Fish creatine kinase allergenicity and immune cross reactivity analysis method
Patent Information
- Application Number
- CN202511201538.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-08-26
- Publication Date
- 2025-12-26
AI Technical Summary
Existing technologies do not provide a complete identification, expression, and cross-reactivity assessment system for grass carp creatine kinase, which makes it impossible to accurately identify the sensitization potential of grass carp CK, and the recombinant protein preparation has poor stability. It is also difficult to quantify the degree of cross-reactivity between grass carp CK and crustacean AK, and thus cannot support the risk assessment and accurate diagnosis of complex allergens.
By preparing a crude extract of water-soluble protein from fish muscle, separating 40-45kDa protein components, and screening for target allergenic proteins, total RNA from grass carp was extracted based on molecular weight characteristics. Creatine kinase-specific primers were designed to amplify the gene sequence, which was cloned into an expression vector and induced to express in Escherichia coli. The IgE/IgG binding activity and cross-reactivity of recombinant grass carp creatine kinase were detected by dot hybridization and ELISA.
This study achieved high expression, high purity, and high activity of grass carp CK, enriched the aquatic product allergen database, provided target molecules for precise clinical diagnosis, quantified the degree of cross-reactivity between grass carp CK and crustacean AK, and supported the risk classification and labeling management of aquatic product compound allergens.
Smart Images
Figure CN121208341A_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of fish creatine kinase technology, specifically relating to a method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase. Background Technology
[0002] Food allergies are recognized as a global public health challenge. Epidemiological surveys show that seafood is among the most common allergenic foods, with freshwater fish seeing a year-on-year increase in allergy cases due to high consumption and diverse processing methods. Currently, research on fish allergens largely focuses on traditional albumin, while a thorough understanding of the systematic identification of other potential allergenic proteins in muscle and their cross-species cross-reaction mechanisms remains lacking.
[0003] Creatine kinase (CK), a key enzyme in energy metabolism, is widely present in the muscles of various fish species. Recent studies have found significant sequence and structural similarities between fish CK and crustacean arginine kinase (AK), suggesting that they may trigger immune cross-reactivity through shared or mimicked antigenic epitopes. However, current technology lacks a complete system for identifying, evaluating the expression, and assessing cross-reactivity of grass carp CK, leading to:
[0004] (1) The sensitizing potential of grass carp CK cannot be accurately identified;
[0005] (2) The lack of a stable preparation method for highly active recombinant grass carp CK restricts subsequent immunological research;
[0006] (3) The degree of cross-reactivity between grass carp CK and crustacean AK lacks quantitative means, making it difficult to support the needs of risk assessment and accurate diagnosis of complex allergens.
[0007] In view of this, the present invention proposes a method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase, which is of great significance for improving the aquatic product allergen database, guiding dietary management of allergic populations, and promoting the development of low-allergenic foods. Summary of the Invention
[0008] The purpose of this invention is to address the problems of difficulty in identifying the sensitization potential of grass carp creatine kinase, poor stability of recombinant protein preparation, and difficulty in quantifying immune cross-reactivity, and to propose a method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase.
[0009] The technical solution adopted by this invention to solve its technical problem is as follows:
[0010] This invention proposes a method for analyzing the sensitization and immune cross-reactivity of creatine kinase in fish, the method comprising the following steps:
[0011] S1. Prepare a crude extract of water-soluble protein from fish muscle. Separate the 40-45kDa protein components from the crude extract of fish muscle by SDS-PAGE. Then, analyze the binding activity of the protein components with IgE and IgG by immunoblotting to screen out the target sensitizing proteins.
[0012] S2. Based on the molecular weight characteristics of the target allergenic protein, total RNA was extracted from grass carp and cDNA was synthesized. Creatine kinase-specific primers were designed to amplify the creatine kinase gene sequence. After sequencing verification, bioinformatics analysis was used to analyze the sequence homology, spatial structure, and antigenic epitopes of the creatine kinase gene sequence with known allergens.
[0013] S3. The creatine kinase gene was cloned into an expression vector, transformed into Escherichia coli BL21, and expressed by IPTG. The inclusion bodies were refolded by urea gradient dialysis to obtain recombinant grass carp creatine kinase.
[0014] S4. The binding activity of recombinant grass carp creatine kinase to IgE in the serum of allergic patients was detected by dot hybridization; the IgG cross-reactivity of recombinant grass carp creatine kinase and blue crab arginine kinase was verified by indirect ELISA; and the degree of IgE cross-reactivity of recombinant grass carp creatine kinase and blue crab arginine kinase was quantified by inhibitory dot hybridization.
[0015] Preferably, in step S1, the preparation of a crude extract of water-soluble protein from fish muscle specifically includes the following sub-steps:
[0016] S111. After thawing the fish stored at -80℃ on ice, remove the skin and bones, take the fish muscle tissue, add pre-cooled PBS buffer at a weight-to-volume ratio of 1:10, and homogenize the tissue under ice bath to obtain fish muscle homogenate.
[0017] S112. After stirring the fish muscle homogenate at 4°C overnight, centrifuge at 12,000g for 30 minutes at 4°C. Filter the supernatant through silk cloth to obtain crude extract of water-soluble protein from fish muscle.
[0018] Preferably, in step S1, the 40-45kDa protein component in the crude extract of fish muscle is separated by SDS-PAGE, and then the binding activity of the protein component with IgE and IgG is analyzed by immunoblotting to screen for target sensitizing proteins. This specifically includes the following sub-steps:
[0019] S121. The crude extract of water-soluble protein from fish muscle was subjected to SDS-PAGE electrophoresis, Coomassie brilliant blue staining was used to locate the 40–45 kDa protein band, and the target protein component was recovered by gel excision.
[0020] S122. The recovered protein obtained in step S121 is transferred to a nitrocellulose membrane, blocked with 5% skim milk, and then incubated with serum from allergic patients and rabbit anti-crab arginine kinase IgG antibody. HRP-labeled secondary antibody is used for color development, and proteins with IgE / IgG binding activity are screened as target sensitizing proteins.
[0021] Preferably, in step S2, based on the molecular weight characteristics of the target sensitizing protein, total RNA is extracted from grass carp and cDNA is synthesized. Creatine kinase-specific primers are designed to amplify the creatine kinase gene sequence. This specifically includes the following sub-steps:
[0022] S211. Based on the molecular weight of the target sensitizing protein screened in step S1, retrieve the conserved sequence of creatine kinase from the NCBI database and design specific primers.
[0023] S212. Using cDNA reverse transcribed from total RNA of grass carp muscle as a template, PCR amplification was performed to obtain the PCR amplification product.
[0024] S213. The PCR amplification products were purified by agarose gel electrophoresis and sequenced to verify the correctness of the grass carp CK gene sequence.
[0025] Preferably, in step S2, bioinformatics analysis is performed to determine the sequence homology, spatial structure, and antigenic epitopes of the creatine kinase gene sequence with known allergens, specifically including the following sub-steps:
[0026] S221. Translate the creatine kinase gene sequence into an amino acid sequence and compare the amino acid sequence with sequences in a known allergen database to analyze homology.
[0027] S222. Construct a three-dimensional structural model based on the amino acid sequence of the target protein, and analyze the model features using structural visualization tools;
[0028] S223. Perform multiple sequence secondary structure alignment and spatial structure superposition between the target protein and the reference allergen, calculate the root mean square deviation of the structural differences, and analyze the conservation of the antigen epitope.
[0029] Preferably, step S3 specifically includes the following sub-steps:
[0030] S31. Based on the creatine kinase gene sequence verified in step S2, primers containing restriction endonuclease sites were designed for amplification. The amplified product after enzyme digestion was cloned into a prokaryotic expression vector to obtain a recombinant expression vector.
[0031] S32. The recombinant expression vector was transformed into Escherichia coli BL21, and the recombinant protein was expressed by IPTG induction at a temperature below 30°C to obtain the expression product.
[0032] S33. After cell disruption, inclusion bodies of the expression product were collected and refolded by urea gradient dialysis to obtain recombinant grass carp creatine kinase.
[0033] More preferably, in step S33, the urea gradient dialysis refolding includes the following sub-steps:
[0034] S331. The inclusion body sample dissolved in 4M urea is placed in a dialysis bag with a molecular weight cutoff of 10kDa, and placed in a refolding buffer containing 2M urea. Dialyze at 4°C for 8-12 hours.
[0035] S332. After dialysis in step S331, the sample is centrifuged at 4℃ and 12000g for 10 minutes to separate the supernatant from the precipitate.
[0036] S333. Transfer the supernatant to a new dialysis bag, place it in urea-free PBS buffer, and dialyze at 4°C for 8-12 hours.
[0037] S334. After dialysis in step S333, the sample is centrifuged at 12000g for 10 minutes at 4℃. The supernatant is collected and the refolding efficiency is analyzed by SDS-PAGE. When the recombinant protein band is clearly visible at a molecular weight of 40-45kDa, the inclusion bodies are considered to have successfully refolded.
[0038] Preferably, in step S4, the binding activity of recombinant grass carp creatine kinase to IgE in the serum of allergic patients is detected by dot hybridization, specifically including the following sub-steps:
[0039] S411. The recombinant grass carp creatine kinase, blue crab arginine kinase, sea bass creatine kinase and bovine serum albumin were adjusted to a protein concentration of 2 mg / mL, and 1 μL of each was spotted onto a nitrocellulose membrane. The membrane was dried and fixed at room temperature to obtain the spotting membrane.
[0040] S412. Immerse the spotting membrane in TBST buffer containing 5% skim milk powder and block at room temperature for 1.5 hours. After blocking, wash three times with TBST, add diluted serum from allergic patients, incubate overnight at 4°C, add HRP-labeled goat anti-human IgE antibody, incubate at room temperature for 1.5 hours, and wash again.
[0041] S413. Add ECL chemiluminescent substrate to the spotting membrane that has undergone final washing in step S412, capture the luminescence image of the spotting membrane, and analyze the IgE binding activity by quantifying the gray value using ImageJ software.
[0042] Preferably, in step S4, the cross-reactivity of recombinant grass carp creatine kinase and blue crab arginine kinase with IgG is verified by indirect ELISA, specifically including the following steps:
[0043] S421. The crude extract of water-soluble protein from fish muscle, arginine kinase from blue crab and recombinant creatine kinase from grass carp were diluted with diluent and added to the well plate at a concentration of 150 ng / well.
[0044] S422. After coating, thoroughly wash the well plate with TBST, add 5% skim milk and seal at 37°C for 2.5 hours;
[0045] S423. After the blocking is completed, rabbit anti-crab arginine kinase IgG polyclonal antibody diluted with TBST in a series of steps is added to the well plate. The bound IgG antibody is detected by HRP-labeled goat anti-human IgE diluted 1:20000.
[0046] S424. After developing the substrate in TMB solution at 37°C for 20-30 min, add 2M H2SO4 to terminate the reaction and detect the absorbance of the liquid in the well plate at 450 nm.
[0047] Preferably, in step S4, the degree of IgE cross-reactivity between recombinant grass carp creatine kinase and blue crab arginine kinase is quantified by inhibitory dot hybridization, specifically including the following sub-steps:
[0048] S431. Pre-incubate the serum of allergic patients with blue crab arginine kinase at room temperature for 3 hours to obtain pre-adsorbed serum;
[0049] S432. Using pre-adsorbed serum as the primary antibody, the IgE binding activity of recombinant grass carp creatine kinase was detected by a nitrocellulose membrane solid-phase dot hybridization system.
[0050] S433. Calculate the inhibition rate using the following formula:
[0051]
[0052] Among them, the unadsorbed serum group is serum that has not been pre-incubated. If the inhibition rate is ≥50%, it is determined that there is significant IgE cross-reactivity.
[0053] In summary, compared with existing technologies, the method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase provided by this invention has the following beneficial effects:
[0054] (1) This invention is the first to identify 40–45kDa grass carp creatine kinase (CK) as a novel allergen in fish, breaking through the limitation of existing technologies that only focus on parvalbumin, significantly enriching the aquatic product allergen database, and providing a new target molecule for precise clinical diagnosis.
[0055] (2) By optimizing the prokaryotic expression system and the urea gradient dialysis refolding process, this invention has achieved high expression, high purity and high activity of recombinant grass carp CK, overcoming the defects of low yield and easy inactivation of traditional methods, and laying a reliable material foundation for subsequent immunological and structural biology research.
[0056] (3) A multi-dimensional cross-reactivity assessment scheme integrating dot blot, indirect ELISA and inhibitory dot blot was established, which can quantitatively determine the degree of IgE / IgG cross-reactivity between grass carp CK and crustacean arginine kinase (AK), providing technical support for risk classification and label management of aquatic product complex allergens.
[0057] (4) By organically combining sequence homology, three-dimensional structural superposition and antigen epitope prediction with experimental verification, a complete technical closed loop of "prediction-expression-verification" is formed, which significantly improves the accuracy and efficiency of allergen identification and cross-reactivity research.
[0058] (5) By clarifying the cross-reaction mechanism between grass carp CK and crustaceans AK, molecular markers can be provided for the breeding of low-allergenic varieties in aquaculture. At the same time, scientific basis can be provided for dietary guidance and allergen avoidance strategies for people with allergies. It has significant public health and industrial application value. Attached Figure Description
[0059] Other features, objects, and advantages of this application will become more apparent from the following detailed description of non-limiting embodiments with reference to the accompanying drawings:
[0060] Figure 1 This is a flowchart of the fish creatine kinase sensitization and immune cross-reactivity analysis method of the present invention;
[0061] Figure 2 These are the SDS-PAGE and immunoblot analysis results of crude protein extracted from fish meat.
[0062] Figure 3 This is a dot hybridization and grayscale analysis diagram of crude protein from fish meat;
[0063] Figure 4 This is an amino acid sequence comparison diagram of grass carp CK and allergenic CK and allergenic AK aquatic products;
[0064] Figure 5 This is a comparison diagram of the secondary structure and antigenic epitopes of grass carp CK and sensitized CK and sensitized AK in aquatic products;
[0065] Figure 6 This is a spatial structure model of grass carp CK and a schematic diagram of its structural superposition with that of red swamp crayfish AK.
[0066] Figure 7These are PCR amplification and colony PCR verification images of grass carp CK.
[0067] Figure 8 This is a double enzyme digestion diagram of pEASY-T1-CK and the expression vector pET-28a;
[0068] Figure 9 These are colony PCR verifications of the expressing host and induced expression diagrams of the positive expressing host;
[0069] Figure 10 This is a renaturation diagram of the grass carp CK expression product;
[0070] Figure 11 This is an ELISA analysis diagram of the binding activity of IgG to the CK expression product in grass carp;
[0071] Figure 12 This is a dot hybridization analysis and grayscale analysis of the binding activity of recombinant grass carp CKIgE;
[0072] Figure 13 This is an inhibitory dot hybridization analysis and grayscale analysis of the immunoreactivity of recombinant grass carp CK IgE. Detailed Implementation
[0073] The present application will now be described in further detail with reference to the accompanying drawings and embodiments. It should be understood that the specific embodiments described herein are merely illustrative of the invention and not intended to limit it. Furthermore, it should be noted that, for ease of description, only the parts relevant to the invention are shown in the accompanying drawings.
[0074] It should be noted that, unless otherwise specified, the embodiments and features described in this application can be combined with each other. This application will now be described in detail with reference to the accompanying drawings and embodiments.
[0075] Figure 1 A flowchart of the fish creatine kinase sensitization and immune cross-reactivity analysis method of the present invention is shown, as follows: Figure 1 As shown, the method includes the following steps:
[0076] S1. Prepare a crude extract of water-soluble protein from fish muscle. Separate the 40-45kDa protein components from the crude extract of fish muscle by SDS-PAGE. Then, analyze the binding activity of the protein components with IgE and IgG by immunoblotting to screen out the target allergenic protein. Grass carp is the preferred fish.
[0077] S2. Based on the molecular weight characteristics of the target allergenic protein, total RNA was extracted from grass carp and cDNA was synthesized. Creatine kinase-specific primers were designed to amplify the creatine kinase gene sequence. After sequencing verification, bioinformatics analysis was used to analyze the sequence homology, spatial structure, and antigenic epitopes of the creatine kinase gene sequence with known allergens.
[0078] S3. The creatine kinase gene was cloned into the expression vector, transformed into E. coli BL21, and expressed by IPTG. The inclusion bodies were refolded by urea gradient dialysis. Success was determined when SDS-PAGE showed clear bands, and recombinant grass carp creatine kinase was obtained.
[0079] S4. The binding activity of recombinant grass carp creatine kinase to IgE in the serum of allergic patients was detected by dot hybridization; the IgG cross-reactivity of recombinant grass carp creatine kinase and blue crab arginine kinase was verified by indirect ELISA; and the degree of IgE cross-reactivity of recombinant grass carp creatine kinase and blue crab arginine kinase was quantified by inhibitory dot hybridization.
[0080] Example 1: Preparation of crude extract of water-soluble protein from fish muscle and analysis of IgE / IgG binding activity (1) Preparation of crude extract of water-soluble protein from fish muscle
[0081] Fish stored at -80℃ were thawed on ice, skinned, deboned, and the muscle was collected. Ten volumes (w / v) of PBS were added and the mixture was homogenized to obtain a fish muscle homogenate. The homogenate was stirred overnight at 4℃. The next day, the overnight homogenate was centrifuged (4℃, 12000g, 30min), and the supernatant was filtered through a silk cloth. The filtrate was the crude extract of water-soluble protein from fish muscle (hereinafter referred to as fish crude protein).
[0082] (2) SDS-PAGE analysis
[0083] Crude fish protein and a positive control (Procambarus clarkii AK) were SDS-dimethylated separately, and polyacrylamide gels were prepared for SDS-PAGE analysis. 5 μL of the SDS-dimethylated sample was loaded onto the gel, and electrophoresis was performed at a constant voltage of 100 V. After electrophoresis, the gel was removed, stained with Coomassie Brilliant Blue R-250 until it turned deep blue, and then destained with destaining solution until clear blue protein bands appeared. The results were then recorded using a gel imaging system.
[0084] (3) Immunoblotting analysis of IgE / IgG binding activity
[0085] IgE binding activity of the target protein was detected using Western blotting and dot blot hybridization. Samples analyzed by SDS-PAGE were transferred to nitrocellulose membranes via electrotransfer, blocked with 5% skim milk for 1.5 hours, and thoroughly washed with TBST. IgE binding activity was detected using diluted serum from allergic patients as the primary antibody, incubated overnight at 4°C. After thorough washing of the nitrocellulose membrane, bound IgE was detected using HRP-labeled goat anti-human IgE antibody (1:20,000 dilution). IgG binding activity was detected using rabbit anti-crayfish AK IgG polyclonal antibody (1:100,000 dilution) as the primary antibody, incubated at room temperature for 1.5 hours. Bound IgG was detected using HRP-labeled goat anti-rabbit IgG antibody (1:20,000 dilution). For dot blot hybridization of the target protein, the sample concentration was adjusted to 2 mg / mL, and 1 μL was spotted onto the nitrocellulose membrane; the remaining steps were the same as for Western blotting. After performing grayscale analysis on the results of dot hybridization using ImageJ software, the grayscale values of each point were analyzed for significance using one-way ANOVA.
[0086] Example 2: Gene cloning and bioinformatics analysis of grass carp CK
[0087] (1) Gene cloning of grass carp CK
[0088] according to Total RNA was extracted from grass carp using the Super Total RNA Extraction Kit instructions (it should be understood that this invention uses grass carp as an example, but is applicable to other fish species). Using this RNA as a template, it was then processed according to PrimeScript. TM The first-strand cDNA was synthesized according to the instructions of the 1st Strand cDNA Synthesis Kit. Reported CK gene sequences were retrieved from the gene database provided by the National Center for Biotechnology Information (NCBI), and cloning primers were designed (see Table 1). Using the synthesized first-strand cDNA as a template, the PCR reaction system was prepared according to Table 2, with annealing at 65°C for 1 min and extension at 72°C for 1 min, for 30 cycles of PCR to amplify the target gene. After separation by agarose gel electrophoresis, bands matching the theoretical size were recovered according to the instructions of a general DNA purification and recovery kit and sequenced by Xiamen Platinum Biotech Co., Ltd.
[0089] (2) Bioinformatics analysis of cloned sequences
[0090] Bioinformatics analysis methods were used to analyze the cloned gene sequences: a) Amino acid sequence analysis: First, the phylogenetic analysis of grass carp CK was completed using the protein BLAST online sequence alignment function of the NCBI database. Then, allergens included in the World Health Organization / International Federation of Immunological Societies were searched from highly conserved sequences, and DNAstar software was used for sequence and epitope comparison analysis of these allergens. b) Spatial structure modeling and structural alignment: The obtained target gene nucleotide sequence was translated into amino acid sequence and submitted to the AlphaFold online server for automatic modeling. The obtained protein spatial structure was displayed and analyzed using PyMol software. c) Secondary structure and spatial structure comparison: The searched amino acid sequences were aligned using the Clustal Omega online server, and the alignment result file was saved. The multiple sequence alignment result file and the CK modeling structure file were input into the ESPrint 3.0 online server for secondary structure comparison analysis. The established grass carp CK structural model was subjected to structural similarity comparison, and PyMol software was used to calculate the superposition of crystal structures and the root mean square deviation of structural differences.
[0091] Table 1. Grass carp CK cloning-specific primers
[0092] Primers Sequence (5'-3') Cloning-CK-F TTAACGTGGTGTGCTAGAGGC Cloning-CK-R GTTTGGTCGAGCCCACAGA
[0093] Table 2. PCR reaction system for cloning the CK gene in grass carp.
[0094]
[0095] Example 3: Recombinant expression and purification of grass carp CK
[0096] (1) Construction and transformation of grass carp CK recombinant plasmid
[0097] Based on the cloned grass carp CK base sequence, primers with BamHI restriction sites were designed at both ends of its open reading frame (see Table 3, underlined sites are restriction sites). Using the obtained first-strand cDNA as a template, the target gene was amplified using the reaction system in Table 2. The amplified target gene was recovered according to the DNA recovery kit instructions for expression vector construction. The recovered product was ligated to the pEASY-T1 cloning vector using the system in Table 4, and ligated at 16℃ for 20 min. The ligation product was then rapidly added to the thawed *E. coli* Trans-T1 host culture medium and incubated on ice for 30 min, followed by heat shock at 42℃ for 90 s and an ice bath for 2 min to complete the transformation of the recombinant expression plasmid. The ice-bathed host culture medium was added to 1 mL of LB liquid medium and incubated at 37℃ for 1 h. After centrifugation and discarding 70% of the supernatant, the precipitate was resuspended and plated on LB solid culture medium for overnight incubation at 37℃.
[0098] Table 3. Grass carp CK expression-specific primers
[0099] Primers Sequence (5'-3') CK-F GGATCCATGCCTTTCGGTAACACCCACAACAA (BamHI restriction site) CK-R GTCGACCTTCTGTGCGGGGATCATGCTGTC (SalI restriction site)
[0100] Table 4. Ligation system of recovered products with pEASY-T1 cloning vector
[0101] reagents Volume (μL) Recycled products 6.5 carrier 0.5 Solution I 3.0 Total volume 10.0
[0102] Single colonies were picked from overnight culture plates and colony PCR was performed under the same conditions as for target gene amplification. Positive clones were selected and sequenced by Xiamen Platinum Biotech Co., Ltd. The correctly sequenced clones and the *E. coli* expression vector BL21 (pET-28a) host were inoculated separately into LB broth and cultured overnight at 37°C with a shaker at 200 rpm. The bacterial cells were recovered, and plasmids were extracted according to the plasmid miniprep kit instructions. The positive clones and pET-28a host plasmids were digested using a double restriction enzyme digestion system prepared according to the restriction endonuclease instructions at 37°C. Immediately after digestion, the vector and target gene fragment were recovered from the gel. The recovered target gene was ligated into the pET-28a vector using the system shown in Table 4 and incubated overnight at 16°C. The ligation product was transformed into the *E. coli* expression host BL21 (using the same steps as pEASY-T1 to Trans-T1 transformation) and sequenced.
[0103] (2) Expression and purification of recombinant proteins
[0104] The correctly sequenced expression vector host cells were inoculated into 5 mL of LB liquid medium containing 1 mM kanamycin and cultured until OD ≈ 0.6. IPTG was added to a final concentration of 1 mM, and expression was induced for 10 h at 16°C and 200 rpm. The bacterial cells were recovered, sonicated to disrupt the cell wall, centrifuged (13,000 g, 1 min), and the supernatant was collected. Inclusion bodies were resuspended in 4 M urea. Host cells correctly expressing the protein, as identified by SDS-PAGE, were inoculated into 500 mL of LB liquid medium containing 1 mM kanamycin, induced to express, and then the bacterial cells were recovered. The cells were resuspended in 20 mL of bacterial lysis buffer, sonicated to disrupt the cell wall, and centrifuged (13,000 g, 1 min, 4°C). Inclusion body proteins were refolded by fractional dialyzing with refolding buffer from 2 M urea to 0 M urea, and the refolded target protein was analyzed by SDS-PAGE.
[0105] Example 4: Immune cross-reactivity analysis of recombinant grass carp CK
[0106] (1) Indirect ELISA analysis of the immune cross-reactivity of CK
[0107] Fish crude protein or AK was diluted with coating diluent and added to 96-well plates at 150 ng / well. After gentle shaking, the plates were incubated at 4°C for 16 h. After coating, the plates were thoroughly washed with TBST, and then blocked at 37°C for 2.5 h with 5% skim milk. After blocking, the plates were thoroughly washed again, and rabbit anti-crayfish AKIgG polyclonal antibody serially diluted with TBST was added to the wells. The plates were incubated at 37°C for at least 2 h. The bound IgG antibody was detected using HRP-labeled goat anti-human IgE diluted 1:20,000. After developing the color with substrate chromogenic buffer (TMB) at 37°C for 20–30 min, the reaction was terminated by adding 2 M H2SO4. The absorbance of the liquid in the plates was then measured at 450 nm.
[0108] (2) Dot hybridization and suppression dot hybridization analysis of IgE binding activity and cross-reactivity in grass carp CK
[0109] Dot blot hybridization was used to detect the IgE binding activity of recombinant CK, with purified AK and sea bass CK as positive controls and bovine serum albumin (BSA) as a negative control, following the method for immunoblotting analysis of IgE / IgG binding activity as described in Example 1(3). Inhibitory dot blot hybridization used serum from allergic patients pre-incubated with the inhibitor at room temperature for 3 hours as the primary antibody; the remaining steps were the same as for dot blot hybridization.
[0110] Figure 2 The figure shows the extraction of crude protein from fish meat and the SDS-PAGE (A) and Western blot (B) analyses of the extract. M in the figure represents the standard protein. Samples 1-9 are recombinant red swamp crayfish AK (positive control), Atlantic salmon, large yellow croaker, Chinese sea bass, oval pomfret, freshwater grouper, catfish, grass carp, and bighead carp, respectively. Figure 2 As shown, SDS-PAGE analysis of crude protein extracts from fish meat revealed that, except for Atlantic salmon, the composition of water-soluble proteins in the muscle of different fish species was basically similar, but the abundance of each component varied (see [reference]). Figure 2 A). Reaction of rabbit anti-scuttler crab AKIgG polyclonal antibody with crude fish protein as the primary antibody revealed that a protein component with a molecular weight of 40–45 kDa exists in different fish species and can specifically bind to IgG antibodies (see [link]). Figure 2 B). This result indicates the presence of a 40-45 kDa protein component in fish muscle, which may share the same or similar antigenic epitopes as AK, a major allergen in crustacean aquatic products.
[0111] Figure 3The dot hybridization (A) and grayscale (B) analysis of crude protein from fish meat are shown. Samples 1-10 in the figure represent recombinant *Procambarus clarkii* AK (positive control), Atlantic salmon, large yellow croaker, Chinese sea bass, oval pomfret, freshwater grouper, *Catfish bream*, grass carp, bighead carp, and bovine serum albumin (negative control), respectively. All dot hybridization data were analyzed in triplicate for grayscale quantitative analysis. The average value and error were calculated, and significance analysis was performed using SPSS 19.0 software. Differences in grayscale values between the samples and the positive control were indicated by "*" (p < 0.05) and "**" (p < 0.01), and differences in grayscale values between the samples and the negative control were indicated by "#" (p < 0.05) and "##" (p < 0.01). A serum pool obtained by mixing serum from patients with fish and shrimp / crab allergies was used as the primary antibody. Dot hybridization detection showed that both *Procambarus clarkii* AK and fish crude protein could be recognized and bound by IgE in the patient's serum (see [link to study]). Figure 3 A). Further analysis of the grayscale results of dot hybridization using one-way ANOVA showed that the binding strength of crude protein from the flesh of the four marine fish species and crude protein from the muscle of grass carp and bighead carp in freshwater to serum IgE in allergic patients was significantly higher than that in the negative control. Among the marine fish, the Chinese perch and among the freshwater fish, grass carp showed the highest binding strength to IgE (see [reference]). Figure 3 B). Based on the size of the component in fish crude protein that can be recognized by IgG / IgE, and combined with existing research reports on fish allergens, it is speculated that this component may be a novel allergen CK in the water-soluble protein of fish muscle. Therefore, subsequent experiments selected grass carp, a freshwater species with high antibody binding activity and large consumption in my country, as a representative, and conducted in-depth research on its 40-45kDa protein component with IgG / IgE binding activity.
[0112] Figure 4 The diagram shows the amino acid sequence ratios of grass carp CK and allergenic CK and sensitizing AK in aquatic products. (Reference) Figure 4 Sequence alignment analysis revealed that the keratinocytes (CKs) of bardinese and Atlantic salmon, currently listed as allergens by WHO / IUIS, share over 90% sequence homology with the keratinocytes of grass carp. Furthermore, the acetylcholine (AK) of crustaceans shares 67.44% sequence homology with both the keratinocytes of allergenic fish and grass carp. The high sequence homology between grass carp and the allergenic keratinocytes suggests that grass carp keratinocytes may also be an allergen. The sequence homology between keratinocytes and AK provides a molecular basis for their cross-reactivity with the immune system. Figure 5 The diagram shows the secondary structure and antigenic epitope comparison of grass carp CK and sensitized CK and sensitized AK in aquatic products, as shown in the figure. Figure 5 As shown, the reported AK antigen epitopes are further labeled below the sequence alignment results. From the epitope distribution region, in the high-frequency distribution region of the AK epitope, the homology between CK and AK is higher than the homology of the whole sequence. This homology of epitope region is also an important molecular basis for immune cross-reaction between allergens.
[0113] Figure 6 The spatial structure modeling of grass carp CK (A) and its structural superposition with that of red swamp crayfish AK (B) are shown. (Refer to...) Figure 6 Based on the amino acid sequence of grass carp CK, AlphaFold3.0 modeling obtained... Figure 6 Figure A shows the spatial structure of grass carp CK. The structural modeling results of CK show a regular folding pattern, containing an N-terminal α-helix domain composed of 7 α-helices and a C-terminal α-β domain composed of 7 α-helices and 8 β-folds. The grass carp CK structural model and the red swamp crayfish AK structural model (PDB: 8YX0) were overlaid using Pymol software. The results showed that the RMSD (root mean square deviation) of the overlaid model was [value missing]. Based on the spatial structure superposition results, the structural difference between CK and AK lies in the first α-helix at the N-terminus and the two α-helix regions at the C-terminus (see [link to documentation]). Figure 6 B). Since no identified conformational epitopes are present in these regions, the differences in these local structures may not significantly affect the immune cross-reactivity between the two.
[0114] Figure 7 The figures show PCR amplification (A) and colony PCR verification (B) of grass carp CK, where M represents standard nucleic acid; lanes 1-3 in Figure A represent parallel samples; and lanes 1-10 in Figure B represent randomly selected single colonies. Using the synthesized first-strand cDNA as a template, the target gene fragment with the theoretical base number of sea bass CK was obtained by PCR amplification (see [link to relevant documentation]). Figure 7 A) The fragment was recovered from the agarose gel and ligated into the pEASY-T1 vector to construct the recombinant cloning plasmid pEASY-T1-CK. This plasmid was then transformed into *E. coli* Trans-T1 competent cells and incubated overnight at 37°C. Eight single colonies were randomly selected from the overnight culture plates for PCR verification. Agarose gel electrophoresis showed that colonies 6, 8, 9, and 10 were positive clones. Sequencing results of the positive strains indicated that all four positive clones carried a gene completely identical to the *C. coli* CK sequence.
[0115] Figure 8 The double enzyme digestion diagrams of pEASY-T1-CK(A) and expression vector pET-28a(B) are shown, as follows. Figure 8 As shown, strain 10 with correct sequencing was selected and cultured overnight in 20 mL LB broth in a shake flask. Simultaneously, 20 mL of host bacteria for the pET-28a expression vector was cultured in a shake flask for plasmid extraction. The extracted pEASY-T1-CK and pET-28a empty vector were double-digested with BamHI and SalI. [The text then abruptly shifts to a different topic:] ...recovery... Figure 8The vectors for the target gene and enzyme, indicated by the middle arrow, are linked together to construct a recombinant expression vector (pET-CK) and transformed into E. coli BL21 competent cells.
[0116] Figure 9 The diagram shows colony PCR verification of the expression host (A) and induced expression in the positive expression host (B). Figure 9 In A, M represents standard nucleic acid, and lanes 1-10 contain randomly selected single colonies; Figure 9 In lane B, M represents the standard protein, lane 1 is the pET-28a empty vector control, lane 2 is the bacterial cell supernatant dissolved in 4M urea via sonication, and lane 3 is the bacterial cell supernatant via sonication. Ten single colonies were randomly picked from the overnight culture plates of the transformed host for PCR verification. The results showed that 8 were positive clones (see [link to original text]). Figure 9 A). Sequencing results of the positive clones showed that the target gene sequences carried by the eight strains were completely identical to the grass carp CK gene sequence. Positive strain No. 10 and the empty vector control strain were simultaneously induced for expression, and the bacterial cells were collected for SDS-PAGE analysis. The electrophoresis results showed that the constructed expression strain expressed inclusion body protein at approximately 48 kDa (see...). Figure 9 B) indicates that this study successfully obtained a grass carp CK recombinant expression strain by constructing the pET-CK expression vector and transforming it into Escherichia coli. The target protein expressed by this strain exists in the form of inclusion bodies.
[0117] Figure 10 The diagram illustrates the refolding of the grass carp CK expression product. In the diagram, M represents the standard protein, lane 1 is the 0M urea-refolded precipitate, lane 2 is the 0M urea-refolded supernatant, lane 3 is the 2M urea-refolded precipitate, and lane 4 is the 2M urea-refolded supernatant. This invention employs a stepwise dialysis method to refold inclusion bodies. Inclusion bodies dissolved in 4M urea are sealed in a 10kDa pore size dialysis bag and dialyzed overnight at 4°C in 2M urea. The overnight dialyzed sample is removed, centrifuged, and the precipitate is retained. The supernatant is collected and placed in a urea-free buffer solution for further dialysis overnight at 4°C. After centrifugation, the supernatant and precipitate are used for SDS-PAGE analysis. The SDS-PAGE analysis results show that most inclusion bodies can be successfully refolded.
[0118] After refolding, the recombinant grass carp CK was analyzed by indirect ELISA, with recombinant red swamp crayfish AK and recombinant sea bass CK as positive controls and BSA as a negative control, to determine the binding ability of recombinant grass carp CK to rabbit anti-scuttler crab AK IgG polyclonal antibody. Figure 11This diagram illustrates the ELISA analysis of the IgG binding activity of the grass carp CK expression product. CK-1 represents recombinant grass carp CK, and CK-2 represents recombinant sea bass CK. All ELISA data were obtained in triplicate, with averages and errors calculated. SPSS 19.0 software was used for significance analysis. Differences in absorbance values between CK-1 and AK groups and the negative control are indicated by "*" (p < 0.05) and "**" (p < 0.01), respectively. Differences in grayscale values between CK-2 and the negative control are indicated by "#" (p < 0.05) and "##" (p < 0.01), respectively. Figure 11 The test results showed that grass carp CK and AK-specific IgG antibodies still exhibited significant recognition and binding even at a 1000-fold antibody dilution. Although the binding strength between grass carp CK and the antibody was much weaker than that between grass carp CK and AK at this antibody dilution, this result suggests that grass carp CK can specifically bind to AK-specific antibodies. Figure 2 The fish muscle protein component with IgE binding activity may be CK.
[0119] Using dot hybridization, recombinant red swamp crayfish (AK) and recombinant sea bass (CK) were used as positive controls, and BSA was used as a negative control. The reaction of collected serum from fish allergy patients with recombinant grass carp (CK) was analyzed one by one. The serum from fish allergy patients was diluted 3 times with PBS and incubated overnight at 4°C with nitrocellulose membranes spotted with AK, CK, and BSA. Figure 12 The diagram shows the dot blot analysis (A) and grayscale analysis (B) of recombinant grass carp CK IgE binding activity. Only the last three digits of the serum ID are displayed (IDs 593 and 594 are from healthy individuals). All dot blot data were analyzed in triplicate using grayscale quantitative analysis. The average value and error were calculated, and significance analysis was performed using SPSS 19.0 software. Differences in sample grayscale values between the samples and the negative control are indicated by "*", p < 0.05. Figure 12 The dot blot hybridization results showed that among the 12 serum samples collected from patients with fish and shrimp / crab allergies, 10 serum samples showed IgE binding to AK, 9 to sea bass CK, and 9 to grass carp CK. The binding strength of serum IgE to AK was higher than that to CK, indicating that grass carp CK may be sensitizing in the body. However, the one-way ANOVA results showed no significant difference in the binding strength of serum with the three allergens (see [link to analysis]). Figure 12 B). However, the amount of serum collected from allergy sufferers in this study was limited, insufficient to compare the sensitizing power of grass carp CK, sea bass CK, and red swamp crayfish AK.
[0120] To further verify the immune cross-reactivity between CK and AK, this invention employs inhibitory dot hybridization, in which serum from allergic patients is first incubated with an inhibitor, and then reacted with a nitrocellulose membrane dotted with the allergenic protein. Inhibition dot hybridization also uses recombinant red swamp crayfish AK and recombinant sea bass CK as positive controls, and BSA as a negative control, analyzing the mutual inhibition of IgE binding activity among the three proteins one by one. Figure 13 The diagram shows the inhibitory dot blot hybridization analysis (A) and grayscale analysis (B) of the recombinant grass carp CKIgE immune cross-reactivity. The primary antibody in the diagram represents the serum pool of allergic patients. All dot blot hybridization data were analyzed in triplicate using grayscale quantitative analysis. The average value and error were calculated, and significance analysis was performed using SPSS 19.0 software. Differences in sample grayscale values between the sample and the negative control are indicated by "*" for p < 0.05 and "**" for p < 0.01. Figure 13 It can be seen that, compared with the group where BSA replaced the inhibitor, the addition of the inhibitor reduced the binding strength of the protein to IgE to varying degrees. Specifically, there was mutual inhibition of IgE binding activity between AK and CK, and between sea bass CK and grass carp CK, indicating that the three can competitively bind to IgE in the serum of patients allergic to fish and shrimp / crab species. Based on the comparison results of the amino acid sequences, spatial structures, and antigenic epitopes of the three, it can be inferred that grass carp CK may have cross-reactivity with other fish CKs and crustacean AKs due to sequence homology, structural similarity, and the presence of common epitopes. Combining the results of immunoblotting, indirect ELISA, dot blot hybridization, and inhibition dot blot hybridization, grass carp CK is not only an sensitizer in its muscle but may also be an sensitizer involved in immune cross-reactivity.
[0121] The above description is merely a preferred embodiment of this application and an explanation of the technical principles employed. Those skilled in the art should understand that the scope of the invention involved in this application is not limited to technical solutions formed by specific combinations of the above-described technical features, but should also cover other technical solutions formed by arbitrary combinations of the above-described technical features or their equivalents without departing from the above-described inventive concept. For example, technical solutions formed by substituting the above features with (but not limited to) technical features with similar functions disclosed in this application.
Claims
1. A method for analyzing the sensitization and immune cross-reactivity of creatine kinase in fish, characterized in that, The method includes the following steps: S1. Prepare a crude extract of water-soluble protein from fish muscle, separate the 40-45kDa protein component from the crude extract of fish muscle by SDS-PAGE, and then analyze the binding activity of the protein component with IgE and IgG by immunoblotting to screen out the target sensitizing protein. S2. Based on the molecular weight characteristics of the target allergenic protein, total RNA was extracted from grass carp and cDNA was synthesized. Creatine kinase-specific primers were designed to amplify the creatine kinase gene sequence. After sequencing verification, the sequence homology, spatial structure, and antigenic epitopes of the creatine kinase gene sequence with known allergens were analyzed by bioinformatics. S3. The creatine kinase gene was cloned into an expression vector, transformed into Escherichia coli BL21, and expressed by IPTG. The inclusion bodies were refolded by urea gradient dialysis to obtain recombinant grass carp creatine kinase. S4. The binding activity of the recombinant grass carp creatine kinase to IgE in the serum of allergic patients was detected by dot hybridization; the IgG cross-reactivity of the recombinant grass carp creatine kinase and the blue crab arginine kinase was verified by indirect ELISA; and the degree of IgE cross-reactivity of the recombinant grass carp creatine kinase and the blue crab arginine kinase was quantified by inhibitory dot hybridization.
2. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S1, a crude extract of water-soluble protein from fish muscle is prepared, which specifically includes the following sub-steps: S111. After thawing the fish stored at -80℃ on ice, remove the skin and bones, take the fish muscle tissue, add pre-cooled PBS buffer at a weight-to-volume ratio of 1:10, and homogenize the tissue under ice bath to obtain fish muscle homogenate. S112. After stirring the fish muscle homogenate at 4°C overnight, centrifuge at 12,000g for 30 minutes at 4°C. Filter the supernatant through silk cloth to obtain crude extract of water-soluble protein from fish muscle.
3. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S1, the 40-45 kDa protein component in the crude extract of fish muscle is separated by SDS-PAGE, and then the binding activity of the protein component with IgE and IgG is analyzed by Western blotting to screen for target sensitizing proteins. This specifically includes the following sub-steps: S121. The crude extract of water-soluble protein from fish muscle is subjected to SDS-PAGE electrophoresis, Coomassie brilliant blue staining is used to locate the 40–45 kDa protein band, and the target protein component is recovered by gel excision. S122. The recovered protein obtained in step S121 is transferred to a nitrocellulose membrane, blocked with 5% skim milk, and then incubated with serum from allergic patients and rabbit anti-crab arginine kinase IgG antibody. HRP-labeled secondary antibody is used for color development, and proteins with IgE / IgG binding activity are screened as target sensitizing proteins.
4. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S2, based on the molecular weight characteristics of the target sensitizing protein, total RNA from grass carp is extracted and cDNA is synthesized. Creatine kinase-specific primers are designed to amplify the creatine kinase gene sequence. This specifically includes the following sub-steps: S211. Based on the molecular weight of the target sensitizing protein screened in step S1, retrieve the conserved sequence of creatine kinase from the NCBI database and design specific primers. S212. Using cDNA reverse transcribed from total RNA of grass carp muscle as a template, PCR amplification was performed to obtain the PCR amplification product. S213. The PCR amplification product was purified by agarose gel electrophoresis and sequenced to verify the correctness of the grass carp CK gene sequence.
5. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S2, bioinformatics analysis is performed to examine the sequence homology, spatial structure, and antigenic epitopes of the creatine kinase gene sequence with known allergens. This includes the following sub-steps: S221. Translate the creatine kinase gene sequence into an amino acid sequence, and compare the amino acid sequence with sequences in a known allergen database to analyze homology; S222. Construct a three-dimensional structural model based on the amino acid sequence of the target protein, and analyze the model features using structural visualization tools; S223. Perform multiple sequence secondary structure alignment and spatial structure superposition between the target protein and the reference allergen, calculate the root mean square deviation of the structural differences, and analyze the conservation of the antigen epitope.
6. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, Step S3 specifically includes the following sub-steps: S31. Based on the creatine kinase gene sequence verified in step S2, primers containing restriction endonuclease sites were designed for amplification. The amplified product after enzyme digestion was cloned into a prokaryotic expression vector to obtain a recombinant expression vector. S32. The recombinant expression vector is transformed into Escherichia coli BL21, and the recombinant protein is expressed by IPTG induction at a temperature below 30°C to obtain the expression product. S33. After cell disruption, inclusion bodies of the expressed product are collected and refolded by urea gradient dialysis to obtain recombinant grass carp creatine kinase.
7. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 6, characterized in that, In step S33, the urea gradient dialysis refolding includes the following sub-steps: S331. The inclusion body sample dissolved in 4M urea is placed in a dialysis bag with a molecular weight cutoff of 10kDa, and placed in a refolding buffer containing 2M urea. Dialyze at 4°C for 8-12 hours. S332. After dialysis in step S331, the sample is centrifuged at 4℃ and 12000g for 10 minutes to separate the supernatant from the precipitate. S333. Transfer the supernatant into a new dialysis bag, place it in urea-free PBS buffer, and dialyze at 4°C for 8-12 hours. S334. After dialysis in step S333, the sample is centrifuged at 12000g for 10 minutes at 4℃. The supernatant is collected and the refolding efficiency is analyzed by SDS-PAGE. When the recombinant protein band is clearly visible at a molecular weight of 40-45kDa, the inclusion bodies are considered to have successfully refolded.
8. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S4, the binding activity of the recombinant grass carp creatine kinase to IgE in the serum of allergic patients is detected by dot hybridization, specifically including the following sub-steps: S411. Adjust the recombinant grass carp creatine kinase, blue crab arginine kinase, sea bass creatine kinase and bovine serum albumin to a protein concentration of 2 mg / mL, take 1 μL of each and spot it onto a nitrocellulose membrane, dry and fix at room temperature to obtain a spotting membrane. S412. Immerse the spotting membrane in TBST buffer containing 5% skim milk powder and block at room temperature for 1.5 hours; after blocking, wash 3 times with TBST, add diluted serum from allergic patients, incubate overnight at 4°C, add HRP-labeled goat anti-human IgE antibody, incubate at room temperature for 1.5 hours, and wash again. S413. Add ECL chemiluminescent substrate to the spotting membrane that has undergone final washing in step S412, capture the luminescence image of the spotting membrane, and analyze the IgE binding activity by quantifying the gray value using ImageJ software.
9. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S4, the cross-reactivity of the recombinant grass carp creatine kinase and the blue crab arginine kinase with IgG is verified by indirect ELISA, specifically including the following steps: S421. The crude extract of water-soluble protein from fish muscle, arginine kinase from blue crab and recombinant creatine kinase from grass carp are diluted with diluent and added to the well plate at a concentration of 150 ng / well. S422. After coating, the well plate is thoroughly washed with TBST, and then sealed at 37°C for 2.5 hours with 5% skim milk added. S423. After the sealing is completed, rabbit anti-crayfish arginine kinase IgG polyclonal antibody diluted with TBST in a gradient is added to the well plate. The bound IgG antibody is detected by HRP-labeled goat anti-human IgE diluted 1:20000. S424. After developing the substrate in TMB solution at 37°C for 20-30 min, add 2M H2SO4 to terminate the reaction, and detect the absorbance of the liquid in the well plate at 450 nm.
10. The method for analyzing the sensitization and immune cross-reactivity of fish creatine kinase according to claim 1, characterized in that, In step S4, the degree of IgE cross-reactivity between the recombinant grass carp creatine kinase and the blue crab arginine kinase is quantified by inhibitory dot hybridization, specifically including the following sub-steps: S431. Pre-incubate the serum of allergic patients with blue crab arginine kinase at room temperature for 3 hours to obtain pre-adsorbed serum; S432. Using the pre-adsorbed serum as the primary antibody, the IgE binding activity of recombinant grass carp creatine kinase was detected by a nitrocellulose membrane solid-phase dot hybridization system. S433. Calculate the inhibition rate using the following formula: If the inhibition rate is ≥50%, then significant IgE cross-reactivity is considered to exist.