MiR-124 nasal in situ gel spray and methods of making the same

By preparing a nasal in-situ gel spray containing miR-124 lipid nanoparticles, poloxamer 407, poloxamer 188, and sodium alginate, the problem of low efficiency in nasal-brain drug delivery of nasal sprays was solved, achieving efficient intracerebral delivery of miR-124 and improving the treatment effect of Alzheimer's disease.

CN121197058BActive Publication Date: 2026-05-29JINAN UNIVERSITY
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
JINAN UNIVERSITY
Filing Date
2025-10-28
Publication Date
2026-05-29

AI Technical Summary

Technical Problem

Existing nasal sprays have low efficiency in naso-brain drug delivery, mainly due to low deposition efficiency in the nasal olfactory region and short nasal adhesion retention time, which makes it difficult for miR-124 drugs to effectively cross the blood-brain barrier and meet the treatment needs of Alzheimer's disease.

Method used

A nasal in-situ gel spray containing miR-124 lipid nanoparticles, poloxamer 407, poloxamer 188, and sodium alginate is formed by mixing the excipients with miR-124 lipid nanoparticles in a specific ratio to create a temperature-ion dual-response nasal in-situ gel precursor spray solution. This solution has a small spray area and suitable droplet size, which can deposit and adhere in the olfactory region, resisting mucus and cilia clearance.

Benefits of technology

It improved the deposition and retention time of miR-124 in the olfactory region of the nasal cavity, enhanced the efficiency of naso-brain drug delivery, achieved efficient intracerebral delivery of miR-124, and improved the therapeutic effect on Alzheimer's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure FT_1
    Figure FT_1
  • Figure FT_2
    Figure FT_2
  • Figure FT_3
    Figure FT_3
Patent Text Reader

Abstract

The present application relates to a kind of miR-124 nasal cavity in-situ gel spray and its preparation method.The miR-124 nasal cavity in-situ gel spray thereof is aqueous solution containing miR-124 lipid nanoparticle, poloxamer 407, poloxamer 188 and sodium alginate;The concentration of poloxamer 407 in the miR-124 nasal cavity in-situ gel spray is 145mg / mL-155mg / mL;The concentration of poloxamer 188 in the miR-124 nasal cavity in-situ gel spray is 9.5mg / mL-10.5mg / mL;The concentration of sodium alginate in the miR-124 nasal cavity in-situ gel spray is 1mg / mL-5mg / mL.The spray can effectively improve the olfactory area deposition of drug miR-124, extend the nasal cavity retention time of drug miR-124, improve the nasal-brain delivery efficiency of miR-124.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention belongs to the field of pharmaceutical formulation technology, and relates to nasal sprays, specifically to a nasal in-situ gel spray for delivering miR-124 and its preparation method. Background Technology

[0002] Alzheimer's disease (AD) is a degenerative disease of the central nervous system, primarily occurring in the elderly or pre-elderly. Its main characteristics include progressive cognitive impairment and behavioral disturbances. miR-124, the most abundant RNA in the brain (approximately 100 times higher than in other tissues), is significantly reduced in the brains of AD patients. Stereoscopic injection of miR-124 into the mouse brain can inhibit neuroinflammation and alleviate AD symptoms. Therefore, miR-124 shows great promise in AD treatment. However, the application of free miR-124 still faces significant limitations. miR-124 is easily degraded in vivo, has an extremely short half-life, and cannot cross cell membranes. Furthermore, miR-124 has extremely poor penetration efficiency across the blood-brain barrier (BBB). Existing intravenous delivery methods, such as naked miRNA and lipid-encapsulated RNA, have low efficiency in intrabrain delivery, leading to high systemic toxicity. Intracerebral injection is highly invasive, resulting in poor patient compliance.

[0003] Theoretically, preparing drugs as nasal delivery formulations can overcome the BBB limitation through the naso-brain pathway. This involves utilizing the unique anatomical and physiological connection between the nasal cavity and the brain, bypassing the BBB via the olfactory nerve and trigeminal nerve to directly deliver drugs to the cerebrospinal fluid and brain parenchyma. This offers a unique advantage in brain delivery and avoids the metabolic burden on the liver and kidneys caused by systemic circulation. Therefore, developing novel nasal sprays is of great significance for the treatment of central nervous system (CNS) diseases such as Alzheimer's disease.

[0004] However, despite the theoretical advantage of naso-brain drug delivery systems in highly efficient intracerebral drug delivery, extensive clinical data indicate that the cerebrospinal fluid / plasma concentration ratio of existing nasal drug delivery formulations is still less than 0.1, far below the expected performance in formulation design. The unique physiological structure of the nasal cavity makes naso-brain drug delivery extremely difficult; existing naso-brain drug delivery systems exhibit very low efficiency and rapid drug clearance rates, failing to meet clinical needs. The low efficiency of naso-brain drug delivery is mainly limited by two factors: low deposition efficiency in the olfactory region of the nasal cavity; and short drug adhesion and retention time in the nasal cavity, leading to rapid clearance.

[0005] 1. Low deposition efficiency in the olfactory region of the nasal cavity: The nasal cavity can be roughly divided into three regions: the vestibule, the respiratory region, and the olfactory region. The vestibule is located at the front of the nasal cavity, close to the nostril opening. This region has a small surface area and small cell structure, resulting in very limited drug absorption. The respiratory region covers the lateral walls of the nasal cavity and includes three protruding turbinates (inferior, middle, and superior). This region has the largest area and the most blood vessels, making it an excellent site for systemic drug absorption. However, naso-brain drug transport is mainly completed in the olfactory region, a narrow area located at the top of the superior nasal meatus covered by the olfactory nerve. Traditional nasal sprays have excessively large spray areas and plume angles, resulting in droplets that are mainly trapped in the respiratory region and difficult to diffuse into the depths of the nasal cavity to achieve effective deposition in the olfactory region.

[0006] 2. Short nasal retention time: Furthermore, the secretions produced by goblet cells and serosal cells in the nasal mucosa form a mucus mat on the ciliary surface, promoting ciliary movement. The rapid and continuous rhythmic beating of numerous cilia on the nasal mucosa, while clearing foreign objects from the nasal cavity, also significantly affects the retention time of drugs in the nasal cavity during nasal administration, thus impacting drug absorption on the mucosal surface. Therefore, the naso-brain drug delivery efficiency is unsatisfactory.

[0007] Therefore, it is necessary to develop novel nasal sprays to improve the nasal-brain delivery efficiency of miR-124 drugs and enhance the therapeutic effect on Alzheimer's disease. Summary of the Invention

[0008] Therefore, the purpose of this invention is to provide a miR-124 nasal spray to improve the naso-brain delivery efficiency of miR-124 drugs and improve the therapeutic effect on Alzheimer's disease.

[0009] To achieve the above objectives, the present invention includes the following technical solutions.

[0010] In a first aspect, the present invention provides a miR-124 nasal in-situ gel spray, which is an aqueous solution containing miR-124 lipid nanoparticles, poloxamer 407, poloxamer 188 and sodium alginate.

[0011] The concentration of poloxamer 407 in the miR-124 nasal in situ gel spray is 145 mg / mL-155 mg / mL;

[0012] The concentration of poloxamer 188 in the miR-124 nasal in situ gel spray is 9.5 mg / mL-10.5 mg / mL;

[0013] The concentration of sodium alginate in the miR-124 nasal in situ gel spray is 1 mg / mL-5 mg / mL.

[0014] Secondly, the present invention provides a method for preparing the miR-124 nasal in-situ gel spray, comprising the following steps:

[0015] Preparation of a suspension of miR-124 lipid nanoparticles;

[0016] The poloxamer 188, poloxamer 407 and sodium alginate were swollen in water to obtain a nasal in-situ gel precursor solution.

[0017] The miR-124 nasal in-situ gel spray is obtained by mixing the suspension of the miR-124 lipid nanoparticles with the nasal in-situ gel precursor solution.

[0018] The present invention has the following beneficial effects:

[0019] This invention utilizes specific amounts of poloxamer (P407), poloxamer 188 (P188), and sodium alginate as excipients, along with miR-124 lipid nanoparticles, to prepare a temperature- and ion-responsive nasal in-situ gel precursor spray solution (spray) with suitable viscosity. This nasal in-situ gel precursor spray solution has low viscosity at room temperature, enabling it to form an aerosol under the drive of a nasal spray device. Its spray area and plume angle are small, resulting in a suitable droplet size distribution, spray pattern, and spray morphology for olfactory deposition. This reduces collision deposition in the nasal vestibule, leading to deposition in the olfactory region. Then, under the dual response of temperature and ions, it rapidly undergoes a phase transition under the physiological environment of the nasal cavity to form a gel, achieving adhesion and retention on the olfactory mucosa, effectively resisting the clearance effects of mucus and cilia. This spray achieves precise olfactory deposition and nasal adhesion retention, which can effectively improve the olfactory deposition of drug miR-124, prolong the nasal retention time of drug miR-124, and greatly improve the naso-brain drug delivery efficiency of miR-124. Attached Figure Description

[0020] Figure 1 The image shows an agarose gel electrophoresis image of the miR-124 lipid nanoparticles prepared in Example 1.

[0021] Figure 2 Electron microscopy and particle size distribution of miR-124 lipid nanoparticles (LNP: miR-124 = 12) prepared in Example 1, where LNPs refer to blank lipid nanoparticles and m-LNPs refer to miR-124 lipid nanoparticles.

[0022] Figure 3 To investigate the effects of different thermosensitive gel materials on promoting the absorption of miR-124 through the nasal mucosa.

[0023] Figure 4 The delivery dose and viscosity of miR-124 nasal in situ gel spray.

[0024] Figure 5 The droplet size and percentage of each stage of the miR-124 nasal in-situ gel spray are shown.

[0025] Figure 6 The spray form and spray pattern of miR-124 nasal in situ gel spray.

[0026] Figure 7 Image of a 3D printed human nasal cavity model.

[0027] Figure 8 The nasal cavity deposition distribution and olfactory zone deposition fraction of miR-124 nasal in situ gel spray.

[0028] Figure 9 Results of experiments on the removal of toad mucus cilia from nasal cavity in situ gel.

[0029] Figure 10 The rheological properties of the nasal in-situ gel precursor spray solution.

[0030] Figure 11 To investigate the naso-brain transport process and drug delivery efficiency of nasal in situ gel spray. Detailed Implementation

[0031] To facilitate understanding of the present invention, a more complete description will be provided below. The present invention can be implemented in many different forms and is not limited to the embodiments described herein. Rather, these embodiments are provided to provide a thorough and complete understanding of the disclosure of the present invention.

[0032] Unless otherwise specified, experimental methods in the following examples are generally performed under standard conditions or as recommended by the manufacturer. All commonly used chemical reagents used in the examples are commercially available products.

[0033] Unless otherwise defined, all technical and scientific terms used in this invention have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. The terminology used in this specification is for the purpose of describing particular embodiments only and is not intended to limit the invention. The term "and / or" as used in this invention includes any and all combinations of one or more of the associated listed items.

[0034] Furthermore, as used herein, the term "or" is an inclusive "or" sign and is equivalent to the term "and / or" unless the context clearly specifies otherwise. The term "based on" is not exclusive and allows for basing on other factors not described unless the context clearly specifies otherwise. Additionally, throughout the specification, the meanings of "an," "a," and "the" include plural indicators. The meaning of "in" includes both "in" and "on."

[0035] In some embodiments of the present invention, therein is a miR-124 nasal in-situ gel spray, which is an aqueous solution containing miR-124 lipid nanoparticles, poloxamer 407, poloxamer 188 and sodium alginate.

[0036] The concentration of poloxamer 407 in the miR-124 nasal in situ gel spray is 145 mg / mL-155 mg / mL;

[0037] The concentration of poloxamer 188 in the miR-124 nasal in situ gel spray is 9.5 mg / mL-10.5 mg / mL;

[0038] The concentration of sodium alginate in the miR-124 nasal in situ gel spray is 1 mg / mL-5 mg / mL.

[0039] In some of these embodiments, the concentration of poloxamer 407 in the miR-124 nasal in situ gel spray is 148 mg / mL to 152 mg / mL.

[0040] In some embodiments, the concentration of poloxamer 188 in the miR-124 nasal in situ gel spray is 9.8 mg / mL to 10.2 mg / mL.

[0041] In some embodiments, the sodium alginate in the miR-124 nasal in-situ gel spray is at a concentration of 3 mg / mL to 4.2 mg / mL, preferably 3.8 mg to 4.2 mg / mL.

[0042] In some embodiments, the miR-124 nasal in situ gel spray contains miR-124 at a concentration of 10 μg / mL to 50 μg / mL, preferably 20 μg / mL to 30 μg / mL, and more preferably 23 μg / mL to 27 μg / mL.

[0043] In some of these embodiments, the miR-124 lipid nanoparticles are prepared from miR-124, phospholipids, and cholesterol.

[0044] In some of these embodiments, the phospholipid is at least one of (2,3-dioleoxypropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, and egg yolk lecithin.

[0045] In some embodiments, the mass ratio of miR-124 to the phospholipid is 1:2-16, preferably 1:8-16, more preferably 1:10-14, and even more preferably 1:12-13.

[0046] In some of these embodiments, the mass ratio of phospholipids to cholesterol is 2-6:1, preferably 3-5:1, and more preferably 4:1.

[0047] In some of these embodiments, the miR-124 lipid nanoparticles are prepared from miR-124, (2,3-dioleopropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, egg yolk lecithin, and cholesterol.

[0048] In some embodiments, the mass ratio of (2,3-dioleoxypropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, egg yolk lecithin, and cholesterol is preferably 1:0.5-1.5:1.5-2.5:0.5-1.5, and more preferably 1:0.8-1.2:1.8-2.2:0.8-1.2.

[0049] In some embodiments, the preparation method of the miR-124 lipid nanoparticles includes the following steps:

[0050] The phospholipids and cholesterol were dissolved in dichloromethane to obtain a lipid solution;

[0051] The lipid solution was vacuum dried to remove dichloromethane, then physiological saline was added, hydrated, and ultrasonically pulverized to obtain a lipid suspension.

[0052] The lipid suspension was diluted and mixed evenly with an aqueous solution of miR-124, and then incubated to obtain a suspension of miR-124 lipid nanoparticles.

[0053] In some of these embodiments, the total concentration of phospholipids in the lipid solution is 5 mg / mL to 7 mg / mL.

[0054] In some embodiments, the total concentration of phospholipids in the lipid suspension is 5 mg / mL to 7 mg / mL.

[0055] In some of these embodiments, the drying temperature is 15°C-30°C.

[0056] In some embodiments, the hydration conditions include: a temperature of 30°C-40°C, a rotation speed of 150 rpm-250 rpm, and a time of 0.8 h-1.5 h.

[0057] In some of these embodiments, the conditions for ultrasonic pulverization include: a power of 60 W-80 W and a time of 2 min-5 min.

[0058] In some embodiments, the lipid suspension is diluted and then mixed with an equal volume of an aqueous solution of miR-124. The concentration of miR-124 in the aqueous solution is 40 μg / mL to 200 μg / mL, preferably 80 μg / mL to 120 μg / mL, and more preferably 92 μg / mL to 108 μg / mL.

[0059] In some of these embodiments, the incubation temperature is 20°C-30°C and the incubation time is 15 min-25 min.

[0060] Some embodiments of the present invention also relate to a method for preparing the miR-124 nasal in-situ gel spray of the present invention, comprising the following steps:

[0061] Preparation of a suspension of miR-124 lipid nanoparticles;

[0062] The poloxamer 188, poloxamer 407 and sodium alginate were swollen in water to obtain a nasal in-situ gel precursor solution.

[0063] The miR-124 nasal in-situ gel spray is obtained by mixing the suspension of the miR-124 lipid nanoparticles with the nasal in-situ gel precursor solution.

[0064] In some of these embodiments, the swelling temperature is 0°C-8°C and the time is 40-56 hours.

[0065] The present invention will be further described in detail below with reference to specific embodiments.

[0066] The miR-124 sequence (5' to 3') used in the following examples is as follows, mouse source:

[0067] S: UAAGGCACGCGGUGAAUGCC

[0068] AS:CAUUCACCGCGUGCCUUAUU

[0069] Both miR-124 and cy5-labeled miR-124 were purchased from Gemma Gene.

[0070] Example 1: Preparation of miR-124 lipid nanoparticles (miR-124@LNPs)

[0071] 1. Preparation of blank lipid nanoparticles: LNPs were prepared by thin-film dispersion. A lipid solution with a total concentration of 6 mg / mL phospholipids (DOTAP, DOPE, EPC) was prepared by dissolving (2,3-dioleopropyl)trimethylammonium chloride (DOTAP), 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine (DOPE), egg yolk lecithin (ECP), and cholesterol (Cho) in 4 mL of dichloromethane at a mass ratio of 1:1:2:1. The solution was then dried in a vacuum drying oven (20 kPa absolute) at room temperature for 3 h to remove the dichloromethane. 4 mL of DEPC water was then added, and the solution was hydrated in a water bath (37℃, 200 rpm) for 1 h to obtain a milky white liquid. This liquid was then ultrasonically pulverized at 70 W for 3 min using an ultrasonic cell disruptor, and finally filtered three times through a 0.22 μm microporous membrane to obtain the blank LNPs suspension.

[0072] 2. Preparation of miR-124 lipid nanoparticles (miR-124@LNPs): Cationic liposomes loaded with miR-124 were prepared by electrostatic adsorption. miR-124 powder was centrifuged at 4 ℃ and 10000 rpm for 30 s to concentrate it at the bottom of an EP tube. An appropriate amount of DEPC water was added to dissolve it, preparing a miR-124 solution with a concentration of 100 μg / mL. LNPs suspensions were diluted with DEPC water to total phospholipid concentrations of 200 μg / mL, 400 μg / mL, 800 μg / mL, 1200 μg / mL, and 1600 μg / mL, respectively. Equal volumes of miR-124 solution were added to each, and the mixtures were thoroughly mixed. The mixtures were then incubated at room temperature for 20 min to obtain miR-124@LNPs suspensions with miR-124 concentration of 50 μg / mL and phospholipid concentrations of 100 μg / mL, 200 μg / mL, 400 μg / mL, 600 μg / mL, and 800 μg / mL, respectively.

[0073] 3. The miR-124 drug loading of the series of miR-124@LNPs was determined by agarose gel electrophoresis.

[0074] Experimental Methods: Gel Preparation: Accurately weigh 1% agarose powder and mix with 1×TAE buffer. Heat in a microwave oven until the agarose is completely melted, then cool. Once the temperature drops to 50℃, add 10 μL of Goldview dye to 30 mL of agarose solution and mix rapidly until homogeneous. Then, pour the solution into a gel casting plate, allow it to stand until solidified, and then place it in an electrophoresis tank for later use.

[0075] 10 μL of miR-124@LNP suspensions with different drug loading ratios (prepared in step 2) were mixed with 3 μL of loading buffer, loaded onto the sample, and electrophoresed at 140 V for 15 min. The samples were then observed and photographed using a gel imaging system. The specific experimental groups are as follows:

[0076] LNP:miR-124=0:miR-124 50 μg / mL;

[0077] LNP: miR-124=2: miR-124 50 μg / mL, phospholipid concentration 100 μg / mL;

[0078] LNP: miR-124=4: miR-124 50 μg / mL, phospholipid concentration 200 μg / mL;

[0079] LNP: miR-124=8: miR-124 50μg / mL, phospholipid concentration 400μg / mL;

[0080] LNP: miR-124=12: miR-124 50 μg / mL, phospholipid concentration 600 μg / mL;

[0081] LNP: miR-124=16: miR-124 50 μg / mL, phospholipid concentration 800 μg / mL.

[0082] Agarose gel electrophoresis results showed that ( Figure 1 When LNP:miR-124 = 12:1, miR-124 is completely encapsulated in liposomes.

[0083] 4. Particle size testing: Electron microscopy (TEM) results showed that the nanoparticles exhibited a spherical structure, and the particle size increased slightly after miR-124 encapsulation. Figure 2 Furthermore, the particle size of blank LNPs and miR-124@LNPs was measured using a Malvern particle size potentiometer. The results also showed that the particle size of miR-124@LNPs encapsulated with miR-124 was larger than that of blank LNPs. These results indicate that miR-124 was successfully encapsulated in nanoparticles. Figure 2 ).

[0084] Example 2: Preparation of miR-124 nasal in-situ gel spray

[0085] 1. Preparation of saturated precursor solution for nasal in situ gel: Accurately weighed 200 mg poloxamer 188 (P188), 3.0 g poloxamer 407 (P407) and 80 mg sodium alginate (Beijing Bailingwei Technology Co., Ltd., batch number: LD50Y112) were added to 10 mL of DEPC water and allowed to swell at 4℃ for 48 h to obtain a saturated precursor solution for nasal in situ gel, which was stored at 2~8℃.

[0086] 2. Preparation of miR-124 nasal in-situ gel spray: The miR-124-encapsulated nanoparticles (miR-124@LNPs suspension, LNP:miR-124=12:1) prepared in Example 1 were mixed with an equal volume of saturated nasal in-situ gel precursor solution to obtain miR-124 nasal in-situ gel precursor spray solution. This solution was then filled into a nasal spray device to obtain a nasal in-situ gel spray with a miR-124 concentration of 25 μg / mL that can achieve efficient intracerebral delivery of miR-124.

[0087] Example 3: Effect of different temperature-sensitive materials on miR-124 drug absorption

[0088] P407+P188, P407+hydroxypropyl methylcellulose (HPMC), P407+poloxam 181 (L61), and P407+chitosan (CS) were used as thermosensitive materials (the amount of P407 in each group was the same as in Example 2, and the amounts of P188, HPMC, L61, and CS were equal and the same as in Example 2). Other raw materials and amounts were the same as in Example 2. miR-124 nasal in-situ gel spray was prepared according to the method of Example 2 and was designated as miR-124 nasal in-situ gel spray in the P407+P188 group, P407+HPMC group, P407+L61 group, and P407+CS group, respectively.

[0089] This embodiment uses the Calu-3 cell model at the gas-liquid interface to investigate the promoting effect of different material combinations on drug absorption in the nasal mucosa. Calu-3 cells are derived from human lung adenocarcinoma epithelial cells. During culture, they differentiate into a polar monolayer membrane with tight structural connections and microvilli at the apex. The membrane expresses P protein, cystic fibrosis transmembrane transduction regulators, various ion channels, and certain amounts of hydrolases, transferases, and cytochromes, exhibiting mucus secretion function. The advantages of this cell model are: a mature, dense monolayer of cells, similar to normal epithelial cells, with different differentiation morphologies and functions on the apical (AP) and basal (BL) surfaces. This model allows for the study of drug uptake from the AP end, retention and metabolism within the cell, and drug release from the BL end; controllable experimental conditions and good data reproducibility; rapid and simple sample analysis; short experimental cycle and low cost. Currently, this cell line can be used for lung epithelial cell and nasal epithelial cell models. To observe the integrity of monolayer cell division and fusion within a suspended cell chamber, trans-membrane resistance (TEER) was used to evaluate the integrity and tightness of the tight junctions of the epithelial cell layers. TEER typically reaches its maximum between 10 and 14 days of cell culture. Literature reports that the maximum TEER ranges from 400 to 600 Ω·cm. 2 Calu-3 cells were cultured using an air-interface method, where the upper culture medium was removed one day after cell seeding, exposing the aspirin (AP) to air and creating an air interface. This resulted in a cell layer that morphologically resembled airway epithelial cells. The study concluded that air-interface culture was superior to liquid-intrusion culture, as the cell model cultured using the air-interface method more closely resembled human respiratory epithelial cells in terms of cell morphology, apparent permeability, and TEER.

[0090] The specific experimental procedure is as follows: Calu-3 cells in good growth condition were collected by trypsin digestion, centrifuged, and then the cells were counted using a hemocytometer and diluted to 8 × 10⁻⁶. 4 / mL. 500 μL of the diluted cell suspension was added to the AP side of a 12-well Transwell plate, and 1 mL of MEM medium containing 10% serum was added to the BL side. After two days of incubation, the AP side medium was discarded, and the BL side medium was replaced with fresh medium. The medium was then replaced every two days thereafter. The TEER value of each well was measured after day 14, with a mean of 543.75 ± 17.46 Ω·cm. 2This demonstrates that the monolayer cells are relatively intact and can be used for subsequent experiments. In the formal experiment, 100 μL of sample solution (i.e., the miR-124 nasal in-situ gel precursor spray solution prepared in this embodiment) was added to the AP side of each well. Then, at 0 min, 10 min, 20 min, 30 min, 60 min, and 120 min, 50 μL of solution was taken from the BL side to detect the miR-124 concentration and calculate the percentage of absorbed drug relative to the total drug. Each group was operated in parallel with 3 wells, and the experimental groups are as follows:

[0091] Control group: miR-124@LNPs suspension, diluted to contain 25 μg / mL miR-124;

[0092] P407+P188 group miR-124 nasal in situ gel precursor spray solution;

[0093] P407+HPMC group miR-124 nasal in situ gel precursor spray solution;

[0094] P407+L61 group miR-124 nasal in situ gel precursor spray solution;

[0095] P407+CS group miR-124 nasal in situ gel precursor spray solution.

[0096] The results are as follows Figure 3 As shown, the choice of thermosensitive material affects the absorption of miR-124. The combined use of P407 and P188 as thermosensitive materials promotes the absorption of miR-124 in the nasal in-situ gel spray, resulting in the highest miR-124 absorption rate, reaching 51.28% after 2 hours. Furthermore, the combination of P407 and P188 showed a stronger absorption-promoting effect than the combinations of P407 and hydroxypropyl methylcellulose, P407 and L61, and P407 and chitosan (with absorption percentages of 32.52%, 30.29%, and 23.77%, respectively).

[0097] Example 4: Effect of the ratio of P407 and P188 on the phase transition temperature of nasal in-situ gel spray

[0098] By changing the ratio of P407 and P188 (as shown in Table 1), and keeping the other raw materials and amounts the same as in Example 2, miR-124 nasal in situ gel precursor spray solutions with different formulations were prepared according to the method of Example 2.

[0099] The phase transition temperature of the nasal in-situ gel precursor spray solution prepared in this embodiment was tested using the inversion method: 2 mL of miR-124 nasal in-situ gel precursor spray solution was placed in a vial and placed in a water bath with ice. The temperature was increased at a rate of 1 °C / min, and the vial was inverted every 15 s until the gel stopped flowing when the vial was tilted. The temperature of the gel at this moment was measured with a thermometer, which is T1 sol-gel. Each sample was measured in parallel 3 times and the average value was taken.

[0100] The phase transition temperature test results of the miR-124 nasal in-situ gel precursor spray solutions of each formulation are shown in Table 1. The physiological temperature of the nasal cavity is between 32 and 34℃. The phase transition temperature (i.e., gel temperature) of the miR-124 nasal in-situ gel precursor spray solution prepared by formulation A2 is 32.67±0.47℃, which is more consistent with the physiological temperature of the nasal cavity. Therefore, it is preferred to prepare the miR-124 nasal in-situ gel precursor spray solution with 15% P407 and 1% P188.

[0101] Table 1. In-situ gel phase transition temperatures of different poloxamer formulations

[0102]

[0103] Note: The percentages in the table are weight-to-volume ratios, and the weight is in grams (g) and the volume is in milliliters (mL).

[0104] Example 5: Effect of different ion-responsive materials and their dosages on the phase transition temperature of nasal in-situ gel spray

[0105] By replacing the sodium alginate in Example 2 with an equal amount of gellan gum, or by changing the amount of sodium alginate (as shown in Table 2), and keeping all other raw materials and amounts the same as in Example 2, different formulations of miR-124 nasal in-situ gel precursor spray solutions were prepared according to the method of Example 2.

[0106] The gel temperature of the nasal in-situ gel precursor spray solution prepared in this example was tested using the method in Example 4, and the results are shown in Table 2.

[0107] The gel time of the nasal in-situ gel precursor spray solution prepared in this embodiment was tested using the inversion method: 2 mL of the swollen precursor spray solution was placed in a vial and placed in a 33°C constant temperature water bath. Timing was started, and the vial was inverted every 15 seconds until the gel stopped flowing when the vial was tilted. Timing was stopped immediately. Each sample was measured in triplicate, and the average value was taken as the gel time. The results are shown in Table 2.

[0108] As shown in Table 2, the gelation time of the temperature-sensitive in-situ gel prepared without the addition of ion-responsive materials is 103.33 s. This excessively long time is detrimental to the rapid phase transition after the precursor spray is delivered to the nasal cavity, hindering its resistance to mucociliary clearance. When ion-responsive materials sodium alginate and gellan gum are added to form a temperature-ion dual-responsive in-situ gel, the gelation time of the precursor spray solution is significantly reduced. Furthermore, the addition of sodium alginate significantly reduces the phase transition time compared to gellan gum, reducing it to approximately 1-3 s. This is more conducive to the rapid phase transition and formation of an in-situ gel after deposition in the nasal cavity, thus enhancing its resistance to mucociliary clearance. Therefore, the combination of sodium alginate and poloxamer is preferred as the gelling material to prepare the temperature-ion dual-responsive miR-124 nasal in-situ gel spray.

[0109] Table 2. In-situ gel phase transition (gel) time and temperature of non-ionic responsive materials and dosages

[0110]

[0111] Note: The percentages in the table are weight-to-volume ratios, and the weight is in grams (g) and the volume is in milliliters (mL).

[0112] Example 6 Performance testing of nasal in-situ gel spray

[0113] The following performance tests were conducted on the miR-124 nasal in-situ gel spray prepared according to formulations F1-F5 in Example 5:

[0114] 1. The delivery dose and viscosity were determined using a weighing method and a rotational viscometer.

[0115] According to the method under General Chapter 0112 of Part IV of the 2020 edition of the Chinese Pharmacopoeia, the dosage per spray of the nasal spray was determined. One bottle of the sample to be tested was taken, inverted and shaken well, and pre-sprayed 10 times, then discarded. After wiping the nozzle clean, the mass of the nasal in-situ gel precursor spray before and after spraying was accurately weighed; the difference between the two masses is the delivered dose. 10 mL of the test solution was added to the ultra-low viscosity adapter of the viscometer, and the viscosity was measured using a No. 21 rotor at a speed of 50 rpm / min for 60 s. Each formulation was measured in triplicate.

[0116] The results are as follows Figure 4 As shown: Each formulation contains different concentrations of sodium alginate, resulting in a series of nasal in-situ gel sprays with varying viscosities, ranging from 32.2 mPa·s to 98.9 mPa·s. Furthermore, there was no significant difference in the delivery dose (~100 mg) among the different formulations of the nasal in-situ gel spray.

[0117] 2. Evaluation of spray performance.

[0118] The droplet size of each formulation of nasal in situ gel spray was determined using a Sympatec laser particle size analyzer (HELOS & SPRAYER™), with an R5 lens (0.5 / 4.5-875 μm), an actuation pressure of 60 N, and a measurement time of 100 ms.

[0119] The spraying process of the nasal in-situ gel precursor spray is divided into three stages: formation, stabilization, and dissipation. The formation stage is the initial stage of spraying, where droplet concentration rapidly increases and droplet size increases accordingly. Then, the droplet concentration reaches its peak and remains constant during the stabilization stage, with droplet size remaining essentially unchanged. During the dissipation stage, droplet concentration decreases due to droplet collisions and gravitational settling, resulting in significant droplet size fluctuations. The spraying process shows that as the formulation viscosity increases, the stabilization period shifts later, the percentage of the stabilization period increases, and the droplet size increases. However, when the viscosity is too high (F5), the nasal spray device struggles to fully disperse the solution, forming larger droplets, leading to greater droplet size fluctuations during the stabilization period, which is detrimental to olfactory deposition.

[0120] Further statistical analysis of droplet size during the stable period and the three stages of spraying ( Figure 5 The average particle size during the stable period of each formulation of the nasal in-situ gel precursor spray gradually increased with increasing viscosity, but all were greater than 9 μm, indicating a low probability of deposition into the lower respiratory tract during administration and good safety. The proportion of the formation period gradually increased with increasing formulation viscosity, but none exceeded 20%. Furthermore, the proportion of the stable period initially decreased with increasing formulation viscosity, with no significant difference among F1-F4 (p < 0.05), and all were greater than 60%, indicating that formulations F1-F4 could be continuously and stably delivered within the nasal passages. There was no obvious pattern in the proportion of the dissipation period among formulations F1-F5.

[0121] 3. Spray mode and spray pattern.

[0122] The spray pattern and spray morphology of each prescription nasal in situ gel spray were determined using the SprayVIEW® online droplet testing system at a trigger distance of 6 cm.

[0123] The results are as follows Figure 6 As shown, as viscosity increases, the spray area and plume angle of each formulation gradually decrease, which can form a more convergent spray plume, thereby reducing ineffective deposition in the nasal vestibule and increasing deposition in the olfactory region of the nasal cavity.

[0124] 4. Determination of nasal cavity deposition distribution and olfactory region deposition percentage.

[0125] The nasal cavity deposition distribution and olfactory region deposition percentage of various nasal in-situ gel spray formulations were determined using a 3D-printed human nasal cavity model. Based on the magnetic resonance imaging (MRI) results of healthy adults, a human nasal cavity model was established and divided into five parts according to its physiological structure: the nasal vestibule, inferior nasal meatus, middle nasal meatus, superior nasal meatus, and pharynx. The structure is as follows: Figure 7 As shown.

[0126] The nasal cavity deposition distribution of the nasal spray was then tested. The specific procedure was as follows: One bottle of the nasal spray sample was taken, shaken thoroughly, and pre-sprayed 10 times. The nasal spray device was then inserted into the left nostril of a simulated human nasal cavity model and the spray was triggered. The insertion angle was 30° to the central axis, and the insertion depth was 5 mm. The spray was triggered twice for each test. Subsequently, the shell of the simulated human nasal cavity model was opened, and the various nasal cavity modules were removed. Drug solutions were collected from the nasal vestibule, inferior nasal meatus, middle nasal meatus, superior nasal meatus, and pharynx using deionized water. The nasal cavity location and drug deposition amount were determined using high-performance liquid chromatography (HPLC). Each prescription was tested three times. The percentage of drug deposited at the top of the superior nasal meatus relative to the total amount of drug deposited in the nasal cavity was defined as the olfactory deposition fraction.

[0127] The results are as follows Figure 8 As shown, the F4 nasal in-situ gel spray exhibits the highest olfactory deposition rate at 42.5%, enabling it to deliver more miR-124 to the brain. The F4 formulation has an appropriate droplet size, ensuring minimal entry into the lower respiratory tract after spraying, and also results in a lower oropharyngeal deposition rate. Compared to the low-viscosity formulation, it significantly reduces the percentage of deposition in the nasal vestibule and increases the percentage in the nasal turbinate, further promoting olfactory deposition of miR-124.

[0128] 5. Test of mucosal adhesion and retention effect.

[0129] Considering the difficulty in simulating the clearance of nasal mucus and cilia in vitro, this experiment used an isolated toad palate to simulate the nasal environment. The color clearance time and object movement rate were observed under an optical microscope by adding a solution pre-coated with crystal violet dye (AQ group) and a miR-124 nasal in-situ gel precursor solution pre-coated with crystal violet dye (F4 group). The specific experimental steps are as follows:

[0130] Preparation of AQ group solution: miR-124@LNPs suspension (LNP:miR-124=12:1) was prepared according to the method of Example 1 (the difference being that 2% crystal violet powder was added during hydration), and then an equal volume of DEPC water was added and mixed evenly.

[0131] Preparation of nasal in situ gel precursor spray solution for group F4: miR-124@LNPs suspension (LNP:miR-124=12:1) was prepared according to the method of Example 1 (the difference being that 1% crystal violet powder was added during hydration), and then an equal volume of saturated nasal in situ gel precursor solution prepared according to Example 2 was added.

[0132] After destroying the brain and spinal cord of the toad with a bone marrow destroying needle, the toad was fixed to a frog board. The toad's mouth was opened and secured with hemostatic forceps. The palatal mucosa of the toad was surgically separated and placed on a glass slide. The ciliary movement was observed using an optical microscope. Then, 20 μL of either a solution of group Aq containing 1% crystal violet or group F4 in-situ gel precursor spray solution was added to the ciliary movement area. The clearance rate of the crystal violet dye and the state of the added droplet were observed and recorded.

[0133] The results are as follows Figure 9 As shown, group F4 rapidly underwent a phase transition to form a gel after droplet application, while group Aq remained in liquid form. Microscopic observation of pigment removal revealed that the color in group Aq was rapidly removed after 30 seconds, while the in-situ gel remained for over 3600 seconds despite the removal by mucociliary action. Further quantitative analysis of the substance migration rate showed that the removal rate of the substance in group Aq was 53.32 times that of the in-situ gel group. These results demonstrate that the phase transition of the nasal in-situ gel precursor spray solution effectively resists the removal action of mucociliary action, achieving long-lasting retention in the nasal cavity.

[0134] 6. Rheological properties.

[0135] The viscoelasticity of the nasal in-situ gel spray was evaluated by constant-frequency thermosetting tests using a Thermo rotational rheometer. The measuring fixture was P35 / Ti, the strain frequency was 1%, and the constant frequency was 1 Hz. The elastic modulus (G') and viscous modulus (G”) of the gel were recorded at different temperatures (4–40℃).

[0136] The resistance to external forces and adhesive properties of nasal in-situ gel precursor sprays can be represented by the elastic modulus G' and viscous modulus G (also known as storage modulus G' and loss modulus G). The relative magnitudes of G' and G'' reflect the phase transition of the system. When G' > G'', the elastic properties of the system dominate, exhibiting a semi-solid gel state; when G' < G'', the viscous properties dominate, exhibiting a solution state; when G' = G'', the nasal in-situ gel precursor spray begins to undergo a phase transition. Simultaneously, the modulus value also represents the hardness properties of the nasal in-situ gel precursor spray. An excessively high modulus can cause nasal discomfort, while an excessively low modulus results in poor mechanical properties, making it difficult to resist the clearing action of cilia.

[0137] The rheological properties of each prescription nasal in situ gel spray are as follows: Figure 10As shown. In the initial heating stage (5~25℃), the G' value of all external components remained lower than G'', indicating that the system was still in a precursor solution state within this temperature range. As the temperature further increased (25~35℃), the G' value rose sharply. At approximately 26℃, G' equaled G'', indicating that the temperature-sensitive gel began to undergo a phase transition. Subsequently, G' exceeded G'' and tended to stabilize around 35℃, indicating that the precursor solution had completely transformed into a semi-solid gel. At this point, viscous behavior dominated, exhibiting a large adhesive force, allowing it to adhere stably to the nasal cavity wall and prevent detachment.

[0138] Example 7: Testing the in vivo nasobrain delivery efficiency of nasal in situ gel spray.

[0139] This embodiment uses in vivo imaging experiments in rats to investigate the nasal-brain drug transport process and intracranial drug distribution of a dual-response nasal in situ gel precursor spray solution, and to elucidate the effect of dual-response in situ gel on the nasal-brain transport process. Brains were harvested from rats 4 hours after administration to test the nasal-brain delivery efficiency of the dual-response nasal in situ gel precursor spray solution, with the nasal spray solution (aq) used as a control.

[0140] Experimental Methods: First, SD rats were anesthetized with isoflurane. Then, the rats were placed supine on the operating table and administered 100 μL each of the following via nasal spray: an aqueous solution containing cy5-labeled miR-124 (aq group, concentration 25 μg / mL) and a nasal in-situ gel precursor spray solution containing cy5-labeled miR-124 (F4 group, where miR-124 in Example 5 was replaced with cy5-labeled miR-124). The rat heads were observed and photographed using a small animal in vivo imaging system at 10 min, 30 min, 60 min, 120 min, and 240 min after administration.

[0141] The results are as follows Figure 11 As shown, at the same dosage, the nasal retention effect and naso-brain delivery efficiency of the dual-response nasal in situ gel precursor spray solution are significantly better than those of the nasal spray solution group. This indicates that the F4 formulation, when delivered as a nasal spray solution, can rapidly undergo a phase transition to form a gel under the physiological conditions of the nasal cavity, thereby resisting the clearance of nasal mucus and cilia, and ultimately achieving better naso-brain delivery efficiency.

[0142] The embodiments described above are merely illustrative of several implementations of the present invention, and while the descriptions are relatively specific and detailed, they should not be construed as limiting the scope of the invention patent. It should be noted that those skilled in the art can make various modifications and improvements without departing from the concept of the present invention, and these all fall within the protection scope of the present invention. Therefore, the protection scope of this invention patent should be determined by the appended claims.

Claims

1. A miR-124 nasal in-situ gel spray, characterized in that, It is an aqueous solution containing miR-124 lipid nanoparticles, poloxamer 407, poloxamer 188 and sodium alginate; The concentration of poloxamer 407 in the miR-124 nasal in situ gel spray is 145 mg / mL-155 mg / mL; The concentration of poloxamer 188 in the miR-124 nasal in situ gel spray is 9.5 mg / mL-10.5 mg / mL; The concentration of sodium alginate in the miR-124 nasal in situ gel spray is 1 mg / mL-5 mg / mL; The miR-124 lipid nanoparticles are prepared from miR-124, phospholipids, and cholesterol; The phospholipids are (2,3-dioleoxypropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine and egg yolk lecithin; The mass ratio of miR-124 to the phospholipid is 1:2-16, and the mass ratio of the phospholipid to cholesterol is 2-6:

1.

2. The miR-124 nasal in-situ gel spray according to claim 1, characterized in that, The concentration of poloxamer 407 in the miR-124 nasal in situ gel spray is 148 mg / mL-152 mg / mL; And / or, the concentration of poloxamer 188 in the miR-124 nasal in situ gel spray is 9.8 mg / mL-10.2 mg / mL.

3. The miR-124 nasal in-situ gel spray according to claim 1, characterized in that, The concentration of sodium alginate in the miR-124 nasal in-situ gel spray is 3 mg / mL-4.2 mg / mL.

4. The miR-124 nasal in-situ gel spray according to claim 3, characterized in that, The concentration of sodium alginate in the miR-124 nasal in-situ gel spray is 3.8 mg / mL-4.2 mg / mL.

5. The miR-124 nasal in-situ gel spray according to claim 1, characterized in that, The miR-124 nasal in situ gel spray contains miR-124 at a concentration of 10 μg / mL to 50 μg / mL.

6. The miR-124 nasal in-situ gel spray according to claim 5, characterized in that, The miR-124 nasal in situ gel spray contains miR-124 at a concentration of 20 μg / mL to 30 μg / mL.

7. The miR-124 nasal in-situ gel spray according to claim 6, characterized in that, The miR-124 nasal in situ gel spray contains miR-124 at a concentration of 23 μg / mL to 27 μg / mL.

8. The miR-124 nasal in-situ gel spray according to claim 1, characterized in that, The mass ratio of miR-124 to the phospholipid is 1:8-16; And / or, the mass ratio of the phospholipids to cholesterol is 3-5:

1.

9. The miR-124 nasal in-situ gel spray according to claim 8, characterized in that, The mass ratio of miR-124 to the phospholipid is 1:10-14.

10. The miR-124 nasal in-situ gel spray according to claim 9, characterized in that, The mass ratio of miR-124 to the phospholipid is 1:12-13.

11. The miR-124 nasal in-situ gel spray according to claim 8, characterized in that, The mass ratio of phospholipids to cholesterol is 4:

1.

12. The miR-124 nasal in-situ gel spray according to claim 1, characterized in that, The miR-124 lipid nanoparticles are prepared from miR-124, (2,3-dioleoyloxypropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphorylethanolamine, egg yolk lecithin, and cholesterol. The mass ratio of (2,3-dioleoyloxypropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphorylethanolamine, egg yolk lecithin, and cholesterol is 1:0.5-1.5:1.5-2.5:0.5-1.

5.

13. The miR-124 nasal in-situ gel spray according to claim 12, characterized in that, The mass ratio of (2,3-dioleoxypropyl)trimethylammonium chloride, 1,2-dioleoyl-SN-glycerol-3-phosphoethanolamine, egg yolk lecithin, and cholesterol is 1:0.8-1.2:1.8-2.2:0.8-1.

2.

14. The miR-124 nasal in-situ gel spray according to any one of claims 1-13, characterized in that, The preparation method of the miR-124 lipid nanoparticles includes the following steps: The phospholipids and cholesterol were dissolved in dichloromethane to obtain a lipid solution; The lipid solution was vacuum dried to remove dichloromethane, then physiological saline was added, hydrated, and ultrasonically pulverized to obtain a lipid suspension. The lipid suspension was diluted and mixed evenly with an aqueous solution of miR-124, and then incubated to obtain a suspension of miR-124 lipid nanoparticles.

15. The miR-124 nasal in-situ gel spray according to claim 14, characterized in that, The total concentration of phospholipids in the lipid solution is 5 mg / mL-7 mg / mL; And / or, the total concentration of phospholipids in the lipid suspension is 5 mg / mL-7 mg / mL; And / or, the vacuum drying temperature is 15℃-30℃; And / or, the hydration conditions include: a temperature of 30℃-40℃, a rotation speed of 150rpm-250rpm, and a time of 0.8h-1.5h; And / or, the conditions for ultrasonic pulverization include: power of 60 W-80 W and time of 2 min-5 min; And / or, the lipid suspension is diluted and mixed with an equal volume of the aqueous solution of miR-124, wherein the concentration of miR-124 in the aqueous solution of miR-124 is 40 μg / mL-200 μg / mL; And / or, the incubation temperature is 20℃-30℃, and the time is 15min-25min.

16. The miR-124 nasal in-situ gel spray according to claim 15, characterized in that, The concentration of miR-124 in the aqueous solution is 80 μg / mL to 120 μg / mL.

17. The miR-124 nasal in-situ gel spray according to claim 16, characterized in that, The concentration of miR-124 in the aqueous solution is 92 μg / mL to 108 μg / mL.

18. A method for preparing the miR-124 nasal in-situ gel spray according to any one of claims 1-17, characterized in that, Includes the following steps: A suspension of miR-124 lipid nanoparticles was prepared according to the method for preparing miR-124 nasal in situ gel spray according to any one of claims 14-17. The poloxamer 188, poloxamer 407 and sodium alginate were swollen in water to obtain a nasal in-situ gel precursor solution. The miR-124 lipid nanoparticle suspension and the nasal in-situ gel precursor solution are mixed to obtain the miR-124 nasal in-situ gel spray.

19. The method for preparing the miR-124 nasal in-situ gel spray according to claim 18, characterized in that, The swelling temperature is 0℃-8℃, and the time is 40 hours-56 hours.

Citation Information

Patent Citations

  • CN104888224A

  • CN106727276A