the animal to determine whether it includes one or more variations in an amino acid sequence, wherein if one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments have said one or more variations, the animal and / or its offspring are determined to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0206] 18. A method for selecting or excluding an animal, one or more cells, or an embryo, the method comprising at least the steps of: analyzing one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof from an animal, one or more cells, or an embryo to determine whether it includes one or more variations in an amino acid sequence.

[0207] 19. A method for estimating the value of an animal and / or its offspring, the method comprising at least the steps of: analyzing one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more of its fragments from the animal to determine whether it includes one or more variations in the amino acid sequence, wherein the presence of the one or more variations infers that the animal and / or its offspring are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture.

[0208] 20. A method for breeding animals, the method comprising at least the steps of: selecting a first animal having one or more variations in the amino acid sequence of one or more of a PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof; and mating the first animal with a second animal, the method optionally further comprising the step of: selecting the second animal if the second animal has one or more variations in the amino acid sequence of one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0209] 21. A method for breeding animals, the method comprising at least the steps of: selecting a first gamete having one or more variations in the amino acid sequence of one or more of a PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof; and fusing the first gamete with a second gamete to form a zygote, the method optionally further comprising the step of: selecting the second gamete if the second gamete has one or more variations in the amino acid sequence of one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0210] 22. A method for breeding animals, the method comprising at least the steps of: selecting an embryo having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0211] 23. A method for cloning an animal, the method comprising at least the steps of: selecting one or more cells having one or more variations in the amino acid sequence of one or more of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof.

[0212] 24. The method as described in any one of embodiments 17 to 23, wherein one or more variations in the amino acid sequence include one or more of the following:

[0213] Variations that increase PRLR activity;

[0214] The missing element that causes PRLR to be truncated;

[0215] The variation is located in the region from the position of amino acid 430 corresponding to the PRLR of ordinary cattle to the position of amino acid 490 corresponding to the PRLR of ordinary cattle;

[0216] The variation that causes the PRLR to be truncated in the region that is approximately from the amino acid position 430 corresponding to the PRLR of ordinary cattle to the amino acid position 490 corresponding to the PRLR of ordinary cattle.

[0217] In the PRLR of ordinary cattle, alanine at position 461 is replaced by valine; and / or

[0218] This variation truncates the PRLR to the position 461, which corresponds to the amino acid position of the PRLR in normal cattle.

[0219] 25. A method for producing an animal that is likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture, the method comprising at least the step of: introducing one or more genetic alterations into the PRLR gene of one or more cells used to produce the animal.

[0220] 26. The method of embodiment 25, wherein one or more genetic alterations include one or more of the following:

[0221] This improved the activity of the PRLR;

[0222] Changes located within the region defined by nucleotides at positions 39136469 and 39136649 of chromosome 20 in ordinary cattle;

[0223] The alteration is located in the last exon of the PRLR gene;

[0224] The change corresponds to the position 39136559 of chromosome 20 in ordinary cattle; and / or

[0225] The missing value of C corresponds to position 39136559.

[0226] 27. The method of embodiment 25 or 26, wherein the method comprises the step of selecting or excluding one or more animals, cells or embryos using any one or more methods of embodiment 2, 11 or 18.

[0227] 28. An animal produced by a method as described in any one of embodiments 4 to 7, 13 to 16, 20 to 23 or 25 to 27.

[0228] 29. A method for forming a herd, the method comprising at least the following steps:

[0229] a. Perform the method as described in any one of embodiments 1 to 3, 10 to 12, or 17 to 19;

[0230] b. Selecting or excluding animals based on the results of step a; and

[0231] c. Form a herd of the selected animals.

[0232] 30. A herd formed using the method described in embodiment 28.

[0233] 31. A method for identifying one or more genetic variations in a PRLR gene or one or more amino acid variations in PRLR in an animal, said one or more genetic variations or one or more amino acid variations inferring enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, said method comprising identifying one or more genetic variations in the PRLR gene or one or more amino acid variations in PRLR and determining whether it results in an increase in the level or activity of said PRLR.

[0234] 32. A method for identifying whether an animal (and / or its offspring), one or more cells, or an embryo has or may have one or more genetic alterations in a PRLR gene or one or more amino acid variations in PRLR, said one or more genetic alterations or one or more amino acid variations being associated with enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, said method comprising observing the nucleic acid sequence of said PRLR gene or the amino acid sequence of said PRLR, one or more of its precursors, one or more of its fragments, and / or one or more of its subtypes to identify whether it includes amino acid variations and / or genetic alterations and / or one or more genetic markers in linkage disequilibrium with which it is located.

[0235] 33. An isolated nucleic acid containing a del(C) alteration at position 39136559 on chromosome 20 of a common cow.

[0236] 34. An isolated nucleic acid comprising the sequence of SEQ ID No. 3 or the sequence of SEQ ID No. 6 or a functionally equivalent variant thereof, or consisting of the sequence of SEQ ID No. 3 or the sequence of SEQ ID No. 6 or a functionally equivalent variant thereof.

[0237] 35. An isolated peptide comprising the sequence of SEQ ID No. 7 or a functionally equivalent variant thereof, or consisting of the sequence of SEQ ID No. 7 or a functionally equivalent variant thereof.

[0238] 36. An isolated nucleic acid comprising the sequence of SEQ ID no. 1 or the sequence of SEQ ID no. 2 or a functionally equivalent variant thereof, or consisting of the sequence of SEQ ID no. 1 or the sequence of SEQ ID no. 2 or a functionally equivalent variant thereof.

[0239] The invention can also be broadly considered to consist of any or all combinations of two or more parts, elements and features, or two or more of the parts, elements or features mentioned or indicated individually or jointly in the description of this application, and where a particular overall scheme is mentioned herein and there are known equivalents in the field related to the invention, such known equivalents are considered to be incorporated herein as if they were described separately. Attached Figure Description

[0240] Based on the following description and with reference to the accompanying drawings, these and other aspects of the invention, which should be considered in all novel aspects of the invention, will become apparent. The description is given by way of example only, wherein:

[0241] Figure 1 The diagram illustrates the nucleotide sequence of the common bovine prolactin receptor (PRLR) transcript variant 2 mRNA (NCBI reference sequence: NM_001039726.2). PRLR is long. The translation region is highlighted. The start codon at position 85 corresponds to position 39115293 on UMD 3.1. Exon 1 starts at 39115245 as disclosed by NCBI. The stop codon at position 1828 in the mRNA sequence is located at position 39136922 in the genome construct UMD 3.1. The base deletion identified in DNA from Senap cattle is located at position 1466 (highlighted) in the mRNA sequence and at genomic position 39136559. The resulting frameshift encodes valine, which in turn causes a stop codon that truncates the protein. Figure 2 ).

[0242] Figure 2 : Common bovine prolactin receptor (PRLR) transcript variant 2 mRNA.

[0243] The product is the PRLR long form (NCBI reference sequence: NM_001039726.2). The frameshift mutation observed by the inventors of this application will shorten the protein from 581 amino acids to 461 amino acids by removing the highlighted sequence; and change the new carboxyl-terminal amino acid from alanine to valine.

[0244] Figure 3 The product is a common bovine prolactin receptor (PRLR) transcriptomorph 2 mRNA, exhibiting the alteration identified by the inventors of this application, namely a missing base in the Senap bovine PRLR (at position 39136559 on BTA20) (c), indicated by omission. The product is the long form of PRLR (NCBI reference sequence: NM_001039726.2).

[0245] Figure 4 The predicted amino acid sequence (n461) of the prolactin receptor in Senap bovines resulting from the deletion of base C at position 39136559 of BTA20 in ordinary bovines.

[0246] Figure 5 The diagram illustrates the nucleotide sequence of the common bovine prolactin receptor (PRLR) transcript variant 2 mRNA (NCBI reference sequence: NM_001039726.1). PRLR is long. The translation region is highlighted. The start codon at position 87 corresponds to position 39115293 on UMD 3.1. Exon 1 starts at 39115245 as disclosed by NCBI. The stop codon at position 1830 in the mRNA sequence is located at position 39136922 in the genome construct UMD 3.1. The base deletion identified in DNA from Senap cattle is located at position 1468 in the mRNA sequence (highlighted) and genomic position 39136559. The resulting frameshift encodes valine, which in turn causes a stop codon that truncates the protein. Figure 2 ). Detailed Implementation

[0247] The following is a general description of the invention, including preferred embodiments thereof. The invention is further elucidated by the disclosure set forth in certain “Examples,” which in particular provides experimental data supporting the invention.

[0248] The inventors of this application have identified specific alleles of a genetic marker in the prolactin receptor (PRLR) gene located in a region of chromosome 20 in common cattle, which are associated with the very short, smooth coat observed in Senap cattle, a breed with enhanced heat tolerance. This is the first time that alterations in the PRLR gene have been directly linked to the short, smooth coat and heat tolerance traits in cattle. Therefore, the inventors of this application envision that any genetic alterations in the PRLR gene, particularly those that increase PRLR activity, could be used as markers to determine whether an animal is likely to have enhanced heat tolerance. Thus, while the following description may focus on the analysis of nucleotide sequences at specific locations within this gene, it should be understood to extend to the analysis of nucleotide sequences at any other locations within the gene.

[0249] The inventors of this application also envision that analysis of one or more genetic markers in linkage disequilibrium with such alterations in the PRLR gene could be used to achieve the same purpose. Furthermore, haplotypes comprising two or more such genetic alterations and / or combinations of markers in linkage disequilibrium with them could also be used to achieve this purpose.

[0250] Furthermore, the inventors of this application envision a method for determining whether an animal (and / or its offspring) is likely to have enhanced heat resistance, which may include observing the levels of PRLR, one or more of its isoforms, one or more of its precursors, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them, wherein in one embodiment, an increase in the level of any one or more of these molecules infers that it is likely to have enhanced heat resistance. Additionally, the inventors of this application envision a method involving the observation of the activity of PRLR (including references to one or more of its isoforms, one or more of its precursors, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them), wherein in one embodiment, an increase in the activity level of PRLR (including references to one or more of its isoforms, one or more of its precursors, one or more of its fragments, and / or one or more nucleic acids encoding any one or more of them infers that the animal is likely to have enhanced heat resistance.

[0251] Furthermore, regarding certain genetic variations or alterations that result in changes to the amino acid sequence of the PRLR, the inventors of this application envision a method for determining whether an animal (and / or its offspring) is likely to possess enhanced heat resistance that may include observing whether these molecules include one or more variations in their amino acid sequences. It should be understood that this may include observing size variations in the PRLR (including references to one or more precursors, subtypes, fragments, and / or nucleic acids encoding any one or more of them).

[0252] Analysis of one or more biomarkers correlated with PRLR according to the present invention can also be used to select or exclude one or more cells or embryos. Such analysis can contribute to methods, for example, for animal breeding or cloning.

[0253] While the invention has been described herein in relation to determining or inferring whether an animal and / or its offspring are likely to have increased heat resistance, it should be understood that it is equally applicable to methods for determining or inferring whether an animal and / or its offspring are likely to have decreased heat resistance or substantially no increase in heat resistance. The description herein (including all aspects and embodiments of the invention) should be accordingly interpreted to encompass this.

[0254] In addition to using the methods of the present invention to determine or infer whether an animal and / or its offspring are likely to have enhanced heat resistance, the inventors of this application also envision that the methods of the present invention are applicable to determining or inferring whether an animal and / or its offspring are likely to have a desired coat texture (such as the short, smooth coat of cattle), because this relates to the phenotype observed in Senap cattle and is associated with heat resistance. Furthermore, the inventors of this application envision that the methods of the present invention are applicable to determining or inferring whether an animal and / or its offspring are likely to have a certain level of resistance to ticks. Tick resistance is related to coat type; shorter coats increase tick resistance while longer coats increase tick infestation, and tick resistance is associated with Senap cattle. Therefore, while the methods of the present invention may be described herein in relation to enhanced heat resistance, it should be understood that these methods (including all aspects and embodiments of the present invention) can be used as an alternative or additional means to achieve the purpose of determining or inferring whether an animal and / or its offspring are likely to have a desired coat texture and / or a certain level of tick resistance or enhanced resistance to ticks. The description should be interpreted accordingly to cover such alternative or other methods.

[0255] In some embodiments, the "desired fur texture" includes thin, light, smooth, and / or short fur. For example: in the cases of bovids and capillaries, the "desired fur texture" may be short and smooth; in the cases of argali sheep, the "desired fur texture" may be short, thin, and / or light; in the cases of suidae, the "desired fur texture" may be short, thin, and / or light; and in the cases of pheasants, the "desired fur texture" may be thin and / or long, light feathers. In some embodiments, the "undesired fur texture" is the fur texture associated with animals having significantly limited heat tolerance. The "undesired fur texture" may include thick, heavy, coarse, and / or long fur.

[0256] Analyzing one or more biomarkers according to the present invention can help, for example: predict phenotypic performance, including in production management systems known as Marker Assisted Selection; select or exclude animals for breeding purposes; select or exclude animals for milk production, meat production, egg production, fur, hair, wool, pelt, or feather production and / or desired fur texture; manage animals to maximize their individual potential performance and value; estimate the value or economic value of animals; increase profits associated with the sale of animals and / or products produced by said animals; improve the genetics of animal populations by selecting and breeding desired animals; generate and maintain animal herds; clone animals that may or may not have specific traits; predict the fitness of animals and / or their offspring for use in different industries and / or environments and / or breeding programs or cloning. Animals suited to specific production systems, industries, or environments to varying degrees can be tested or screened to predict lifespan performance and isolated or managed to suit their genotype and thus the predicted phenotype. Animals can be tested or screened at any time during their life, including but not limited to early birth, as gametes, zygotes, embryos, and fetuses.

[0257] The inventors of this application have identified that alterations in the PRLR gene are associated with heat tolerance and desired coat texture (e.g., the short, smooth coat of cattle), and also allow for the production of animals with such desired phenotypes using cloning and / or gene editing methods, in which one or more specific genetic alterations are introduced into the PRLR gene. For example, one or more specific alterations may be introduced into a single gamete or zygote during an IVF program, or into one or more related cells during a cloning procedure. Therefore, the present invention should be considered as including methods for producing animals that are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired coat texture.

[0258] Although the inventors of this application have identified relevant markers in bovine animals, they envision that the method of this invention is equally applicable to a variety of different animals (as described below), including but not limited to cattle, sheep, goats, chickens, and pigs.

[0259] definition

[0260] As used herein, the term “one or more biomarkers” should be broadly understood and includes, for example, one or more genetic markers; the level of one or more proteins (including references to one or more segments, one or more precursors, one or more isoforms thereof) or nucleic acids encoding one or more proteins (including references to one or more segments, one or more precursors, one or more isoforms thereof); the expression level of one or more genes or proteins (including references to one or more segments, one or more precursors, one or more isoforms thereof); the activity level of one or more proteins (including references to one or more segments, one or more precursors, one or more isoforms thereof); and / or variations in the amino acid sequence of proteins (including references to one or more segments, one or more precursors, one or more isoforms thereof), which may include observations of the size of the protein (including references to one or more segments, one or more precursors, one or more isoforms thereof).

[0261] As used herein, the term "genetic marker" refers to a nucleic acid or specific locus (including a specific nucleotide position) that exhibits polymorphism or contains sequence alterations or variations within a population, whose alleles can be detected and distinguished by one or more analytical methods. The term "genetic marker" also includes, within its scope, multiple genetic markers that co-segregate in the form of "haplotypes." In this context, the term "haplotype" refers to multiple genetic markers that are generally co-inherited. Typically, genetic markers within a haplotype are in linkage disequilibrium. The term "genetic marker" in the context of "genetic marker of the invention" and similar terms can be used herein to describe one or more genetic variations in the PRLR gene according to the invention.

[0262] When this document refers to analyzing nucleic acids to determine the nucleotide sequence of a "genetic marker" or the nucleotide sequence at a specific genetic location, or the presence, absence, or nature of one or more genetic variations, it should be considered to include analyzing and determining the nucleotide sequence on any strand of the nucleic acid. Those skilled in the art will be able to readily determine the nucleotides or bases on the reverse strand based on the well-known structure of the DNA molecule: C pairs with G, and A pairs with T. Therefore, if it is mentioned that the presence of T at a specific location is identified, this should be considered to include identifying the presence of A on the reverse strand of DNA, and vice versa. Similarly, if it is mentioned that the presence of G at a specific location is identified, this should be considered to include identifying the presence of C on the reverse strand of DNA, and vice versa.

[0263] The term "single nucleotide polymorphism" (SNP) refers to a variation in the nucleic acid sequence that occurs when a single nucleotide in the genome is altered. A SNP can also be a single nucleotide insertion or deletion. The different nucleotides within an SNP are called alleles.

[0264] As used herein, the term "genotype" refers to the genetic composition or nucleotide sequence at one or more loci, particularly the nucleotide sequence of the alleles at a locus.

[0265] "Linkage disequilibrium" should be broadly understood to refer to the tendency of the presence of an allele at one locus to predict the presence of the allele at one or more other loci (e.g., different genetic markers). The loci need not necessarily be located on the same chromosome. However, in a preferred embodiment, the loci are located on the same chromosome. In one specific embodiment of the invention, the marker in linkage disequilibrium with the genetic alteration according to the invention is located on chromosome 20 in a region between approximately 38.35 Mb and approximately 39.85 Mb in a common cattle. In another specific embodiment, the marker in linkage disequilibrium is located on chromosome 20 in a region between approximately 38.4 Mb and approximately 39.8 Mb. In yet another embodiment, the marker in linkage disequilibrium is located on chromosome 20 in a region between approximately 38.5 Mb and approximately 39.7 Mb.

[0266] One measure of chain imbalance is DELTA. 2 It is calculated using the formula described by Devlin et al. (Genomics 29(2):311-22(1995)) and is a measure of the extent to which allele X at the first locus predicts the occurrence rate of allele Y at the second locus. 1.0 DELTA 2 The value indicates that the prediction is complete (e.g., if Y exists, then X exists). It should be understood that when referring to chain imbalances in this paper, it should not be assumed to represent a DELTA of 1.0. 2 Value. In a specific implementation, the linkage disequilibrium between the allele at one locus and the allele at a second locus has a DELTA of at least 0.75, at least 0.80, at least 0.85, at least 0.90, at least 0.95, and most preferably 1.0. 2 value.

[0267] Those skilled in the art will readily understand the methods used to determine whether any two alleles are in linkage disequilibrium. However, for example, see *Genetic Data Analysis II*, Weir, Sinauer Associates, Inc. Publishers, Sunderland, Massachusetts, 1996.

[0268] In the context of analyzing nucleic acids to determine whether they include genetic markers in linkage disequilibrium with one or more genetic variations in the PRLR gene, it should be understood that such genetic markers can be genomically native (e.g., in animals or one or more cells) or they may have been artificially generated or inserted. “Artificially generated or inserted” genetic markers are those that have been introduced into the genome. Such genetic markers can include any one or more of a variety of genetic alterations, including, for example, the addition of one or more nucleotides to the genome, the substitution of one or more nucleotides within the genome by one or more nucleotides, and / or the deletion of one or more nucleotides from the genome. In one specific embodiment, the genetic marker is a heterologous nucleic acid containing one or more nucleotides inserted into the genome. Those skilled in the art will readily understand methods for introducing such genetic markers into the genome of an animal, including various recombination techniques, such as gene editing methods and site-directed mutagenesis.Such techniques can be described in, for example, the following literature: Sambrook and Russell, *Molecular Cloning: A Laboratory Manual*, 2001, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York; and *Precision Editing of Large Animal Genomes*, Wenfang (Spring) Tan, Daniel F. Carlson, Mark W. Walton, Scott C. Fahrenkrug, and Perry B. Hackett, *Adv Genet.*, 2012; 80:37-97. doi:10.1016 / B978-0-12-404742-6.00002-8; and *One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR / Cas-Mediated Genome Engineering*. (Genome Engineering), Haoyi Wang, Hui Yang, Chikdu S. Shivalila, Meelad M. Dawlaty, Albert W. Cheng, Feng Zhang and Rudolf Jaenisch. Cell. May 9, 2013; 153(4):910-918. doi:10.1016 / j.cell.2013.04.025. To give just one example, such genetic markers may have been introduced into the genome of one or more cells to be tested, the genome of one or more cells from the ancestral lineage of an animal, or the genome of one or more cells from the animal to be tested.

[0269] "Variations in the amino acid sequence" of PRLRs, their isotypes, fragments, and / or precursors should be broadly considered to include any changes in the amino acid sequence. By way of example only, it should be considered to include substitutions of one or more amino acids, additions of one or more amino acids, and / or deletions of one or more amino acids.

[0270] "Genetic variation" should also be broadly considered to include any change in nucleotide sequence. For example, it should be considered to include the substitution of one or more nucleotides, the addition of one or more nucleotides, and / or the deletion of one or more nucleotides.

[0271] In the context of describing the invention in relation to identifying or determining whether a nucleic acid includes one or more genetic variations or whether a peptide or protein includes one or more variations in its amino acid sequence, it should be understood that such variations are differences between the nucleic acid or amino acid sequence and the nucleic acid sequence associated with one or more animals having significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture, or not having enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. Typically, such variations will be determined relative to a reference sequence. In some embodiments, the reference sequence is a nucleic acid encoding a portion or all of the PRLR gene and / or one or more genetic markers in linkage disequilibrium with it, along with the amino acid sequence of PRLR, its subtype, precursor, or fragment, associated with an animal having significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture, as defined herein. In one embodiment, the nucleic acid reference sequence is SEQ ID No. 4 or a portion thereof. In one embodiment, the amino acid reference sequence is SEQ ID No. 5 or a portion thereof. In other embodiments, the reference sequence may be a nucleic acid, peptide, or protein having a sequence known to be associated with enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture, as defined herein. Therefore, the use of "variation" should not be limited to meaning that the analyzed nucleic acid, peptide, or protein differs from the reference sequence.

[0272] When referring to a protein or peptide being truncated "to the position corresponding to position Z" and similar phrases, it is intended to indicate that the protein or peptide terminates at position Z.

[0273] When referring to a region “defined by a specific nucleotide or amino acid,” it should be understood to mean the region containing that nucleotide or amino acid. In other words, the region includes the mentioned terminal nucleotide or amino acid. For example, the region “defined by the nucleotides at positions 39136469 and 39136649” includes the nucleotides present at positions 39136469 and 39136649.

[0274] "Genetic alterations or variations that enhance PRLR activity" can be any genetic change that affects the level, expression, or activity of the PRLR gene product (including references to its isotypes, segments, and / or precursors). For example, it can increase the expression level of the gene product or alter its structure or function. Similarly, "amino acid sequence variations that enhance PRLR activity" or similar phrases can be any change that affects the level or activity of PRLR (including references to its isotypes, segments, and / or precursors). The term "enhancement" should not be considered to indicate any specific level of activity or function; what is required is simply that there is at least a certain degree of enhancement in activity compared to one or more animals (including references to the same animal if the animal does not have the biomarker according to the invention) without the said variation or alteration.

[0275] Generally, when referring to an “increased” or “decreased” level or activity of PRLR, its isotype, its fragment, its precursor, and / or the nucleic acid encoding any one or more of them, it should be broadly understood to include any increase or decrease in said level compared to one or more reference animals or standards. It may also be mentioned herein that the level or activity of PRLR, its isotype, its fragment, its precursor, and / or the nucleic acid encoding any one or more of them is “higher” or “lower” compared to one or more reference animals or standards. This should not be interpreted as indicating a specific level or activity of PRLR, its isotype, its fragment, its precursor, and / or the nucleic acid encoding any one or more of them. Standard assays known in the art can readily determine whether a variation results in an increase or decrease in the level or activity of PRLR compared to a standard, including those techniques illustrated below.

[0276] In one embodiment, the inventors of this application envision that a PRLR level or activity that is at least about 20% higher than that of one or more animals that do not have the desired phenotype (improved heat resistance, improved resistance to ticks, and / or desired fur texture) could indicate that an animal does indeed have the desired phenotype (improved heat resistance, improved resistance to ticks, and / or desired fur texture).

[0277] When referring to the “PRLR gene,” it should be understood to include both the coding and non-coding regions of the gene, including upstream and downstream regulatory elements. The PRLR gene has been reported to be transcribed into two mRNA forms that differ in length: short and long. Therefore, the term “PRLR gene” may be used herein with terms such as “long” or “short,” which respectively refer to the gene being transcribed into long or short mRNA. When referring to a specific location of genetic alteration within the PRLR gene (e.g., in the last exon), it should be interpreted in consideration of the long form. However, unless otherwise stated, in general, when referring to the PRLR gene, it should be understood to include both the short and long forms. In a preferred embodiment of the invention, the PRLR gene is the long form.

[0278] “PRLR” stands for prolactin receptor. Unless the context otherwise requires, reference to “PRLR” herein should be considered to include reference to the precursor of PRLR, PRLR isoforms, and / or PRLR fragments. For example, the methods of the present invention may include analyzing the sequence, level, and / or activity of PRLR, PRLR isoforms, PRLR precursors, and / or PRLR fragments and / or nucleic acids encoding any one or more of them. Furthermore, PRLR is known to exist in two common isoforms: long and short. Reference to PRLR herein should be considered to include reference to both forms. However, in a preferred embodiment, the PRLR is the long form.

[0279] The term "functionally equivalent variant" of any particular nucleic acid mentioned herein should be broadly considered to encompass any nucleic acid whose nucleic acid sequence may differ from the specific sequence provided, but which retains substantially the same function; for example, in the case of oligonucleotides used to detect the genetic markers of the present invention, the ability to bind to a specific target nucleic acid or elicit a specific reaction with desired specificity. The phrase "functionally equivalent" should not be construed as meaning that the variant has the same level of activity as the nucleic acid that produces it as a variant, although this may be desired. In one embodiment, any "functionally equivalent variant" of a particular nucleic acid will have at least about 80%, about 90%, about 95%, or about 99% sequence homology or identity with the nucleic acid that produces it as a variant.

[0280] The term "functionally equivalent variant" of any particular peptide or protein mentioned herein should be broadly considered to encompass any peptide or protein whose amino acid sequence may differ from the specific sequence provided, but which retains substantially the same function. The phrase "functionally equivalent" should not be construed as meaning that the variant has the same level of activity as the peptide or protein that produces it as a variant, although this may be desirable. In one embodiment, any "functionally equivalent variant" of a particular peptide or protein will have at least about 80%, about 90%, about 95%, or about 99% sequence similarity or identity to the peptide or protein that produces it as a variant.

[0281] The term "animal" should be broadly considered to include a variety of different animals. In one implementation, "animal" is a mammal. In a specific implementation, the animal is from the Bovidae, Pheasantae, or Suidae families.

[0282] In one embodiment, the animal belongs to the subfamily Bovinae. In another embodiment, the animal belongs to the genus Bos. In some embodiments, the animal is a common cattle or a zebu. In a specific embodiment, the animal is a beef cattle breed and / or a dairy cattle breed. Also, for example, the animal may be selected from the group including, but not limited to, the following: Jersey cattle, Holland cattle, Friesian cattle, Ayrshire cattle, crossbred dairy cattle, Angus cattle, Hereford cattle, Simmental cattle, and crossbred beef cattle. In other embodiments, the animal is selected from the group including: Creole breeds of cattle, including Romansh cattle, Creole cattle, Carrolla cattle, Senap cattle, and crossbred dairy or beef cattle. In one specific embodiment, the animal is a hybrid between an animal breed known to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, and an animal breed known to have significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture. Those skilled in the art will readily recognize a variety of other species and breeds to which the invention can be applied.

[0283] In another embodiment, the animal from the Bovidae family is from the Caprinae subfamily. In one embodiment, the animal belongs to the Capra genus. In some embodiments, the animal is the domestic goat (Capra hircus). In one embodiment, the animal is a breed used for dairy, meat, and / or wool farming and production. In some embodiments, the animal may be selected from the group including, but not limited to, the following: Saanen, Alpine, Nubian, Boer, and Cashmere. In another embodiment, the animal belongs to the Argali genus. In some embodiments, the animal is the Ovisaries. In one embodiment, the animal is a breed used for dairy, meat, and / or wool farming and production. In some embodiments, the animal may be selected from the group including, but not limited to, the following: Border Leicester, Merino, Wiltshire, Dorset, East Friesian, and Lacaune. Those skilled in the art will readily understand that the present invention can be applied to a variety of other species and varieties.

[0284] In one embodiment, the animal belongs to the subfamily Suinae. In another embodiment, the animal belongs to the genus Sus. In some embodiments, the animal is a wild boar (Sus scrofa). In one embodiment, the animal is a breed used for meat and / or leather farming and production. In some embodiments, the animal may be selected from the group including, but not limited to, the following: Landrace, Duroc, Meishan, Berkshire, and Philippine native. Those skilled in the art will readily recognize that the invention can be applied to a variety of other species and breeds.

[0285] In one embodiment, the animal from the Phasianidae family is from the Phasianinae subfamily. In one embodiment, the animal belongs to the genus *Gallus*. In some embodiments, the animal is *Gallus gallus*. In one embodiment, the animal is a breed used for meat, feather, and / or egg production. In some embodiments, the animal may be selected from the group including, but not limited to, the following: Namtam, Leghorn, Silkie, and Wyandotte. Those skilled in the art will readily recognize that the invention can be applied to a variety of other species and breeds.

[0286] The invention may be described herein by referring to the “herd” of animals. This term should be broadly considered to include any group of animals of the same species. The term should also be considered to encompass other collective nouns used to refer to any particular group of animals, such as “herd” or “grazing herd.”

[0287] "Increased tolerance to heat," "increased heat tolerance," and similar phrases should be broadly understood to mean that an animal is better able to maintain or regulate its body temperature under heat stress compared to animals without the genetic alterations or other biomarkers described herein. In one embodiment, the animal has a lower mean body temperature under heat stress compared to animals without the biomarkers according to the invention (including references to the same animal if it does not have the biomarkers according to the invention).

[0288] As used herein, “significantly limited heat tolerance” and similar phrases mean that an animal has a limited or essentially no ability to maintain or regulate its body temperature under heat stress. In one embodiment, the animal will have a higher average body temperature under heat stress compared to an animal having the biomarker according to the invention (including references to the same animal if it has the biomarker according to the invention).

[0289] As used herein, “thermal stress” should be broadly understood to mean exposure to temperatures of at least about 25°C. This temperature can be calculated as a composite temperature using known methods, taking into account any one or more of air temperature, humidity, radiant heat, and convective heat. In one embodiment, “thermal stress” includes exposure to a temperature humidity index (THI) of about 72.

[0290] When the term “fur” is used in this article, it should be considered to include references to skin, hair, wool, or feathers, depending on the specific animal.

[0291] The terms “tick resistance,” “resistance to ticks,” and similar terms should be broadly understood to describe an animal’s ability to resist ticks, limit the number of ticks carried on its fur, and / or limit the number of ticks that survive to maturity compared to an animal without the biomarker described herein (including references to the same animal if it does not have the biomarker according to the invention). It should not be construed as meaning that absolutely no ticks will affect, infest, or harm the animal, or that no ticks will survive to maturity. In one embodiment, the presence of the biomarker of the invention infers at least a certain level of “enhanced” resistance to ticks. This should be broadly understood to mean that an animal is better resistant to ticks compared to an animal without the biomarker described herein (including references to the same animal if it does not have the biomarker according to the invention), including, for example, a reduction in the number of ticks carried on its fur, a reduction in tick infestation or disturbance, and / or a smaller number of ticks that survive to maturity.

[0292] As used herein, “significantly limited resistance to ticks” and similar phrases mean that an animal has limited or essentially no ability to resist tick infestation or intrusion. In one embodiment, in the presence of ticks, the animal will carry a higher number of ticks on its fur and / or a higher number of ticks that survive to maturity compared to an animal with the biomarker according to the invention (including references to the same animal if it has the biomarker according to the invention).

[0293] As used herein, the term "value" for an animal refers to an indicator used to evaluate the animal's value for purposes such as breeding, inclusion in a herd, and herd management. "Value" is the sum of estimated values ​​of one or more characteristics that may be associated with the animal, typically weighed by economic value. Exemplary characteristics include milk fat, protein, milk volume, live weight, fertility, milk somatic cell count, growth rate, feed conversion ratio, and egg production. The term "value" should be considered to encompass "breeding value" as well as other known indicators used to assess animal value. Those skilled in the art will readily recognize methods and formulas applicable to estimating breeding value based on many different characteristics. The results, data, and / or information generated by the methods of this invention can be used to calculate and estimate "value."

[0294] It should be understood that, where the methods of this invention involve breeding animals, any suitable breeding method can be used, including, for example, natural insemination, artificial insemination, and in vitro fertilization (IVF). Therefore, the term "mating" should be interpreted broadly and is not limited to the actual mating of two animals. It should be understood that methods for breeding animals may include one or more gene-editing steps and / or cloning techniques.

[0295] As previously noted herein, the methods of the present invention can be used to identify animals suitable for cloning. They can also be used during the cloning process to determine whether one or more cells, embryos, or the cloned animal possess a genetic variation in the PRLR gene and is likely to have (or develop into an animal with) enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. Any suitable cloning method can be used. However, such cloning techniques, by way of example, include somatic cell nuclear transfer, chromatin transfer, and embryo splitting. Suitable somatic cell nuclear transfer and chromatin transfer methods will be readily understood by those skilled in the art. However, for example, the methods described in the following publications can be used: Bovine somatic cell nuclear transfer, Ross PJ and Cibelli, JB 2010. Methods in Molecular Biology, 636:155-177; and Influence of cloning by chromatin transfer on placental gene expression at Day 45 of pregnancy in cattle, Mesquita FS, Machado SA, Drnevicch J, Borowicz P, Wang Z, Nowak RA. AnimReprod Sci. Jan 30, 2013; 136(4):231-44. doi:10.1016 / j.anireprosci.2012.10.030. Published electronically on 8 November 2012.

[0296] In the context of this invention, any suitable IVF method may be used, as will be apparent to those skilled in the art. However, suitable methods are described, for example, in the following literature: Imai K, Tagawa M, Yoshioka H, ​​Matoba S, Narita M, et al., (2006) The efficiency of embryo production by ovoum pick-up and in vitro fertilization in cattle, J Reprod Dev 52:19-29.

[0297] The method of the present invention may be described herein by reference to "standard". The standard may include any suitable sample or other information sufficient for comparison with results from samples from animals. In one embodiment, the standard may be a control sample from an animal having a known phenotype, containing PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) and / or nucleic acids encoding therethe, which is tested simultaneously with a sample from the animal to be tested. However, in another embodiment, the standard may be a printed chart or electronic information containing previously generated data deemed to provide an appropriate standard and comparable to the test sample based on, for example, color, fluorescence level, or numerical value. Examples of suitable standards will be further illustrated later herein. However, in one embodiment, the standard will represent an animal with significantly limited heat tolerance, enhanced resistance to ticks, and / or an undesirable fur texture. In another embodiment, the standard will represent an animal with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In some embodiments, both standards may be used.

[0298] The method of the present invention may include obtaining a “sample” from an animal to be tested. The sample may be any suitable tissue or bodily fluid sample. In one embodiment, the sample may include one or more cells, blood, muscle, bone, one or more somatic cells, saliva, skin, liver, brain, placenta, amniotic fluid, and / or semen. The “sample” can be obtained from the animal using standard techniques known in the art. It should be understood that samples can be obtained from animals at any stage of life, including before birth; non-limiting examples include zygotes, embryos, and fetuses. Individual gametes can also be tested using the method of the present invention. This can be helpful for breeding and / or cloning programs. Therefore, a “sample” should be considered to include zygotes, embryonic tissue, fetal tissue, and gametes. Samples may also be obtained after the animal's death.

[0299] In addition, it should be understood that in the case of analysis or observation of nucleic acids or peptides in animals during pregnancy, such analysis or observation can be performed before the birth of the animal by analyzing the proteins, peptides, nucleic acids, or one or more cells that may be present in the maternal blood supply, placenta, amniotic fluid, or any other maternal tissues or fluids. Therefore, references to the analysis of nucleic acids from an animal, the analysis of PRLRs from an animal, their precursors, subtypes, and / or fragments, the observation of the levels of one or more PRLRs from an animal, their precursors, subtypes, and / or fragments, and / or the observation of the activity levels of PRLRs from an animal, their precursors, subtypes, and / or fragments, should be considered to include references to the analysis and / or observation of one or more of these from the animal that may be present in maternal tissues or fluids.

[0300] The term "embryo" should be broadly considered to include an organism arising from the first division of a zygote. In some embodiments, an embryo is an organism that exists between the first division of the zygote and its development into a fetus. When referring to "embryo," it should be considered to include organisms at various developmental stages, including, for example, blastocysts, blastocysts, gastrula, and morula.

[0301] In one aspect, the present invention provides a method for selecting or excluding one or more cells. In some embodiments, such "cells" may include gametes (e.g., sperm or eggs) or zygotes. Selection of such cells can be used, for example, in IVF procedures. In other embodiments, such "cells" may be, for example, somatic cells, embryonic cells, embryonic stem cells, cells in a cell line, or one or more cells for cloning. Selection of these cells can be used, for example, in cloning procedures or to prepare cell lines for cloning and other procedures.

[0302] Certain aspects and embodiments of the invention may be described herein by reference to “fusing the first and second gametes” to form a zygote. This phrase should be broadly considered to include fertilization processes, such as those used in in vitro fertilization. Those skilled in the art will readily understand the standard means of fusing gametes to form a zygote.

[0303] For ease of reference, the methods of the present invention may, subsequently, be described in relation to the analysis of biomarkers (such as nucleic acid sequences, amino acid sequences, levels of proteins and peptides, or activity levels of proteins or peptides) in or from an “animal”, or to determine whether an “animal” possesses specific markers related to or associated with enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, or to determine the genotype of an “animal.” It should be understood that the methods of the present invention are also applicable to the analysis and determination of whether individual cells and embryos, including gametes, may possess relevant biomarkers. Therefore, unless the context requires otherwise, references to “animal” should also be considered to include references to one or more cells or embryos.

[0304] The invention can be described herein by referring to the amino acid or nucleic acid sequence of the PRLR (including references to one or more subtypes, precursors, or fragments thereof) and / or the level or activity level of one or more nucleic acids encoding thereof, which "indicate" or are likely to have enhanced heat resistance, enhanced resistance to ticks, and / or the desired fur texture. "Indicates" should not be construed as meaning that the level and the level associated with such one or more animals are exactly the same. However, in one embodiment, the level or activity level and the level or activity level associated with such one or more animals are substantially similar or substantially identical. Whether the amino acid or nucleic acid sequence of the PRLR (including references to one or more subtypes, precursors, or fragments thereof) and / or the level or activity level of one or more nucleic acids encoding thereof, which "indicates" or are likely to have enhanced heat resistance, enhanced resistance to ticks, and / or the desired fur texture, can be readily determined using the various methods described herein; for example, by comparing results from test samples against one or more standards or references. When referring to "one or more animals," it should be understood to mean a particular reference or standard based on a value derived from a single animal or an average of a group of animals.

[0305] mark

[0306] The specific marker identified in this study is located in the PRLR gene at a nucleotide position on chromosome 20 of common cattle. The sequence and location given for this gene and specific genetic marker are based on the genomic sequence of chromosome 20 in bovine construct UMD3.1 (gi|258513347|ref|AC_000177.1|) in the GenBank database (http: / / www.ncbi.nlm.nih.gov / ). The location of the genetic marker should be read according to the base position that serves as the initiation site of the change, with the first nucleotide in the assumed sequence (gi|258513347|ref|AC_000177.1|) indicated as position 1. Furthermore, sequence information about the PRLR gene and its location on chromosome 20 is provided in the NCBI database: for example, reference sequence NM_001039726.2 and gene ID: 281422. The PRLR gene is located at 38,951,611 and 39,146,316 (excluding the promoter sequence). References to the location of specific genetic alterations within the PRLR gene in this article (see, for example, Table 3 below) will be interpreted in relation to its location within the long variant gene. Similarly, references to the location of specific amino acid variations within PRLR in this article will be interpreted in relation to their location within the long variant PRLR protein of common bovine bursal. Exemplary transcript and protein sequence information for common bovine PRLR is provided in this article. Figure 1 and Figure 2 middle.

[0307] This article mentions PRLR transcript variant 2 mRNA, which is provided on NCBI as NM_001039726.2. For this sequence: the start codon begins at position 85, which corresponds to position 39115293 on UMD 3.1; exon 1, as disclosed by NCBI, begins at 39115245; the stop codon begins at position 1828 in the mRNA sequence, which corresponds to position 39136922 in the genome construct UMD3.1; and the base deletions identified by the inventors of this application are at positions 1466 and 39136559 in the genome. It should be understood that a previous version of this NCBI sequence (NM_001039726.1) exists, namely… Figure 5SEQ ID No. 8. For this sequence: the start codon begins at position 87, which corresponds to position 39115293 on UMD 3.1; exon 1, as disclosed by NCBI, begins at 39115245; the stop codon begins at position 1830 in the mRNA sequence, which is located at position 39136922 in the genome construct UMD 3.1; the base deletion identified by the inventors of this application is located at position 1468 in the mRNA sequence, which corresponds to position 39136559 in the genome.

[0308] It will be understood that the precise location of the genetic markers of the present invention can vary slightly between genomes; for example, the location of the markers may differ in different species or breeds of animals. Similarly, the precise location of any amino acid variation in the PRLR protein can vary slightly between proteomes; for example, the location of the change may differ in different species or breeds of animals. However, those skilled in the art will be able to readily identify specific markers in different genomes and / or PRLR proteins (including their isotypes, fragments, and precursors) via routine sequence alignment and when their presence in the PRLR gene / PRLR protein (including its isotypes, fragments, and precursors) is known. To illustrate this variation in the location of any particular genetic marker across genomes, the marker is described herein as "located at position X corresponding to chromosome 20 of a common cow," where X is the number of nucleotides or base pairs read relative to the chromosome 20 sequence in the UMD3.1 genome construct. Similarly, to describe any variation in the location of a specific amino acid variant across the proteome, an amino acid variant may be described in this paper as "located at the Y position corresponding to the PRLR (or the long form of the PRLR) of a normal cow," where Y is relative to the position of the variant described later in this paper. Figure 2 The number of amino acids read from the standard bovine PRLR sequence provided in the image.

[0309] Exemplary PRLR nucleic acid and amino acid sequence information for animals other than common cattle can be found in the NCBI database. However, the following database accession numbers are given as examples:

[0310] Pig (wild boar (581)) NC_010458.3 (complete nucleotide sequence) and NM_001001868.1 (protein sequence);

[0311] Chicken (Raw Junglefowl) NC_006127.3 (complete nucleotide sequence) and NP_990185.1 (protein sequence);

[0312] Sheep (domestic sheep) NC_019473.1 (complete nucleotide sequence), O46561.1 (protein sequence); and

[0313] Goat (domestic goat) JF966783.1 (complete nucleotide sequence), AEJ76924.1 (protein sequence).

[0314] Table 3: Specific genetic markers identified

[0315]

[0316] While the inventors of this application have observed that the changes shown in Table 3 indicate that animals are likely to have increased heat tolerance, increased resistance to ticks, and / or a desired fur texture, they envision that any variation in the nucleotide sequence at this locus could indicate increased heat tolerance, increased resistance to ticks, and / or a desired fur texture. Furthermore, the inventors of this application envision that any variation in the nucleotide sequence of the PRLR gene that increases PRLR activity could indicate increased heat tolerance, increased resistance to ticks, and / or a desired fur texture. The invention should be interpreted accordingly. Such variations can include, for example, the addition of one or more nucleotides, the deletion of one or more nucleotides, the substitution of one or more nucleotides, or a combination of two or more of these.

[0317] In one embodiment, one or more alterations are located within a region defined by nucleotides corresponding to positions 39136469 and 39136649 on chromosome 20 of a normal cow. In other embodiments, one or more alterations are located within a region defined by nucleotides corresponding to positions 39136498 and 39136620, positions 39136528 and 39136590, or positions 39136543 and 39136575. In one embodiment, the one or more genetic alterations are located in the last exon of the PRLR gene; for example, within a region defined by nucleotides corresponding to positions 39136033 to 39136920 on chromosome 20 of a normal cow.

[0318] In one embodiment, one or more alterations cause the alanine at position 461 of the PRLR gene in ordinary cattle to be replaced by valine. In one embodiment, one or more genetic alterations cause the transcript or peptide expressed by the PRLR gene to be truncated. In one embodiment, one or more alterations cause the PRLR to be truncated to an amino acid position in a region that is approximately from amino acid position 430 to amino acid position 490 of the PRLR gene in ordinary cattle; truncated to an amino acid position in a region that is approximately from amino acid position 440 to amino acid position 480 of the PRLR gene in ordinary cattle; truncated to an amino acid position in a region that is approximately from amino acid position 450 to amino acid position 470 of the PRLR gene in ordinary cattle; or truncated to an amino acid position in a region that is approximately from amino acid position 455 to amino acid position 465 of the PRLR gene in ordinary cattle. In one embodiment, one or more changes are made such that the PRLR is truncated to position 461, corresponding to the amino acid position 461 of the PRLR in a normal bovine population. In one embodiment, one or more changes are made such that alanine at position 461 is replaced by valine and the PRLR is truncated to position 461, corresponding to the amino acid position 461 of the PRLR in a normal bovine population.

[0319] Similarly, while the inventors of this application have observed that amino acid variations in the PRLR described herein indicate a high likelihood of enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture in animals, they contemplate that any variation in the amino acid sequence at the same position could indicate enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. Furthermore, the inventors of this application contemplate that any variation in the amino acid sequence of the PRLR that enhances the activity of the PRLR could indicate enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. The invention should be interpreted accordingly. Such variations may include, for example, the addition of one or more amino acids, the deletion of one or more amino acids, the substitution of one or more amino acids, or a combination of two or more of these.

[0320] In some embodiments of the invention, one or more amino acid variations are located in the region of amino acid positions 430 to 490 corresponding to the PRLR of ordinary cattle; in the region of amino acid positions 440 to 480 corresponding to the PRLR of ordinary cattle; in the region of amino acid positions 450 to 470 corresponding to the PRLR of ordinary cattle; or in the region of amino acid positions 455 to 465 corresponding to the PRLR of ordinary cattle.

[0321] In one embodiment, one or more amino acid variations are the substitution of alanine for valine at position 461 of the PRLR in normal cattle. In a specific embodiment, one or more variations in the amino acid sequence are deletions that truncate the PRLR. In one embodiment, one or more variations truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 430 to amino acid position 490 of the PRLR in normal cattle; truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 440 to amino acid position 480 of the PRLR in normal cattle; truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 450 to amino acid position 470 of the PRLR in normal cattle; or truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 455 to amino acid position 465 of the PRLR in normal cattle. In one embodiment, one or more changes cause the PRLR to be truncated to amino acid position 461 corresponding to the PRLR of a normal cow. In one embodiment, one or more amino acid variations are the substitution of alanine at position 461 with valine and the PRLR being truncated to amino acid position 461 corresponding to the PRLR of a normal cow.

[0322] The inventors of this application noted that the specific changes mentioned in Table 3 are dominant in nature. They believe that other changes in the PRLR gene will also be dominant. Therefore, for example, in the case where an animal is heterozygous for the change, it would be inferred that it is very likely to have increased heat tolerance, increased resistance to ticks, and / or the desired fur texture. In view of this, the method of the present invention does not require determining the homozygosity or heterozygosity of the animal. However, in some embodiments, it may be desirable to determine whether the animal is homozygous. For example, in the case of selecting animals for breeding purposes or for inclusion in a herd, it may be beneficial to know whether the animal is homozygous, as this will help ensure that any offspring carry the desired genetic change.

[0323] Changes in nucleic acid sequence

[0324] In some embodiments, the method of the present invention includes analyzing nucleic acids (including one or more nucleic acids) from an animal to determine the presence or absence of one or more genetic alterations in the PRLR gene. Such one or more genetic alterations would indicate that one or more animals have, or are very likely to have, enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In one embodiment, the one or more genetic alterations result in increased PRLR activity.

[0325] It should be understood that one or more genetic alterations can be identified by observing the size of the PRLR gene or a portion or region thereof.

[0326] In one embodiment, one or more alterations are located within a region defined by nucleotides corresponding to positions 39136469 and 39136649 on chromosome 20 of a normal cow. In other embodiments, one or more alterations are located within a region defined by nucleotides corresponding to positions 39136498 and 39136620, positions 39136528 and 39136590, or positions 39136543 and 39136575. In one embodiment, the one or more genetic alterations are located in the last exon of the PRLR gene; for example, within a region defined by nucleotides corresponding to positions 39136033 to 39136920 on chromosome 20 of a normal cow.

[0327] In one implementation, for example, the method includes analyzing nucleic acids (including one or more nucleic acids) to determine nucleotides present at position 39136559 of chromosome 20 corresponding to a common cow.

[0328] Alternatively or otherwise, the method may include analyzing the nucleotide sequence of nucleic acids to determine the nucleotide sequence of one or more genetic markers that are in linkage disequilibrium with a genetic alteration in the PRLR gene, such as a genetic marker (genetic variation) at the aforementioned location.

[0329] In one specific embodiment, the method of the present invention may include analyzing the nucleotide sequence of a nucleic acid to determine, for example, a haplotype of an animal, one or more cells, or an embryo, wherein the haplotype includes the aforementioned genetic marker (genetic variation in the PRLR gene) and a combination of one or more genetic markers in linkage disequilibrium with it.

[0330] It should also be understood that the nucleic acid sequence of any strand of the nucleic acid can be analyzed to identify the sequence at a specific locus or location; for example, instead of analyzing the strand associated with the above sequence variants, the nucleotide sequence of the reverse or complementary strand of the DNA can be analyzed. Those skilled in the art will readily understand, in light of the information contained herein and the principles of nucleic acid base pairing (i.e., A pairs with T and C pairs with G), such nucleic acid sequence variations on the reverse strand associated with the above genotypes.

[0331] Nucleic acids can be analyzed using any appropriate technique to determine the genotype / sequence of genetic markers. Such techniques include, for example, polymerase chain reaction (PCR), including allele-specific PCR; gel electrophoresis; hybridization using oligonucleotide probes; DNA blotting; direct sequencing; restriction enzyme digestion; restriction fragment length polymorphism (RFLP); single-strand confirmatory polymorphism (SSCP); LCR (ligase chain reaction); denaturing gradient gel electrophoresis (DGGE); using allele-specific oligonucleotides (ASO); using proteins that recognize nucleic acid mismatches, such as the *E. coli* mutS protein; RNase protection assays; oligonucleotide array hybridization (e.g., microarrays); denaturing HPLC (dHPLC); and fluorescence quenching PCR (TaqMann). TM Applied Biosystems, CA 94404, USA; High-resolution melting (HRM); Matrix-assisted laser desorption / ionization time-of-flight mass spectrometry (MALDI-TOF MS); and qRT-PCR. Combinations of two or more of these techniques can be used. Such combinations can improve the sensitivity of the analyses performed.

[0332] In some implementations, single-cell analysis can be performed. In these cases, genome amplification and / or next-generation sequencing methods can be used. Those skilled in the art will readily understand suitable methods. However, for example, the method described in the following literature: Navin et al. (Nature, April 7, 2011; 472(7341):90-4. doi:10.1038 / nature09807. Electronic publication March 13, 2011). Tumor evolution inferred through single-cell sequencing can be used.

[0333] The one or more techniques used will depend on the nature of the marker to be detected, as will be known to those skilled in the art. For example, techniques capable of resolving single nucleotide differences between sequences can be used to analyze single nucleotide polymorphisms (SNPs); such as direct sequencing or LCR, allele-specific PCR, RFLP, SSCP, DGGE, using allele-specific oligonucleotides (ASO), or proteins that recognize nucleic acid mismatches, oligonucleotide array hybridization, dHPLC, fluorescence quenching PCR, and matrix MALDI-TOF MS.

[0334] Genetic markers that may include the insertion or deletion of one or more nucleotides can be analyzed using any one or more of the techniques mentioned above (including, for example, SSCP, RFLP, DGGE, dHPLC, and direct sequencing).

[0335] It should be understood that certain techniques used for analyzing genetic markers according to the present invention utilize one or more oligonucleotides that hybridize with a genetic region containing, adjacent to, or side-connected to the marker. Such oligonucleotides may be DNA, RNA, or derivatives thereof and include nucleic acid primers, such as PCR primers and LCR primers; and nucleic acid probes.

[0336] Those skilled in the art will readily understand suitable oligonucleotides for use in this invention, taking into account one or more of the following: the PRLR gene, chromosome 20, particularly the nucleic acid sequence in the genetic region adjacent to the genetic marker, the nature of the genetic marker to be analyzed, and the general principles of nucleic acid hybridization. The nucleic acids will be able to hybridize specifically to the target nucleic acid, and in the case of primers, they will be able to initiate a PCR or similar reaction. While such nucleic acids will preferably have 100% complementarity to their target region in the mRNA or cDNA of the protein of interest, they may contain one or more non-complementary nucleotides at specific locations while still substantially retaining the specificity to the target nucleic acid they are designed to bind. For example, the nucleic acid and its target may have about 80%, about 90%, about 95%, or about 99% complementarity or homology. Also, for example, in some cases, the oligonucleotides may be designed such that mismatches at specific nucleotide positions indicate the nature of the genetic marker being analyzed (e.g., SNPs). For example, a mismatch in the nucleotides present at the 3' end of an LCR primer will inhibit a reaction that provides an indication of the nature of the nucleotide at that position. Mismatches can be similarly used in techniques including RNase protection assays and allele-specific PCR, as well as in, for example, fluorescence quenching PCR. Typically, the nucleic acids will hybridize with their target nucleic acids under strict hybridization conditions (see, for example, Sambrook and Russell, *Molecular Cloning: A Laboratory Manual*, 2001, Cold Spring Harbor Laboratory Press, NY).

[0337] Oligonucleotide probes or primers can have any length suitable for a specific application, taking into account the sequence of the genetic region they are designed to bind to. Probes or primers will generally be able to form stable hybrids with the complementary sequence to which they are designed to hybridize. Therefore, the length depends on the nucleic acid composition and the percentage of homology between the oligonucleotide and its complementary sequence, as well as the hybridization conditions utilized (e.g., temperature and salt concentration). These hybridization factors are well known in the relevant art. For example, oligonucleotides used in this invention can have a length of 2 to 500 nucleotides. In one embodiment, specifically when used as primers, oligonucleotides can have a length of about 15 to 30 nucleotides.

[0338] Non-limiting examples of oligonucleotides used in this invention include CCTATTTTTCTGGCCAATGGA (SEQ ID No. 1), CAGCCCAACTGGAGTCTGC (SEQ ID No. 2), and / or one or more functionally equivalent variants thereof. In one embodiment, these oligonucleotides are used as forward and reverse primers in the method of this invention utilizing PCR.

[0339] In one specific implementation, oligonucleotides CCTATTTTTCTGGCCAATGGA (SEQ ID No. 1) and CAGCCCAACTGGAGTCTGC (SEQ ID No. 2) and / or one or more functionally equivalent variants thereof are used as forward and reverse primers to detect genetic alterations at position 39136559 of chromosome 20 in ordinary cattle according to the method of the present invention.

[0340] The oligonucleotide probes and primers used in this invention can be prepared by many conventional DNA synthesis methods, including recombinant techniques and chemical synthesis, or they can be commercially available. It will be understood that the usefulness of any probe or primer can be evaluated, at least theoretically, using appropriate software and sequence information about the nucleic acids encoding the protein of interest. For example, software packages such as Primer3 (http: / / primer3.sourceforge.net / ), PC Oligo5 (National Bioscience Inc.), Amplify (University of Wisconsin), and the PrimerSelect program (DNAStar) can be used to design and evaluate primers.

[0341] When using amplification techniques (e.g., PCR) in the methods of this invention, amplification can be performed according to conventional procedures in the relevant art of the invention, such as those described in U.S. Patent No. 4,683,202. For example, a PCR reaction typically includes 0.1 μM–1 μM of each primer, 200 μM of each dNTP, 3 mM–7 mM of MgCl2, and 1 U of Taq DNA polymerase. Furthermore, exemplary PCR cycling conditions include: denaturation at approximately 94°C for 30 to 60 seconds, annealing at a temperature calculated based on the primer sequence and length (as discussed herein) for 30 to 60 seconds, and extension at approximately 70°C to 72°C for 30 to 60 seconds. For example, 25 to 45 cycles are run.

[0342] Those skilled in the art will understand that any amplification conditions provided herein are merely exemplary and can be varied to optimize conditions, such as using alternative PCR cyclers or DNA polymerases; where the quality of the template DNA differs; or variations in primers not specifically exemplified herein are used, without departing from the scope of the invention. PCR conditions can be altered or optimized, for example, by changing the concentrations of various components within the reaction and / or changing the composition of the reaction, changing the number of amplification cycles, denaturation, annealing, or extension times or temperatures, or the amount of template DNA. Those skilled in the art will understand that many other ways exist to optimize PCR conditions to overcome variability between reactions.

[0343] It should be understood that, although no specific examples are given herein, the appropriate annealing temperature for any primer within the scope of this invention can be derived from the calculated melting temperature of that primer. Such a melting temperature can be calculated using a standard formula, such as that described in Sambrook and Russell, 2001. As will be appreciated by those skilled in the art, the annealing temperature can be higher or lower than the melting temperature, but generally, an annealing temperature approximately 5°C lower than the calculated melting temperature of the primer is suitable.

[0344] Oligonucleotides used for detecting and / or analyzing genetic markers according to the present invention can be modified to facilitate such detection. Similarly, nucleic acid products obtained using techniques such as PCR can be modified to facilitate detection and / or analysis. For example, nucleic acid molecules can be labeled using techniques standard in the art to facilitate visual identification. For example, P... 32 Nucleic acids can be radiolabeled, as may be described in Sambrook and Russell, 2001. Furthermore, nucleic acids can be appropriately labeled for use in colorimetric, fluorescent, or chemiluminescent procedures.

[0345] It will be understood that the method of the present invention may use one or more control samples. These control samples may be positive or negative controls for a specific genetic marker. The type of control sample used may vary depending on factors such as the nature of the genetic marker being analyzed and the specific techniques used for such detection and analysis. Positive controls may include, for example, samples having a known nucleic acid sequence or a known size. Negative controls may include samples in the absence of nucleic acids. Generally, for example, in the analysis of SNPs, positive control samples may include nucleic acids known to have a specific nucleotide at the relevant position. In one embodiment, the method may utilize control samples having sequences that are unrelated to or related to enhanced heat resistance, enhanced resistance to ticks, and / or desired fur texture. In another embodiment, the method may utilize control samples having sequences related to enhanced heat resistance, enhanced resistance to ticks, and / or desired fur texture.

[0346] The method of this embodiment of the invention may include comparing the sequence of the nucleic acid being tested with one or more reference sequences, as previously described herein.

[0347] The method of the present invention may include obtaining samples from the animal to be tested (as described previously herein). In this embodiment of the invention, the samples are analyzed using techniques that allow observation or analysis of nucleic acids (including sequences of specific nucleic acids).

[0348] To facilitate the detection of the genetic markers according to the invention, the sample can be processed prior to analysis. For example, the sample can be processed to isolate nucleic acids from the sample to be analyzed or to amplify the specific genetic region to be analyzed.

[0349] In one embodiment, nucleic acids are isolated or extracted from the sample prior to analysis. In another embodiment, genomic DNA is isolated or extracted from the sample. In an alternative embodiment, mRNA may be isolated or extracted from the sample. In this case, reverse transcription techniques known in the art can be used to convert the mRNA into cDNA. Techniques for isolating nucleic acids from a sample will be readily understood by those skilled in the art. For example, methods for isolating nucleic acids are described in Sambrook and Russell, 2001.

[0350] In an alternative embodiment of this invention, nucleic acids can be analyzed in situ, thus avoiding the need to extract nucleic acids from the sample. This can be done using, for example, PCR. Those skilled in the art will readily recognize suitable techniques and methods for this purpose (see, for example, Sambrook and Russell, 2001).

[0351] The method of the present invention can be combined with one or more other methods for assessing genotypes, predicting phenotypes, selecting animals, cells, or embryos based on certain characteristics, estimating breeding values, or estimating economic value. Therefore, in addition to analyzing the genetic markers identified herein, the method of the present invention may also include, for example, analyzing other genetic markers, and / or the expression levels of certain genes / proteins, and / or one or more phenotypic traits.

[0352] Nucleic acid

[0353] The present invention also provides nucleic acids carrying the genetic markers of the present invention. For example, isolated nucleic acids containing the PRLR gene, wherein a region containing the genetic markers as described herein exists, are covered by the present invention.

[0354] This invention also covers nucleic acids that can hybridize with regions of the PRLR gene containing one or more genetic markers of this invention, preferably under stringent conditions (as previously described herein). Such nucleic acids can be used as primers or otherwise for analyzing the genetic markers of this invention, as previously described herein.

[0355] The nucleic acid of the present invention can have 100% sequence identity, homology, or complementarity with the relevant region of the PRLR gene, but it can also have some sequence variation. For example, the nucleic acid of the present invention can have about 80%, about 90%, about 95%, or about 99% sequence identity, homology, or complementarity.

[0356] The nucleic acids of the present invention can have any suitable length. In one embodiment, they have a length of at least 4 nucleotides, or a length of at least 10, 20, 30, 40, 50, 60, 70, 80 or more nucleotides.

[0357] In one embodiment, the present invention provides a nucleic acid comprising (or in one embodiment, consisting of the following nucleotide sequence) the nucleotide sequence GACCAAACAGACCAACATG(C)delTTTAAAAGCCTCAAAAACCA, wherein (C)del indicates that C is not present at that position (i.e., GACCAAACAGACCAACATGTTTAAAAGCCTCAAAAACCA, SEQ ID No. 3).

[0358] In other embodiments, the nucleic acid of the present invention comprises (or in one embodiment, consists of the following nucleotide sequence) the nucleotide sequence CCTATTTTTCTGGCCAATGGA (SEQ ID No. 1), CAGCCCAACTGGAGTCTGC (SEQ ID No. 2), or a nucleotide sequence as a functionally equivalent variant thereof. Such nucleic acid can be used as a primer in the methods of the present invention involving PCR.

[0359] In other embodiments, the present invention provides one or more cDNAs comprising the genetic alterations described herein or encoding PRLR, its subtypes, fragments, or precursors (including those containing one or more variations in the amino acid sequence).

[0360] Variations in amino acid sequences

[0361] In other embodiments, the method of the present invention includes analyzing one or more of the PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof from the animal to determine whether it includes one or more variations in the amino acid sequence. Such one or more variations in the amino acid sequence would indicate that one or more animals have, or are very likely to have, enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In one embodiment, the one or more variations result in increased activity of the PRLR. Variations in the amino acid sequence can be the addition of one or more amino acids, the deletion of one or more amino acids, the substitution of one or more amino acids, or a combination of two or more of these. In a specific embodiment, the variation in the amino acid sequence is the deletion of one or more amino acids. In one embodiment, the one or more variations are amino acid substitutions. In one embodiment, the amino acid sequence of the PRLR is truncated. In some embodiments, one or more variations in the amino acid sequence are as described previously herein.

[0362] It should be understood that one or more variations in the amino acid sequence can be identified by observing the size of PRLR, one or more of its precursors, one or more of its isotypes, and / or one or more of its fragments.

[0363] In some embodiments of the invention, the one or more amino acid variations are located in the region of amino acid positions 430 to 490 corresponding to the PRLR of ordinary cattle; in the region of amino acid positions 440 to 480 corresponding to the PRLR of ordinary cattle; in the region of amino acid positions 450 to 470 corresponding to the PRLR of ordinary cattle; or in the region of amino acid positions 455 to 465 corresponding to the PRLR of ordinary cattle.

[0364] In one embodiment, one or more amino acid variations are the substitution of alanine for valine at position 461 of the PRLR in normal cattle. In a specific embodiment, one or more variations in the amino acid sequence are deletions that truncate the PRLR. In one embodiment, one or more variations truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 430 to amino acid position 490 of the PRLR in normal cattle; truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 440 to amino acid position 480 of the PRLR in normal cattle; truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 450 to amino acid position 470 of the PRLR in normal cattle; or truncate the PRLR to an amino acid position in a region that is approximately from amino acid position 455 to amino acid position 465 of the PRLR in normal cattle. In one embodiment, one or more modifications cause the PRLR to be truncated to amino acid position 461 corresponding to the PRLR of a normal bovine animal. In one embodiment, one or more amino acid variations involve replacing alanine at position 461 with valine and truncating the PRLR to amino acid position 461 corresponding to the PRLR of a normal bovine animal. In one embodiment, the method of the present invention may include, for example, testing for the presence or absence of C-terminal valine.

[0365] The method of the present invention may include observing or measuring the size of a protein, one or more of its precursors, one or more of its isoforms, and / or one or more fragments thereof, in relation to the biomarker comprising the addition and / or deletion of one or more amino acids, i.e., the size of a protein (including references to one or more precursors, one or more isoforms, and / or one or more fragments thereof). In one specific embodiment, the presence of a PRLR having a length of 430 amino acids or less, a length of 430 to 490 amino acids, a length of 440 to 480 amino acids, a length of 450 to 470 amino acids, or a length of 455 to 465 amino acids infers that an animal, cell, or embryo carries a biomarker associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. In one specific embodiment, the presence of a PRLR having a length of 461 amino acids or less infers that an animal, cell, or embryo carries a biomarker associated with enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0366] Standard techniques known in the art can be used to analyze PRLRs, their isotypes, their precursors, and / or fragments thereof. However, peptide sequencing, mass spectrometry, Western blotting, and ELISA can be used, for example.

[0367] The method may use one or more control samples, such as positive and / or negative controls for specific amino acid sequence variations. The types of control samples used may vary depending on factors such as the type of variation being analyzed and the specific techniques used for detection and analysis. Positive controls may include, for example, samples having a known amino acid sequence or a known size. Negative controls may include samples without the presence of peptides. In one embodiment, the method may utilize control samples having sequences that are unrelated to or related to enhanced heat resistance, enhanced resistance to ticks, and / or desired fur texture. In another embodiment, the method may utilize control samples having sequences related to enhanced heat resistance, enhanced resistance to ticks, and / or desired fur texture.

[0368] The method of this embodiment of the invention may include comparing the sequence of the peptide or protein being tested with one or more reference sequences, as previously described herein.

[0369] The method of the present invention may include obtaining a sample from an animal to be tested. To facilitate the analysis of the peptides according to the invention, the sample may be treated according to any of a number of known methods prior to analysis. For example, the sample may be treated to remove one or more high-abundance proteins that may make analysis of PRLRs, their isotypes, fragments, or precursors difficult. Exemplary techniques that may be used to treat samples prior to analysis of PRLRs, their isotypes, fragments, or precursors are described elsewhere herein.

[0370] Proteins or peptides

[0371] The present invention also provides peptides and proteins carrying the biomarkers of the present invention. For example, isolated peptides or proteins comprising PRLR in which regions containing the biomarkers as described above are covered by the present invention.

[0372] The peptides or proteins of the present invention can have any suitable length. In one embodiment, they have a length of at least 4 amino acids, or a length of at least 10, 20, 30, 40, 50, 60, 70, 80 or more amino acids.

[0373] In one embodiment, the present invention provides a peptide consisting of or containing the amino acid sequence SEQ ID No. 7 (or, in one embodiment, consisting of the above-described amino acid sequence).

[0374] Levels of PRLR, precursors, fragments and / or subtypes

[0375] In another embodiment, the method of the present invention includes observing the levels of PRLR (including references to any one or more subtypes of PRLR, any one or more precursors of PRLR, any one or more fragments of PRLR) and / or any one or more nucleic acids encoding one or more of the aforementioned substances.

[0376] As mentioned earlier herein, the inventors of this application envision that an increase in the level of PRLR (including references to one or more of its subtypes, precursors, or fragments) and / or the nucleic acid encoding it (e.g., an increase in expression level) infers that the animal will most likely possess increased heat tolerance, increased resistance to ticks, and / or a desired fur texture. Therefore, the inventors of this application envision that any increase in said levels can be considered as inferring increased heat tolerance (and / or increased resistance to ticks and / or a desired fur texture) in said animal and / or its offspring. Similarly, a decrease or substantially no increase in said levels (e.g., expression levels) compared to a standard can also infer decreased or substantially no increased heat tolerance, substantially no increased resistance to ticks, and / or an undesirable fur texture in said animal and / or its offspring.

[0377] In some embodiments of the invention, the method may obtain samples from animals; observe the level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) or the nucleic acid encoding it (in one embodiment, the expression level); and compare the levels relative to one or more standards. Any differences in the levels observed in the samples and between the samples and the standards infer whether the animal is likely to have increased heat tolerance, increased resistance to ticks, and / or a desired fur texture.

[0378] In one embodiment, the criterion represents the level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) and / or the nucleic acid encoding it, said level being associated with the level of one or more animals having significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture. In another embodiment, the criterion represents the level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) and / or the nucleic acid encoding it, said level being associated with the level of one or more animals having enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0379] In one implementation, if the level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) or the nucleic acid encoding it is higher than a standard (e.g., having levels associated with one or more animals having significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture), it is inferred that the animal will most likely have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In one implementation, if the level of PRLR (including references to one or more subtypes, precursors, or fragments thereof) or the nucleic acid encoding it is substantially similar, substantially the same, or lower, it is inferred that the animal will most likely have reduced or significantly limited or substantially no enhanced heat tolerance, substantially no enhanced resistance to ticks, and / or an undesirable fur texture.

[0380] In one implementation, when the standard represents a level relating to PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) and / or the nucleic acid encoding it to an animal (or animals) having enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, and the tested animal has a level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) or the nucleic acid encoding it that is substantially similar to, substantially the same as, or higher than the standard, it is inferred that the animal is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. When the tested animal has a level below the standard, it can be inferred that the animal is likely to have reduced or significantly limited or substantially no enhanced heat tolerance, substantially no enhanced resistance to ticks, and / or an undesirable fur texture.

[0381] PRLR (including references to one or more precursors, fragments, and / or isotypes) and the nucleic acid encoding them can be detected and their levels compared to standards using any or a combination of techniques for identifying, quantifying, and / or highlighting differential levels or expression of one or more proteins. Such techniques will be readily understood by those skilled in the art related to this invention. However, for example, the levels of PRLR (including references to one or more precursors, fragments, and / or isotypes) can be measured using: protein purification methods; immunological techniques; protein separation based on characteristics such as molecular weight and isoelectric point, including gel electrophoresis (e.g., PAGE) and microfluidic techniques, such as in gel-free protein separation techniques; and mass spectrometry (MS) utilizing isoweight-labeled MS, such as iTRAQ, or label-free methods, such as multiple reaction monitoring (MRM).

[0382] Appropriate immunological techniques include enzyme-linked immunosorbent assay (ELISA) (sandwich ELISA, double-sandwich ELISA, direct ELISA, microparticle ELISA), radioimmunoassay (RIA), immunoprecipitation, Western blotting, immunohistochemical staining, antibody arrays, or agglutination assays. Protocols for performing such techniques are readily available; see, for example, “Antibodies a Laboratory Manual,” Cold Spring Harbor Laboratory Press (1988).

[0383] Antibodies used in such immunological techniques can be commercially available or produced according to standard methods in the art, taking into account the properties of the protein being tested. For example, polyclonal and monoclonal antibodies can be produced using one or more of the protein or fragments thereof as antigens, according to the procedures described in the textbook "Antibodies a Laboratory Manual" (Cold Spring Harbor Laboratory Press, 1988). Preferably, monoclonal antibodies are used.

[0384] Nucleic acid-based techniques for determining nucleic acid levels (e.g., cDNA levels) may include differential display procedures, RNA blotting, competitive PCR, quantitative reverse transcriptase polymerase chain reaction (qRT-PCR), microarray analysis, and RNA sequencing. Those skilled in the art will readily understand the methods used to perform these techniques.

[0385] Nucleic acids, such as oligonucleotide probes and primers, used to detect (e.g., using RNA blotting or competitive PCR) the expression level of the protein according to the invention will be readily understood by those skilled in the art in light of the information contained herein and any publicly available amino acid and / or nucleic acid sequence information relating to PRLR. The nucleic acids will be able to hybridize in a specific manner to PRLR-associated mRNA or cDNA, and in the case of primers, they will be able to initiate PCR or a similar reaction.

[0386] The mass spectrometry techniques used in this invention are described, for example, in “Proteins and proteomics - A laboratory manual” (RJ Simpson, Cold Spring Harbour Laboratory Press (2002)).

[0387] Standard techniques can be used to compare the levels of PRLRs (including references to one or more fragments, precursors, and / or subtypes) or the nucleic acids encoding them in a sample relative to a standard, taking into account the methods used to detect the protein or nucleic acid. For example, colorimetric and fluorescence assays can be used, in which the detection molecule (such as an antibody or nucleic acid probe or primer) is labeled with a molecular tag that can be observed by the naked eye or otherwise detected using, for example, a spectrophotometer or fluorometer. Alternatively, the detection molecule can be labeled with a radioactive isotope. In the case of PCR amplification, it is also envisioned that the tag be incorporated into the nucleic acid during said PCR amplification (rather than labeling the detection molecule such as a probe or primer).

[0388] Methods for labeling molecules and subsequently measuring the resulting signal intensity are known to those skilled in the art.

[0389] It should be understood that, in addition to analyzing samples and standards, the method of the present invention may also include testing one or more positive control samples or negative control samples to ensure the integrity of the results. For example, it may include samples that do not contain proteins / nucleic acids and one or more samples that contain known levels of proteins / nucleic acids to allow for calibration of results between different runs of the method.

[0390] Samples obtained from animals may be treated to facilitate the analysis of the protein or nucleic acid prior to analysis of the PRLR (including references to one or more isotypes, precursors, and / or fragments) and / or the nucleic acids encoding them. Those skilled in the art will readily understand the appropriate processing steps and techniques suitable for performing them.

[0391] In one embodiment, high-abundance proteins that may make analysis difficult, such as detecting and / or measuring the level of PRLR (including references to one or more isotypes, precursors, and / or fragments), can be removed from the sample. For example, the Top6 or Top7 depletion method can be used. The sample can also be subjected to proteolytic digestion. Therefore, detection of the protein or isotype according to the invention should be considered to include detection of any one or more fragments thereof. The fragment should have a length sufficient to ensure specificity for PRLR. Such a fragment will, for example, have a length of at least 8 amino acids, more preferably at least 10, 15, or 20 amino acids.

[0392] Processing steps for preparing samples to analyze nucleic acids encoding PRLR (including references to one or more isotypes, precursors, and / or fragments) may include lysing cells; isolating mRNA; and generating cDNA using standard procedures such as reverse transcription-PCR, as known in the relevant art of the invention. In one embodiment, mRNA can be observed in situ.

[0393] Those skilled in the art will readily understand that samples can be processed for use in other ways in this invention.

[0394] PRLR, precursor, fragment and / or isoform activity

[0395] In another embodiment, the method of the present invention may include observing the activity level of PRLR (including references to one or more precursors, subtypes and / or fragments thereof).

[0396] As mentioned earlier, the inventors of this application envision that an increased activity level of PRLR (including references to one or more subtypes, precursors, or fragments thereof) presumes that the animal will most likely possess increased heat tolerance, increased resistance to ticks, and / or a desired fur texture. Therefore, the inventors of this application envision that any increase in the activity level can be considered as presuming increased heat tolerance, increased resistance to ticks, and / or a desired fur texture in the animal and / or its offspring. Similarly, a decrease or substantially no increase in the activity level compared to a standard can also presumably presume that the animal and / or its offspring possess decreased or substantially no increased heat tolerance, substantially no increased resistance to ticks, and / or an undesirable fur texture.

[0397] In some embodiments of the invention, the method may include obtaining a sample from an animal; observing the activity level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof); and comparing the activity level relative to one or more standards. The activity level observed in the sample and any differences between the sample and the standards infer whether the animal is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0398] In one embodiment, the criterion represents the activity level of PRLR (including references to one or more of its subtypes, precursors, and / or fragments) associated with the level of one or more animals exhibiting significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture. In another embodiment, the criterion represents the activity level of PRLR (including references to one or more of its subtypes, precursors, and / or fragments) associated with the level of one or more animals exhibiting enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture.

[0399] In one embodiment, a higher level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) compared to a standard (e.g., a level associated with one or more animals having significantly limited heat tolerance, significantly limited resistance to ticks, and / or an undesirable fur texture) suggests that the animal is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture. In another embodiment, if the activity levels of PRLR (including references to one or more subtypes, precursors, or fragments thereof) are substantially similar, substantially the same, or lower, it suggests that the animal is likely to have reduced or significantly limited or substantially no enhanced heat tolerance, substantially no enhanced resistance to ticks, and / or an undesirable fur texture.

[0400] In one implementation, when the standard represents an activity level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) that is associated with improved heat tolerance, improved resistance to ticks, and / or desired fur texture in one or more animals, and the tested animal has an activity level of PRLR (including references to one or more subtypes, precursors, and / or fragments thereof) that is substantially similar, substantially the same, or higher than the standard, it is inferred that the animal will most likely have improved heat tolerance, improved resistance to ticks, and / or desired fur texture. When the tested animal has a level below the standard, it can be inferred that the animal will most likely have reduced or significantly limited or substantially no improved heat tolerance, substantially no improved resistance to ticks, and / or undesirable fur texture.

[0401] The activity level of PRLR can be measured using standard methods known in the art, taking into account the function of PRLR. For example, the methods used may involve one or more of the following techniques: immunoprecipitation, Western blotting, ELISA, mass spectrometry, surface plasmon resonance, isothermal titration calorimetry, luciferase assay, and reporter gene assay. In one embodiment, PRLR activity can be measured by measuring one or more events downstream of PRLR signal transduction, such as the phosphorylation of one or more molecules. In a specific embodiment, a method comprising immunoprecipitation with a PRLR antibody followed by Western blotting or ELISA can be used to measure tyrosine phosphorylation of JAK2 (Janus kinase 2) and / or other phosphorylated molecules downstream of PRLR signal transduction. Also, by way of example, the method described in Perot-Applanat et al., 1997, Mol Endo 11(8) can be used.

[0402] Standard techniques can be used to compare the activity levels of PRLRs (including references to one or more fragments, precursors, and / or subtypes) in a sample, and any differences therein, relative to a standard, taking into account the methods used to detect activity. For example, colorimetric and fluorescence assays can be used, in which the detection molecule (such as an antibody or nucleic acid probe or primer) is labeled with a molecular tag that can be observed by the naked eye or otherwise detected using, for example, a spectrophotometer or fluorometer. Alternatively, the detection molecule can be labeled with a radioactive isotope. However, for example, the method described in Perrot-Applanat et al., 1997 Mol Endo 11(8) can be used.

[0403] It should be understood that, in addition to analyzing samples and standards, the method of the present invention may also include testing one or more positive or negative control samples to ensure the integrity of the results. For example, it may include samples that do not contain protein and one or more samples that contain protein with known activity levels to allow for calibration of results between different runs of the method.

[0404] Samples can be processed prior to analyzing PRLR activity (including references to one or more isotypes, precursors, and / or fragments). Those skilled in the art will readily understand the appropriate processing steps and techniques suitable for performing them.

[0405] In one implementation, high-abundance proteins that may make analysis difficult, such as detecting and / or measuring the activity levels of PRLRs (including references to one or more isoforms, precursors, and / or fragments), can be removed from the sample. For example, Top6 or Top7 depletion methods can be used. Immunoprecipitation of the protein of interest can also be used, as another example.

[0406] Processing steps for preparing samples to analyze PRLR (including references to one or more isoforms, precursors, and / or fragments) activity may include, for example, cell lysis, immunoprecipitation, and cell membrane preparation. Other useful techniques will be readily apparent to those skilled in the art.

[0407] Those skilled in the art will readily understand that samples can be processed for use in other ways in this invention.

[0408] Breeding and cloning

[0409] As previously mentioned herein, this invention provides methods for breeding animals. Various methods of this invention (such as those for determining whether an animal is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, and methods for selecting animals (e.g., including selecting their gametes)) can be used to identify animals (or, for example, gametes) for use in breeding methods. Such methods may include identifying at least one first animal (using one or more methods as described herein) that has or is presumed to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and mating said animal with a second animal. In one embodiment, the method may further include identifying at least one second animal that has or is presumed to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and mating said at least one second animal with said at least one first animal. For example, the method may include selecting a first animal (and optionally a second animal) identified as having one or more biomarkers as described herein. In a preferred embodiment, the mating will produce one or more offspring.

[0410] This invention also covers breeding methods comprising: 1) selecting a first gamete and / or a second gamete and fusing the first gamete with the second gamete to form a zygote; 2) selecting an embryo. This invention also provides a method for cloning an animal, the method comprising selecting one or more cells using the methods of this invention. One or more methods of this invention (such as those for selecting or excluding one or more cells or embryos) can be used to identify and select suitable gametes and embryos for these breeding methods. For example, methods in these embodiments of the invention may include selecting gametes, embryos, or cells identified as having one or more biomarkers as described herein.

[0411] In the breeding method of the present invention, any suitable method can be used to mate animals, including natural insemination, artificial insemination, or IVF. In these cases, a single gamete can be selected for use in the process. Such gametes can be selected using the method of the present invention; for example, the method of the present invention can be used to identify animals that are presumed to have increased heat tolerance, increased resistance to ticks, and / or desired fur texture, and gametes from those animals can be selected for use in a breeding program or process, or gametes can be tested according to the present invention and then selected for use in a breeding program or process. In one specific embodiment, a method for selecting or excluding one or more animals (e.g., according to the second, tenth, eighteenth, or twenty-sixth aspects of the invention described above) can be used to select a first animal and / or a second animal and use their gametes in IVF. In another embodiment, a method for selecting or excluding one or more cells (according to the fifth, thirteenth, twenty-first, or twenty-ninth aspects of the invention) can be used to select a first gamete and / or a second gamete and use the selected gamete for IVF. After selecting male and female gametes, the female gamete is fertilized in vitro. At the appropriate time, one or more embryos are transferred into a pregnancy carrier.

[0412] In one embodiment, female gametes can be in vitro fertilized, and then the method of the present invention can be used to determine whether the embryos have the desired genotype / phenotype and whether they should be selected or excluded for further use in a breeding program. This can be done without testing individual gametes, or the animals that produce or derive them, prior to fertilization to determine whether they are likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture (therefore, the present invention should be considered to include breeding methods in which the first and / or second animals and / or gametes are not selected based on such tests, but the resulting embryos or offspring are tested and selected). Alternatively, the method of the present invention can be used for quality control purposes or to double-check that the resulting embryos have the same desired genotype / phenotype, provided that individual gametes or the animals that produce or derive them have already been tested and selected based on having the desired genotype / phenotype.

[0413] Optionally, after mating the animals, one or more methods of the present invention can be used to determine whether any offspring possess, or can be inferred to possess, the desired characteristics related to PRLR as described above. Such testing can be performed at any time during the offspring's life, including before birth; by way of example only, testing can be performed on the embryo, fetus, amniotic fluid, placenta, maternal blood, or at birth.

[0414] In certain circumstances, cloning can be used to produce animals. In these circumstances, the method may include identifying at least one first animal (using one or more methods as described herein) that has, or is presumed to have, enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture; and using the nucleus or chromatin of one or more cells from that animal in the cloning procedure (e.g., somatic cell nuclear transfer, chromatin transfer techniques, and embryo splitting). These cloning methods are described, for example, in *Bovine somatic cell nuclear transfer*, Ross PJ and Cibelli, JB 2010. *Methods in Molecular Biology*, 636:155-177. At a relevant time during the cloning procedure, one or more embryos are transferred into a gestation carrier.

[0415] In some embodiments, the cloning process may utilize cells derived from a cell line and the methods of the present invention may be used to select such cells or cell lines capable of producing animals that are likely to have enhanced heat resistance, enhanced resistance to ticks, and / or a desired fur texture. In one embodiment, the cell line may be an embryonic cell line.

[0416] One or more cells for cloning can be selected using the methods of the present invention. After the selection of one or more cells, a cloning procedure can be performed. For example, the methods of the present invention can be used to identify animals that are presumed to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture, and to select cells from those animals for use in the cloning process. Similarly, the methods of the present invention can be used to identify cells from cell lines that contain one or more genetic alterations as described herein and can be used to produce animals that are presumably to have enhanced heat tolerance, enhanced resistance to ticks, and / or a desired fur texture. Such objectives can be achieved using the methods of the fifth, tenth, fifteenth, and / or twentieth aspects of the present invention. The methods of the present invention can also be used to identify animals whose cells can be used to produce cell lines for cloning purposes.

[0417] In one specific embodiment, the animals for cloning can be selected using methods of selecting or excluding one or more animals (e.g., according to the second, tenth, eighteenth, or twenty-sixth aspects of the invention described above). In another embodiment, one or more cells can be selected for cloning using methods of selecting or excluding one or more cells (according to the fifth, thirteenth, twenty-first, or twenty-ninth aspects of the invention).

[0418] Optionally, at various stages during the cloning process, one or more methods of the present invention can be used to determine whether any cloned animal possesses, or can be inferred to possess, the desired characteristics related to PRLR as described above. Such testing can be performed at any time during the life of the cloned animal. By way of example only, testing is performed on the blastocyst, embryo, fetus, amniotic fluid, placenta, maternal blood, and at birth.

[0419] Furthermore, the cloning method of the present invention may include selecting desired cells in the absence of testing for the presence or absence of biomarkers related to improved heat resistance and / or desired fur texture on those cells or the animals or cell lines from which they are produced. The cloning procedure may be initiated, and then the method of the present invention may be used to determine whether the embryo, fetus, or animal produced by the cloning procedure possesses the relevant biomarkers according to the present invention and, if the embryo, fetus, or animal has the desired genotype / phenotype, to select the embryo, fetus, or animal.

[0420] The breeding and cloning methods of the present invention may include any of a number of standard growth and / or pregnancy methods for, for example, one or more cells, zygotes, embryos and / or fetuses.

[0421] Forming a herd

[0422] The present invention also provides a method for forming an animal herd. Such a method may include, for example, determining whether an animal carries biomarkers related to enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, according to the thirty-sixth or thirty-eighth aspect of the invention described herein; determining whether an animal (and / or its offspring) is likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or desired fur texture, according to the first, ninth, seventeenth, and / or twenty-fifth aspects of the invention described herein; selecting or excluding animals according to the second, tenth, eighteenth, and / or twenty-sixth aspects of the invention described herein; and / or estimating the value of an animal according to the third, eleventh, nineteenth, and / or twenty-seventh aspects of the invention described herein. In some embodiments, the method of the present invention, including the selection or exclusion of one or more cells, may also be used to select one or more animals for inclusion in a herd. Animals may be selected or excluded for inclusion in a herd based on the results of one or more of the methods described above. In some embodiments, an animal may be selected for inclusion in a herd if it is identified as possessing one or more biomarkers according to the invention or is presumed to be likely to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture and / or the desired "value". An animal may be excluded and not selected for inclusion in a herd if it is identified as not possessing one or more biomarkers according to the invention or is presumed to be likely not to have enhanced heat tolerance, enhanced resistance to ticks, and / or the desired fur texture, or is presumed to have significantly limited heat tolerance and / or an undesirable fur texture and / or the desired "value".

[0423] In some embodiments, animals homozygous for one or more biomarkers according to the invention are selected for inclusion in the herd, although this may not be preferred.

[0424] Therefore, in some embodiments, the method of this aspect of the invention includes testing one or more animals or cells using methods according to any one or more of the first, second, third, fifth, ninth, tenth, eleventh, thirteenth, seventeenth, eighteenth, nineteenth, twenty-first, twenty-fifth, twenty-sixth, twenty-seventh and / or twenty-ninth aspects of the invention; selecting animals having a desired genotype / phenotype or inferred to have one or more desired characteristics or values; and forming a herd with the selected animals.

[0425] This invention should also be considered to include a herd formed by the methods described herein.

[0426] Animal herds can be formed for any desired reason. However, by way of example only, herds may be formed for: beef farming; dairy production; meat production; egg production; and / or the production of fur, hair, wool, pelts, or feathers.

[0427] Gene editing methods

[0428] As previously noted, the inventors of this application have identified that alterations in the PRLR gene are associated with desired fur texture and heat resistance, and also allow for the production of animals with such desired phenotypes using cloning and / or gene editing methods, in which one or more genetic alterations are introduced into the PRLR gene. For example, one or more specific alterations can be introduced into one or more cells that can be used to produce animals. Therefore, the present invention provides one or more cells in which one or more specific alterations have been introduced according to the present invention.

[0429] The genetic alteration introduced into the PRLR gene can be of any nature, including the insertion of one or more nucleotides, the deletion of one or more nucleotides, and / or the substitution of one or more nucleotides. In one embodiment, the one or more genetic alterations are alterations that enhance PRLR activity. In one embodiment, the one or more genetic alterations include a genetic alteration corresponding to position 39136559 on chromosome 20 of a normal cow. In one embodiment, the one or more genetic alterations include a deletion of C at position 39136559 on chromosome 20 of a normal cow. In other embodiments, the one or more genetic alterations are as described previously herein.

[0430] In one embodiment, the one or more cells used to generate an animal include, for example, a single gamete, a zygote, an embryo, a somatic cell, or a cell derived from a cell line. In one embodiment, when using IVF, one or more genetic alterations may be introduced into, for example, one or more gametes or zygotes. In one embodiment, when using cloning, one or more genetic alterations may be introduced into, for example, one or more somatic cells or cells derived from a cell line.

[0431] Such methods may also include testing or screening one or more cells, embryos, or animals after the gene editing step to ensure that they include the desired genetic changes and that it can be inferred that animals produced by the method will likely have increased heat tolerance, increased resistance to ticks, and / or the desired fur texture.

[0432] One or more genetic alterations can be introduced into the PRLR gene using any of the many standard methods according to the present invention. However, for example, TALEN or CRISPR methods can be used. In the case of CRISPR, the embryonic genome can be directly modified by injecting Cas9 mRNA and sgRNA into the fertilized egg, thereby, for example, enabling the efficient generation of animals carrying biallelic mutations in a given gene. Such techniques are described in, for example, the following literature: "Precision Editing of Large Animal Genomes", Wenfang (Spring) Tan, Daniel F. Carlson, Mark W. Walton, Scott C. Fahrenkrug, and Perry B. Hackett, Adv Genet. 2012; 80:37-97. doi:10.1016 / B978-0-12-404742-6.00002-8; and "One-Step Generation of Mice Carrying Mutations in Multiple Genes by CRISPR / Cas-Mediated Genome Engineering", Haoyi Wang, Hui Yang, Chikdu S. Shivalila, Meelad M. Dawlaty, Albert W. Cheng, Feng Zhang, and Rudolf Jaenisch.Cell. May 9, 2013; 153(4):910-918.doi:10.1016 / j.cell.2013.04.025.

[0433] In one implementation, the breeding method may involve IVF. In this embodiment, the individual male and female gametes may first be selected based on genetic advantages or other factors; gene editing methods may be applied to one or both gametes to introduce at least one desired change into the PRLR gene; and the female gamete may be fertilized in vitro. Alternatively, a single male and female gamete may be selected, the female gamete may be fertilized in vitro, and then gene editing methods may be applied to the fertilized zygote to introduce at least one desired change into the PRLR gene. It should be understood that one or more other changes may also be introduced into the genome of the gamete or zygote. At the appropriate time, one or more embryos may be transferred into a gestation vector.

[0434] The method of this embodiment may optionally include performing the methods of the invention as described above to determine whether any cells or animals have the desired changes and whether it can be inferred that the animal will be more likely to have increased heat tolerance, increased resistance to ticks, and / or the desired fur texture. Such testing can be performed at any time during the process and during the life of any animal. For example, testing is performed on blastocysts, embryos, fetuses, amniotic fluid, placenta, maternal blood, and at birth. In one embodiment, the embryo is tested prior to transfer to a pregnancy carrier. In another embodiment, the animal is tested at birth.

[0435] In one implementation, gene editing is combined with cloning. In this embodiment, animals for cloning may first be selected based on their genetic advantages or other factors. Gene editing methods can be applied to cells from said animal to introduce at least one desired alteration into the PRLR gene. The nucleus from such cells can then be used in known cloning methods, such as chromatin transfer, somatic cell nuclear transfer, and embryo splitting. It should be understood that one or more other alterations may also be introduced into the genome if necessary. At the appropriate time, one or more embryos may be implanted into a carrier female animal for pregnancy.

[0436] The method of this embodiment may optionally include performing the methods of the invention as described above to determine whether any cloned cells or animals possess the desired alterations and whether it can be inferred that the animal will be more likely to have increased heat tolerance, increased resistance to ticks, and / or the desired fur texture. Such testing can be performed at any time during the process and during the life of any animal. For example, embryos, fetuses, amniotic fluid, placenta, maternal blood, and at birth are tested. In one embodiment, the embryo is tested prior to transplantation into a pregnancy carrier. In another embodiment, the animal is tested at birth.

[0437] Reagent test kit

[0438] The present invention also relates to a reagent kit used in the method of the present invention.

[0439] In one embodiment, the kit includes at least one or more reagents suitable for analyzing one or more genetic markers according to the present invention. Reagents suitable for analyzing one or more of the markers include one or more nucleic acid probes and / or primers as described herein.

[0440] In another embodiment, the kit includes at least one or more reagents suitable for detecting the level or activity of PRLR, one or more of its precursors, one or more of its subtypes, one or more of its fragments, and / or one or more nucleic acids encoding one or more of them.

[0441] For example, when using an immunological procedure, the kit may include one or more antibodies specific to PRLR (including references to one or more precursors, subtypes, and / or fragments thereof). In one specific embodiment, an ELISA is used and the kit includes one or more capture antibodies and / or detection antibodies against PRLR (including references to one or more precursors, subtypes, and / or fragments thereof).

[0442] As another example, in cases where the method of the present invention includes detecting the level of one or more nucleic acids encoding one or more of PRLR, one or more precursors thereof, one or more subtypes and / or one or more fragments, it may include one or more nucleic acid probes and / or primers that are specific to one or more target nucleic acids.

[0443] The kit may also include one or more standards and / or other controls, which include one or more nucleic acids with a known sequence or genotype at a specific location, or containing a known amount of PRLR, one or more of its precursors, one or more of its subtypes, and / or one or more fragments thereof and / or one or more nucleic acids encoding them. Furthermore, the kit of the present invention may also include instructions for using the components of the kit and printed charts, etc., that can be used as standards for comparison with results obtained from test samples. The reagents can be contained in any suitable container.

[0444] Example

[0445] Example 1

[0446] Semen from Senapong bulls was obtained from Genetic Enterprises Ltd, 21 Grace Ave., Leamington, Cambridge, New Zealand. Genomic DNA was extracted from the semen using a standard phenol / chloroform extraction procedure. DNA fragments encoding the prolactin receptor were amplified using a variety of primer pairs (including those provided in Table 1) and a KAPA2G robust PCR system (KAPA Biosystems). PCR was performed using buffer A (containing 1.5 mM magnesium chloride) and 25 ng of genomic DNA in 50 μL of reactants, following the manufacturer's instructions. PCR cycles (30 cycles per run) were performed according to the manufacturer's instructions, which included a temperature gradient from 55°C to 68°C for the annealing step. Extension was performed at 72°C for 60 seconds. PCR products were evaluated using a 1% agarose / TBE gel. Using Sanger sequencing (Centre for Genomics, Proteomics and Metabolomics, The University of Auckland), PCR reactants containing sufficient and clean products were sequenced using the same primers used for PCR amplification.

[0447] Table 1:

[0448]

[0449] In analyzing the obtained sequence data, the inventors of this application have identified a previously unobserved genetic alteration in the PRLR gene that appears to be unique to Senap cattle.

[0450] This change is 39136559delC (located in the last exon of the gene); Table 2. The location of the change was read relative to its position on chromosome 20 (gi|258513347|ref|AC_000177.1|) of the common bovine construct UMD3.1 in the Genebank database (http: / / www.ncbi.nlm.nih.gov / ), as detailed previously herein. The inventors of this application have also located the location of the change in the long PRLR gene (Table 2).

[0451] Using RNA sequencing performed on mammary tissue, the inventors of this application empirically determined the structure of the bovine prolactin receptor transcript. This transcript contains an additional 120 kb upstream 5' UTR exon, similar to that seen in transcript XM_05221577.1 (gene ID: 281422). The experimentally obtained transcript also has a much larger 3' UTR, approximately 10 kb in length. The inventors of this application used this updated annotation to design PCR primers and amplicons representing all PRLR exons, the 5 kb promoter sequence, and the 3' UTR.

[0452] Table 2:

[0453]

[0454] 39136559delC was identified as a frameshift mutation in the last exon of the PRLR and was therefore predicted to have a major functional effect on the long-form activity of the prolactin receptor. These data suggest that this frameshift mutation may be (or at least) a contributing mutation to the heat tolerance and smooth coat of Senap cattle; while not wishing to be bound by any specific theory, the inventors of this application envision that this may be achieved through enhanced activation of the prolactin signaling pathway.

[0455] Figure 1 and Figure 2 The diagram illustrates the nucleotide sequence (SEQ ID No. 4) and amino acid sequence (SEQ ID No. 5) of the long form of the bovine prolactin receptor (PRLR) (NM_001039726.2), indicating the position of 39136559delC. The identified base deletion (C) is located at position 1466 (arrow) in the mRNA sequence and at genomic position 39136559. The nucleotide sequence of the gene containing the deleted C at this position is provided. Figure 3 In (SEQ ID No. 6), the frameshift caused encodes valine, which in turn causes a stop codon that truncates the protein. Figure 2 The observed frameshift mutations will be detected by removing the highlighted sequence (). Figure 2 This shortens the protein from 581 amino acids to 461 amino acids; and changes the new carboxyl-terminal amino acid from alanine to valine. The truncated protein sequence is shown below. Figure 4 (SEQ ID no. 7). The long form of PRLR is important for many aspects of prolactin function.

[0456] The short PRLR reference sequence NM_174155.2 yielded a PRLR variant with 296 amino acids, meaning that the single-base deletion variants identified by the inventors of this application could not possibly affect the amino acid sequence of this isoform. However, the inventors of this application believe that deletions may also affect the function of the short isoform because the aforementioned variant is still present in the 3'UTR of this transcript.

[0457] The results obtained are related to a mutation previously identified by the inventors of this application in the prolactin (PRL) gene, which is associated with reduced heat tolerance and a 'fluffy' coat phenotype. Therefore, the inventors of this application believe that the alteration in the PRLR gene is the cause of the short, smooth coat and increased heat tolerance or heat resistance of Senap cattle compared to other breeds. This is the first confirmed direct link between the alteration in the PRLR gene and these phenotypes in Senap cattle. Previously, there was some uncertainty regarding the genes involved in the short, smooth coat and increased heat tolerance of these cattle, and various other genes have been proposed to be associated with these phenotypes.

[0458] Example 2

[0459] The Romanshe breed of cattle has also been reported to have a "smooth" phenotype.

[0460] Ear-punched samples were obtained from five Costa Rican Romanian cattle for PRLR genotyping. The ear-punched samples were sent to GeneSeek (Lincoln, Nebraska, USA) for DNA extraction, and the chr20:39136559delC PRLR variant was genotyped using Sequenom iPLEX (Sequenom) to target alleles in both forward and reverse strand orientations.

[0461] The inventors of this application identified the chr20:39136559delC frameshift mutation in two “smooth” phenotype animals of the Romansie breed. Both animals were heterozygous for the deletion (genotype C.Del).

[0462] These data confirm that the frameshift mutations associated with heat resistance and smooth fur identified by the inventors of this application have been identified in non-Sennape cattle.

[0463] Example 3

[0464] The inventors of this application targeted 28 crossbred cattle of Senapian descent, including Red Angus and / or Tuli descent, for PRLR genotyping. The cattle's coat was qualitatively assessed as either smooth or normal.

[0465] Hair samples were sent to GeneSeek (Lincoln, Nebraska, USA) for DNA extraction and genotyping of the chr20:39136559delC PRLR variant using Sequenom iPLEX (Sequenom Corporation) to target alleles in both forward and reverse strand orientations.

[0466] Table 3 shows the genotypic and phenotypic information for 28 hybrid animals of Senapian lineage. All animals qualitatively classified as having smooth fur showed complete segregation with a frameshift deletion at chr20:39136559delC. Except for a single homozygous animal (genotype Del.Del), these animals were heterozygous for the deletion (genotype C.Del). The seven animals not carrying the mutation (genotype CC) were qualitatively classified as having “normal fur.”

[0467] Table 3:

[0468]

[0469]

[0470] In PLINK1 (version 1.07, Purcell, S. http: / / pngu.mgh.harvard.edu / purcell / plink), analysis of these data using a dominant genetic model showed a highly significant correlation between frameshift loss and fur type (P<0.00000012).

[0471] These data confirm the strong correlation between frameshift mutations identified by the inventors of this application and heat resistance and smooth fur. While not wishing to be bound by any specific theory, the inventors of this application hypothesize that this may be achieved through enhanced activation of the prolactin signaling pathway.

[0472] This data supports the inventors' findings that alterations in the PRLR gene are the cause of short, smooth coats and increased heat tolerance or heat resistance. These traits are commonly found in Senap cattle. The data also confirms a direct link between alterations in the PRLR gene and these phenotypes.

[0473] Example 4

[0474] Exome sequencing was performed on 115 animals representing the following breeds: Holstein Friesian (N=10), Jersey (N=10), Angus (N=9), Belgian Blue (N=29), Brahman (N=10), Charolais (N=10), Nelore (N=10), Senap (N=9), Simmental (N=10), and Yak (N=8).

[0475] Customized capture of targeted RefSeq, Ensembl, and human paralogous genes was performed using the SureSelect Target Enrichment System (Agilent Technologies), followed by 101 bp paired-end sequencing on a HiSeq2000. The average sequencing depth between exon targeted sequences was 25×-40× per sample.

[0476] When the analysis was limited to the 1 Mbp common interval reported in independent analyses of Senap cattle and Senap hybrids, and filtered to non-reference variants present in all Senap cattle but not in other breeds, only a frameshift missing at chr20:39136559delC was obtained.

[0477] These results confirm that the frameshift deletion identified by the inventors of this application in the reported 'smooth' common region of chromosome 20 exists in the 'smooth' phenotype of Senap cattle, but not in animals observed to lack the 'smooth' phenotype.

[0478] These data further confirm the strong correlation between frameshift mutations identified by the inventors of this application and heat resistance and smooth fur. While not wishing to be bound by any specific theory, the inventors of this application hypothesize that this may be achieved through enhanced activation of the prolactin signaling pathway.

[0479] This data further supports the inventors' findings that alterations in the PRLR gene are the cause of short, smooth coats and increased heat tolerance or heat resistance. These traits are commonly found in Senap cattle. The data also further confirms the direct link between alterations in the PRLR gene and these phenotypes.

[0480] Example 5

[0481] Animals produced using gene editing

[0482] An embryo is produced by fertilizing an egg cell from a desired (usually a female with a high genetic advantage in production performance traits) in vitro with sperm from a desired male animal.

[0483] For the target species in livestock, one or more genetic alterations in the PRLR gene are identified, such as those that enhance PRLR activity. In one embodiment, mutations are identified that would truncate the protein produced by the long form of the PRLR gene to 461 amino acids in cattle or to an equivalent amino acid position in the target species. These mutations may consist of single-base deletions or additions, such as in the Senap cattle 'smooth' mutation, or may be more complex, producing a stop codon at the desired position in the PRLR gene. The one or more genetic alterations can be identified by referring to prior information or knowledge (such as known genetic alterations) or by analyzing one or more animals to identify previously unknown desired genetic alterations.

[0484] In cases where one or more appropriate genetic variations in the PRLR gene have been identified, gene editing tools (such as those described in Wang et al., 2013 and Wenfang et al., 2013) will be used to introduce one or more desired base changes into the PRLR gene in the zygote.

[0485] After gene editing has been performed, embryos can be grown in vitro to obtain cells and verify that the editing is correct. The selected embryos are then implanted into the uterus of a recipient cow to carry them until full term.

[0486] This procedure is particularly effective in producing males with high genetic advantages, which can be used for extensive insemination to introduce heat-resistant traits into one or more herds of cattle, pigs, sheep, goats, or chickens.

[0487] Example 6

[0488] Animals produced through cloning

[0489] Cloning techniques (as described by Brophy et al., 2003. Nature Biotechnology 21, 157-162) can be used to introduce one or more desired genetic alterations into animals. Simply put, this would involve introducing one or more desired mutations into a cell line in vitro and transferring the nucleus into an enucleated oocyte.

[0490] As in Example 2, embryos can be grown in vitro to enable biopsies and testing of the embryos to allow selection of those carrying the desired genotype.

[0491] The invention has been described herein with reference to certain preferred embodiments to enable the reader to practice the invention without excessive experimentation. However, those skilled in the art will readily recognize that many components and parameters can be modified or altered to some extent, or substituted with known equivalents, without departing from the scope of the invention. It should be understood that these modifications and equivalents are incorporated herein as if they were described separately. The invention also includes all steps, features, compositions, and compounds individually or collectively mentioned or indicated in this specification, as well as any and all combinations of any two or more of said steps or features. Furthermore, titles, headings, etc., are provided to facilitate the reader's understanding of this document and should not be construed as limiting the scope of the invention.

[0492] The full disclosure of all applications, patents, and publications (if any) cited above and below is incorporated herein by reference. However, any reference to any application, patent, or publication in this specification is not and should not be construed as an admission or representation in any way that they constitute valid prior art or are part of common general knowledge in any country of the world.

[0493] Throughout this specification and any of the appended claims, unless the context otherwise requires, the words “comprise”, “comprising”, etc., shall be construed as inclusive rather than exclusive, that is, as meaning “including but not limited to”.

Claims

1. A method for determining whether a Bos animal and / or its offspring is likely to have increased tolerance to heat and / or a desirable coat texture, the method comprising: a. analyzing the nucleic acid of a Bos animal or a gamete, cell or embryo derived from the Bos animal to determine whether it includes a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or a desirable coat texture, and b. determining from the nucleic acid under analysis that the Bos animal or its offspring is likely to have increased tolerance to heat and / or a desirable coat texture based on the presence of the genetic variation and / or a genetic marker in linkage disequilibrium therewith.

2. A method for selecting or excluding a Bos animal or a gamete, cell or embryo derived from a Bos animal that is likely to have increased tolerance to heat and / or a desirable coat texture, the method comprising: a. performing the method of claim 1 ; and b. selecting or excluding a Bos animal or a gamete, cell or embryo derived from a Bos animal that has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith.

3. A method for estimating the value of a Bos animal and / or its offspring, the method comprising: a. performing the method of claim 1 ; and b. calculating the estimated value of the Bos animal using the results of step (a).

4. A method for breeding a Bos animal, the method comprising: a. performing the method of claim 1 ; and b. selecting a first Bos animal that has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or a desirable coat texture; and c. mating the first Bos animal with a second Bos animal to produce one or more offspring. The second Bos animal has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or a desirable coat texture.

6. A method for breeding a Bos animal, the method comprising: a. performing the method of claim 1 ; and 5. The method of claim 4, wherein, b. selecting a first gamete from a first Bos animal that has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or a desirable coat texture; and c. fusing the first gamete with a second gamete from a second Bos animal to form a zygote. ​ ​ ​ ​ 7. The method of claim 6, wherein, the second gamete has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or desirable coat texture.

8. A method of breeding a Bos animal, the method comprising: a. performing the method of claim 1 ; and b. selecting an embryo of a Bos animal that has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or desirable coat texture.

9. A method of cloning a Bos animal, the method comprising: a. performing the method of claim 1 ; and b. selecting a cell from a Bos animal that has a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 and / or a genetic marker in linkage disequilibrium therewith that is associated with increased tolerance to heat and / or desirable coat texture; and c. cloning the Bos animal using the cell selected in step (b).

10. The method of claim 1, wherein, The genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 results in increased PRLR activity.

11. The method of any one of claims 1-10, wherein the animal is a Bos taurus.

12. A method for determining whether a Bos animal and / or its offspring is likely to have increased tolerance to heat and / or desirable coat texture, the method comprising: a. analyzing the genomic and / or proteomic composition of a Bos animal or a gamete, cell or embryo derived from a Bos animal to determine whether it comprises: (i) a measured level of nucleic acid encoding a prolactin receptor (PRLR) or a precursor, isoform or fragment thereof that is at least 20% higher than that of an animal or animals that do not have increased tolerance to heat and / or desirable coat texture; (ii) a measured level of prolactin receptor (PRLR) activity that is at least 20% higher than that of an animal or animals that do not have increased tolerance to heat and / or desirable coat texture; or (iii) a variation in the amino acid composition of a prolactin receptor (PRLR) protein or a precursor, isoform or fragment of a PRLR protein; wherein each of (i), (ii) and (iii) is due to a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20 that is associated with increased tolerance to heat and / or desirable coat texture; and b. determining from the genetic or proteomic material under analysis that the Bos animal and / or its offspring is likely to have increased tolerance to heat and / or desirable coat texture in the presence of the elevated level of PRLR nucleic acid, elevated PRLR activity and / or variation in the amino acid composition of a PRLR protein.

13. The method of claim 12, wherein the animal is a Bos taurus.

14. The method of claim 12, wherein, The variation in the amino acid composition of the PRLR protein or precursor, isoform or fragment thereof includes a variation that results in truncation of PRLR to a position corresponding to amino acid position 461 of Bos taurus PRLR.

15. The method of claim 12, which is implemented for: a. selecting a Bos animal; b. estimating the value of a Bos animal; c. breeding a Bos animal; and / or d. cloning a Bos animal.

16. A method for producing one or more cells or embryos capable of producing a Bos animal that is likely to have increased tolerance to heat and / or a desirable coat texture, the method comprising at least the step of introducing into one or more Bos animal cells or embryos a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20, the genetic variation being associated with increased tolerance to heat and / or a desirable coat texture.

17. A method of producing a bovine animal that is likely to have increased heat tolerance and / or a desirable coat texture, the method comprising: producing a Bos animal with one or more Bos animal cells or embryos into which has been introduced a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20, wherein the genetic variation is associated with increased tolerance to heat and / or a desirable coat texture.

18. A method of producing a bovine animal that is likely to have increased heat tolerance and / or a desirable coat texture, the method comprising at least the step of introducing into one or more bovine animal cells or embryos a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20, and generating the bovine animal from the one or more cells or embryos, wherein, The genetic variation is associated with increased tolerance to heat and / or a desirable coat texture.

19. The method of any one of claims 16-18, wherein the animal is Bos taurus.

20. A cell that can be used in a method for producing a Bos animal that is likely to have increased tolerance to heat and / or a desirable coat texture, the cell having introduced therein a genetic variation corresponding to a C deletion at position 39136559 on Bos taurus chromosome 20, the genetic variation being associated with increased tolerance to heat and / or a desirable coat texture.

21. The cell of claim 20, wherein the animal is Bos taurus.

22. The method of any one of claims 16-18, comprising the step of selecting or excluding one or more Bos animals, cells or embryos using the method of claim 1 or 12.

23. A method of forming a herd of Bos animals, the method comprising at least the steps of: a. performing the method of claim 1 or 12; b. selecting or excluding a Bos animal based on the results of step a.; and c. forming a herd of the selected Bos animals.

24. The method of claim 23, wherein the animal is Bos taurus.

25. An isolated peptide consisting of the sequence of SEQ ID No. 7.

Citation Information

Patent Citations

  • Process for amplifying nucleic acid sequences

    US4683202A